Identification of human cyclin-dependent kinase 8, a putative protein kinase partner for cyclin C.

Metazoan cyclin C was originally isolated by virtue of its ability to rescue Saccharomyces cerevisiae cells deficient in G1 cyclin function. This suggested that cyclin C might play a role in cell cycle control, but progress toward understanding the function of this cyclin has been hampered by the lack of information on a potential kinase partner. Here we report the identification of a human protein kinase, K35 [cyclin-dependent kinase 8 (CDK8)], that is likely to be a physiological partner of cyclin C. A specific interaction between K35 and cyclin C could be demonstrated after translation of CDKs and cyclins in vitro. Furthermore, cyclin C could be detected in K35 immunoprecipitates prepared from HeLa cells, indicating that the two proteins form a complex also in vivo. The K35-cyclin C complex is structurally related to SRB10-SRB11, a CDK-cyclin pair recently shown to be part of the RNA polymerase II holoenzyme of S. cerevisiae. Hence, we propose that human K35(CDK8)-cyclin C might be functionally associated with the mammalian transcription apparatus, perhaps involved in relaying growth-regulatory signals.

Sequence analysis of the cis-regulatory regions of the bithorax complex of Drosophila.

The bithorax complex (BX-C) of Drosophila, one of two complexes that act as master regulators of the body plan of the fly, has now been entirely sequenced and comprises approximately 315,000 bp, only 1.4% of which codes for protein. Analysis of this sequence reveals significantly overrepresented DNA motifs of unknown, as well as known, functions in the non-protein-coding portion of the sequence. The following types of motifs in that portion are analyzed: (i) concatamers of mono-, di-, and trinucleotides; (ii) tightly clustered hexanucleotides (spaced < or = 5 bases apart); (iii) direct and reverse repeats longer than 20 bp; and (iv) a number of motifs known from biochemical studies to play a role in the regulation of the BX-C. The hexanucleotide AGATAC is remarkably overrepresented and is surmised to play a role in chromosome pairing. The positions of sites of highly overrepresented motifs are plotted for those that occur at more than five sites in the sequence, when < 0.5 case is expected. Expected values are based on a third-order Markov chain, which is the optimal order for representing the BXCALL sequence.

Basal expression of the cystic fibrosis transmembrane conductance regulator gene is dependent on protein kinase A activity.

The cystic fibrosis transmembrane conductance regulator (CFTR) functions as a Cl- channel that becomes activated after phosphorylation by cAMP-dependent protein kinase (PKA). We demonstrate that PKA also plays a crucial role in maintaining basal expression of the CFTR gene in the human colon carcinoma cell line T84. Inhibition of PKA activity by expression of a dominant-negative regulatory subunit or treatment with the PKA-selective inhibitor N-[2-(p-bromocinnamylamino)ethyl]-5-isoquinolinesulfonamide (H-89) caused a complete suppression of CFTR gene expression without affecting other constitutively active genes. Basal expression of a 2.2-kb region of the CFTR promoter linked to a luciferase reporter gene (CFTR-luc) exhibited the same dependence on PKA. The ability of cAMP to induce CFTR over basal levels is cell-type specific. In T84 cells, both the endogenous CFTR gene and CFTR-luc exhibited only a modest inducibility (approximately 2-fold), whereas in the human choriocarcinoma cell line JEG-3, CFTR-luc could be induced at least 4-fold. A variant cAMP-response element is present at position -48 to -41 in the CFTR promoter, and mutation of this sequence blocks basal expression. We conclude that cAMP, acting through PKA, is an essential regulator of basal CFTR gene expression and may mediate an induction of CFTR in responsive cell types.

Modulation of c-Myb-induced transcription activation by a phosphorylation site near the negative regulatory domain.

The c-myb protooncogene encodes a highly conserved transcription factor that functions as both an activator and a repressor of transcription. The v-myb oncogenes of E26 leukemia virus and avian myeloblastosis virus encode proteins that are truncated at both the amino and the carboxyl terminus, deleting portions of the c-Myb DNA-binding and negative regulatory domains. This has led to speculation that the deleted regions contain important regulatory sequences. We previously reported that the 42-kDa mitogen-activated protein kinase (p42mapk) phosphorylates chicken and murine c-Myb at multiple sites in the negative regulatory domain in vitro, suggesting that phosphorylation might provide a mechanism to regulate c-Myb function. We now report that three tryptic phosphopeptides derived from in vitro phosphorylated c-Myb comigrate with three tryptic phosphopeptides derived from metabolically labeled c-Myb immunoprecipitated from murine erythroleukemia cells. At least two of these peptides are phosphorylated on serine-528. Replacement of serine-528 with alanine results in a 2- to 7-fold increase in the ability of c-Myb to transactivate a Myb-responsive promoter/reporter gene construct. These findings suggest that phosphorylation serves to regulate c-Myb activity and that loss of this phosphorylation site from the v-Myb proteins may contribute to their transforming potential.

Meso1, a basic-helix-loop-helix protein involved in mammalian presomitic mesoderm development.

To identify genes involved in the regulation of early mammalian development, we have developed a dominant-negative mutant basic-helix-loop-helix (bHLH) protein probe for interaction cloning and have isolated a member of the bHLH family of transcription factors, Meso1. Meso1-E2A heterodimers are capable of binding to oligonucleotide probes that contain a bHLH DNA recognition motif. In mouse embryos, Meso1 is expressed prior to MyoD1 family members. Meso1 expression is first detected at the neural plate stage of development in the paraxial mesoderm of the head and in presomitic mesodermal cells prior to their condensation into somites. Our findings suggest that Meso1 may be a key regulatory gene involved in the early events of vertebrate mesoderm differentiation.

Chimeric plant calcium/calmodulin-dependent protein kinase gene with a neural visinin-like calcium-binding domain.

Calcium, a universal second messenger, regulates diverse cellular processes in eukaryotes. Ca2+ and Ca2+/calmodulin-regulated protein phosphorylation play a pivotal role in amplifying and diversifying the action of Ca(2+)-binding domain was cloned and characterized from lily. The cDNA clone contains an open reading frame coding for a protein of 520 amino acids. The predicted structure of CCaMK contains a catalytic domain followed by two regulatory domains, a calmodulin-binding domain and a visinin-like Ca(2+)-binding domain. The amino-terminal region of CCaMK contains all 11 conserved subdomains characteristic of serine/threonine protein kinases. The calmodulin-binding region of CCaMK has high homology (79%) to alpha subunit of mammalian Ca2+/calmodulin-dependent protein kinase. The calmodulin-binding region is fused to a neural visinin-like domain that contains three Ca(2+)-binding EF-hand motifs and a biotin-binding site. The Escherichia coli-expressed protein (approximately 56 kDa) binds calmodulin in a Ca(2+)-dependent manner. Furthermore, 45Ca-binding assays revealed that CCaMK directly binds Ca2+. The CCaMK gene is preferentially expressed in developing anthers. Southern blot analysis revealed that CCaMK is encoded by a single gene. The structural features of the gene suggest that it has multiple regulatory controls and could play a unique role in Ca2+ signaling in plants.

Genetic and biochemical dissection of protein linkages in the cadherin-catenin complex.

The cadherin-catenin complex is important for mediating homotypic, calcium-dependent cell-cell interactions in diverse tissue types. Although proteins of this complex have been identified, little is known about their interactions. Using a genetic assay in yeast and an in vitro protein-binding assay, we demonstrate that beta-catenin is the linker protein between E-cadherin and alpha-catenin and that E-cadherin does not bind directly to alpha-catenin. We show that a 25-amino acid sequence in the cytoplasmic domain of E-cadherin and the amino-terminal domain of alpha-catenin are independent binding sites for beta-catenin. In addition to beta-catenin and plakoglobin, another member of the armadillo family, p120 binds to E-cadherin. However, unlike beta-catenin, p120 does not bind alpha-catenin in vitro, although a complex of p120 and endogenous alpha-catenin could be immunoprecipitated from cell extracts. In vitro protein-binding assays using recombinant E-cadherin cytoplasmic domain and alpha-catenin revealed two catenin pools in cell lysates: an approximately 1000- to approximately 2000-kDa complex bound to E-cadherin and an approximately 220-kDa pool that did not contain E-cadherin. Only beta-catenin in the approximately 220-kDa pool bound exogenous E-cadherin. Delineation of these molecular linkages and the demonstration of separate pools of catenins in different cell lines provide a foundation for examining regulatory mechanisms involved in the assembly and function of the cadherin-catenin complex.

Stathmin interaction with a putative kinase and coiled-coil-forming protein domains.

Stathmin is a ubiquitous, cytosolic 19-kDa protein, which is phosphorylated on up to four sites in response to many regulatory signals within cells. Its molecular characterization indicates a functional organization including an N-terminal regulatory domain that bears the phosphorylation sites, linked to a putative alpha-helical binding domain predicted to participate in coiled-coil, protein-protein interactions. We therefore proposed that stathmin may play the role of a relay integrating diverse intracellular regulatory pathways; its action on various target proteins would be a function of its combined phosphorylation state. To search for such target proteins, we used the two-hybrid screen in yeast, with stathmin as a "bait." We isolated and characterized four cDNAs encoding protein domains that interact with stathmin in vivo. One of the corresponding proteins was identified as BiP, a member of the hsp70 heat-shock protein family. Another is a previously unidentified, putative serine/threonine kinase, KIS, which might be regulated by stathmin or, more likely, be part of the kinases controlling its phosphorylation state. Finally, two clones code for subdomains of two proteins, CC1 and CC2, predicted to form alpha-helices participating in coiled-coil interacting structures. Their isolation by interaction screening further supports our model for the regulatory function of stathmin through coiled-coil interactions with diverse downstream targets via its presumed alpha-helical binding domain. The molecular and biological characterization of KIS, CC1, and CC2 proteins will give further insights into the molecular functions and mechanisms of action of stathmin as a relay of integrated intracellular regulatory pathways.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Membrane cofactor protein (CD46) is a keratinocyte receptor for the M protein of the group A streptococcus.

The pathogenic Gram-positive bacterium Streptococcus pyogenes (group A streptococcus) is the causative agent of numerous suppurative diseases of human skin. The M protein of S. pyogenes mediates the adherence of the bacterium to keratinocytes, the most numerous cell type in the epidermis. In this study, we have constructed and analyzed a series of mutant M proteins and have shown that the C repeat domain of the M molecule is responsible for cell recognition. The binding of factor H, a serum regulator of complement activation, to the C repeat region of M protein blocked bacterial adherence. Factor H is a member of a large family of complement regulatory proteins that share a homologous structural motif termed the short consensus repeat. Membrane cofactor protein (MCP), or CD46, is a short consensus repeat-containing protein found on the surface of keratinocytes, and purified MCP could competitively inhibit the adherence of S. pyogenes to these cells. Furthermore, the M protein was found to bind directly to MCP, whereas mutant M proteins that lacked the C repeat domain did not bind MCP, suggesting that recognition of MCP plays an important role in the ability of the streptococcus to adhere to keratinocytes.

The role of mechanistic target of rapamycin (mTOR) pathway and synaptic protein GABAA-R in cortical GABAergic cell connectivity

Quelque 30 % de la population neuronale du cortex mammalien est composée d’une population très hétérogène d’interneurones GABAergiques. Ces interneurones diffèrent quant à leur morphologie, leur expression génique, leurs propriétés électrophysiologiques et leurs cibles subcellulaires, formant une riche diversité. Après leur naissance dans les éminences ganglioniques, ces cellules migrent vers les différentes couches corticales. Les interneurones GABAergiques corticaux exprimant la parvalbumin (PV), lesquels constituent le sous-type majeur des interneurones GABAergiques, ciblent spécifiquement le soma et les dendrites proximales des neurones principaux et des neurones PV+. Ces interneurones sont nommés cellules à panier (Basket Cells –BCs) en raison de la complexité morphologique de leur axone. La maturation de la connectivité distincte des BCs PV+, caractérisée par une augmentation de la complexité de l’axone et de la densité synaptique, se déroule graduellement chez la souris juvénile. Des travaux précédents ont commencé à élucider les mécanismes contrôlant ce processus de maturation, identifiant des facteurs génétiques, l’activité neuronale ainsi que l’expérience sensorielle. Cette augmentation marquante de la complexité axonale et de la synaptogénèse durant cette phase de maturation suggère la nécessité d’une synthèse de protéines élevée. La voie de signalisation de la cible mécanistique de la rapamycine (Mechanistic Target Of Rapamycin -mTOR) a été impliquée dans le contrôle de plusieurs aspects neurodéveloppementaux en régulant la synthèse de protéines. Des mutations des régulateurs Tsc1 et Tsc2 du complexe mTOR1 causent la sclérose tubéreuse (TSC) chez l’humain. La majorité des patients TSC développent des problèmes neurologiques incluant des crises épileptiques, des retards mentaux et l’autisme. D’études récentes ont investigué le rôle de la dérégulation de la voie de signalisation de mTOR dans les neurones corticaux excitateurs. Toutefois, son rôle dans le développement des interneurones GABAergiques corticaux et la contribution spécifique de ces interneurones GABAergiques altérés dans les manifestations de la maladie demeurent largement inconnus. Ici, nous avons investigué si et comment l’ablation du gène Tsc1 perturbe le développement de la connectivité GABAergique, autant in vitro que in vivo. Pour investiguer le rôle de l’activation de mTORC1 dans le développement d’une BC unique, nous avons délété le gène Tsc1 en transfectant CRE-GFP dirigé par un promoteur spécifique aux BCs dans des cultures organotypiques provenant de souris Tsc1lox. Le knockdown in vitro de Tsc1 a causé une augmentation précoce de la densité des boutons et des embranchements terminaux formés par les BCs mutantes, augmentation renversée par le traitement à la rapamycine. Ces données suggèrent que l’hyperactivation de la voie de signalisation de mTOR affecte le rythme de la maturation des synapses des BCs. Pour investiguer le rôle de mTORC1 dans les interneurones GABAergiques in vivo, nous avons croisé les souris Tsc1lox avec les souris Nkx2.1-Cre et PV-Cre. À P18, les souris Tg(Nkx2.1-Cre);Tsc1flox/flox ont montré une hyperactivation de mTORC1 et une hypertrophie somatique des BCs de même qu’une augmentation de l’expression de PV dans la région périsomatique des neurones pyramidaux. Au contraire, à P45 nous avons découvert une réduction de la densité des punctas périsomatiques PV-gephyrin (un marqueur post-synaptique GABAergique). L’étude de la morphologie des BCs en cultures organotypiques provenant du knock-out conditionnel Nkx2.1-Cre a confirmé l’augmentation initiale du rythme de maturation, lequel s’effondre ensuite aux étapes développementales tardives. De plus, les souris Tg(Nkx2.1Cre);Tsc1flox/flox montrent des déficits dans la mémoire de travail et le comportement social et ce d’une façon dose-dépendante. En somme, ces résultats suggèrent que l’activation contrôlée de mTOR régule le déroulement de la maturation et la maintenance des synapses des BCs. Des dysfonctions de la neurotransmission GABAergique ont été impliquées dans des maladies telles que l’épilepsie et chez certains patients, elles sont associées avec des mutations du récepteur GABAA. De quelle façon ces mutations affectent le processus de maturation des BCs demeuret toutefois inconnu. Pour adresser cette question, nous avons utilisé la stratégie Cre-lox pour déléter le gène GABRA1, codant pour la sous-unité alpha-1 du récepteur GABAA dans une unique BC en culture organotypique. La perte de GABRA1 réduit l’étendue du champ d’innervation des BCs, suggérant que des variations dans les entrées inhibitrices en raison de l’absence de la sous-unité GABAAR α1 peuvent affecter le développement des BCs. La surexpression des sous-unités GABAAR α1 contenant des mutations identifiées chez des patients épileptiques ont montré des effets similaires en termes d’étendue du champ d’innervation des BCs. Pour approfondir, nous avons investigué les effets de ces mutations identifiées chez l’humain dans le développement des épines des neurones pyramidaux, lesquelles sont l’endroit privilégié pour la formation des synapses excitatrices. Somme toute, ces données montrent pour la première fois que différentes mutations de GABRA1 associées à des syndromes épileptiques peuvent affecter les épines dendritiques et la formation des boutons GABAergiques d’une façon mutation-spécifique.

Temporal Control of Leaf Complexity by miRNA-Regulated Licensing of Protein Complexes

The tremendous diversity of leaf shapes has caught the attention of naturalists for centuries. In addition to interspecific and intraspecific differences, leaf morphologies may differ in single plants according to age, a phenomenon known as heteroblasty. In Arabidopsis thaliana, the progression from the juvenile to the adult phase is characterized by increased leaf serration. A similar trend is seen in species with more complex leaves, such as the A. thaliana relative Cardamine hirsuta, in which the number of leaflets per leaf increases with age. Although the genetic changes that led to the overall simpler leaf architecture in A. thaliana are increasingly well understood, less is known about the events underlying age-dependent changes within single plants, in either A. thaliana or C. hirsuta. Here, we describe a conserved miRNA transcription factor regulon responsible for an age-dependent increase in leaf complexity. In early leaves, miR319-targeted TCP transcription factors interfere with the function of miR164-dependent and miR164-independent CUC proteins, preventing the formation of serrations in A. thaliana and of leaflets in C. hirsuta. As plants age, accumulation of miR156-regulated SPLs acts as a timing cue that destabilizes TCP-CUC interactions. The destabilization licenses activation of CUC protein complexes and thereby the gradual increase of leaf complexity in the newly formed organs. These findings point to posttranslational interaction between unrelated miRNA-targeted transcription factors as a core feature of these regulatory circuits.

Transient Activation of Meox1 Is an Early Component of the Gene Regulatory Network Downstream of Hoxa2

Hox genes encode transcription factors that regulate morphogenesis in all animals with bilateral symmetry. Although Hox genes have been extensively studied, their molecular function is not clear in vertebrates, and only a limited number of genes regulated by Hox transcription factors have been identified. Hoxa2 is required for correct development of the second branchial arch, its major domain of expression. We now show that Meox1 is genetically downstream from Hoxa2 and is a direct target. Meox1 expression is downregulated in the second arch of Hoxa2 mouse mutant embryos. In chromatin immunoprecipitation (ChIP), Hoxa2 binds to the Meox1 proximal promoter. Two highly conserved binding sites contained in this sequence are required for Hoxa2-dependent activation of the Meox1 promoter. Remarkably, in the absence of Meox1 and its close homolog Meox2, the second branchial arch develops abnormally and two of the three skeletal elements patterned by Hoxa2 are malformed. Finally, we show that Meox1 can specifically bind the DNA sequences recognized by Hoxa2 on its functional target genes. These results provide new insight into the Hoxa2 regulatory network that controls branchial arch identity.

Evidence for two protein coding transcripts at the Igf2as locus

The insulin-like growth factor 2 antisense (Igf2as) gene is part of the Ins-Igf2-H19 imprinted gene cluster. The function of the paternally expressed Igf2as is still elusive. In our previous work, we showed that Igf2as transcripts were located in the cytoplasm of C2C12 mouse myoblast cells, associated with polysomes and polyadenylated suggesting that Igf2as is protein coding. In the present work, the protein coding capacity of Igf2as was investigated. We demonstrate for the first time the existence of a polypeptide translated from an Igf2as construct. Furthermore, an RNA-Seq analysis was performed using RNA prepared from skeletal muscles of newborn wild-type and ∆ DMR1-U2 mice to further elucidate the function of Igf2as transcripts. We found no evidence for a regulatory role of Igf2as in the imprinted gene cluster. Interestingly, the RNA-Seq analysis indicated that Igf2as plays a role in the energy metabolism, the cell cycle, histone acetylation and muscle contraction pathways. Our Igf2as investigations further elucidated that there are two distinct Igf2as transcripts corresponding to two putative ORFs.

Protein Hydrolysis and Nitrogen Remobilisation in Plant Life and Senescence

In plant cells, as in all other cells, proteins are submitted to permanent turnover, and the intracellular content of a given protein depends on its rate of both synthesis and degradation. The life time of most proteins is shorter than that of the cell. Thus, in young leaves of Lemna minor, the average half-life of protein was estimated to be 7 days, and it was shorter under stress conditions (Davies 1982). Such observations mean that nitrogen and amino acid fluxes are both cylic and permanent. Although protein turnover may appear wasteful, in terms of energy, numerous studies have shown that proteolysis provides multiple functions in cell physiology, and is an essential regulatory mechanism of cell metabolism and development.