900 resultados para Region of Origin
Resumo:
Elena Makarova traces how the concept of intercultural education in German-speaking European countries promotes the inclusion of courses in the Language and Culture of Origin (LCO) for immigrant youth in the school curriculum of host countries. Such courses are assumed to have positive effects on the development of immigrant youth in the host country. Particularly, it has been suggested that participation in LCO courses increases the self-esteem of immigrant youth, facilitates the development of their bicultural identity and improves their integration in the host society. However, there is a lack of empirical evidence on the nature of the effects of LCO course attendance on the acculturation of immigrant youth and their cultural identity. Accordingly, the aim of the study detailed in the chapter is to examine the impact of immigrant youth’s attitudes towards LCO courses and of their attendance of such courses on their acculturation and cultural identity.
Resumo:
A 1887-bp region at the 5' flank of the human p75 tumor necrosis factor receptor (p75 TNF-R)-encoding gene was found to be active in driving expression of the luc (luciferase-encoding) reporter gene, suggesting that it contains the promoter for the receptor. Rather unexpectedly, a 1827-bp region at the 3' end of the first intron of the p75 TNF-R gene also displayed promoter activity. This activity may be artefactual, reflecting only the presence of an enhancer in this region; yet it also raises the possibility that p75 TNF-R is controlled by more than one promoter and that it encodes various forms of the receptor, or even other proteins. We present here the nucleotide sequences of the 5' flanking and intron regions. Possible implications for the transcriptional regulation of the p75 TNF-R gene are discussed.
Resumo:
BACKGROUND Numerous studies have shown that the preconceptional use of folic acid prevents neural tube defects. We created a study to find out whether the preconceptional use of folic acid has improved in the past 10 years, in the area of Münsterlingen, Switzerland. MATERIAL AND METHODS We interviewed 2 groups of patients who delivered at our Institution, namely between 2000 and 2002 (period A) involving 287 women and from 2009 to 2010 (period B) involving 305 pregnant women. We asked them whether they used folic acid by means of a standardised questionnaire. RESULTS In period B significantly more women have taken folic acid preconceptionally (period A: 27.5% vs. period B: 40.7%; p=0.001). A significant increase in folic acid intake was seen in the German speaking group from period A to B (30.3% vs. 52.7%; p=0.0005), while this was not the case in the non-German speaking group (21.4% in both periods). More multiparaé women were taking folic acid compared to nulliparae. A significant increase from period A to B was noted only in the German speaking group. Unexpectedly, in nulliparae non-German speaking women, folic acid supplementation decreased from 14% to 6.1%. DISCUSSION We have found a significant increase in preconceptional folic acid supplementation from 2001 to 2010. The percentage of women taking folic acid is disappointingly low in all groups, particularly in nulliparae women of non-German ethnicity.
Resumo:
BACKGROUND Chronic hepatitis B virus (HBV) infection affects up to 7 % of the European population. Specific HBV genotypes are associated with rapid progression to end-stage liver disease and sub-optimal interferon treatment responses. Although the geographic distribution of HBV genotypes differs between regions, it has not been studied in Switzerland, which lies at the crossroads of Europe. METHODS In a retrospective analysis of 465 HBV samples collected between 2002 and 2013, we evaluated the HBV genotype distribution and phylogenetic determinants, as well as the prevalence of serological evidence of hepatitis delta, hepatitis C and HIV infections in Switzerland. Baseline characteristics of patients were compared across their region of origin using Fisher's exact test and ANOVA, and risk factors for HBeAg positivity were assessed using logistic regression. RESULTS The Swiss native population represented 15.7 % of HBV-infected patients living in Switzerland. In the overall population, genotype D was most prevalent (58.3 %), whereas genotype A (58.9 %) was the predominant genotype among the Swiss native population. The prevalence of patients with anti-HDV antibodies was 4.4 %. Patients of Swiss origin were most likely to be HBeAg-positive (38.1 %). HBV genotypes of patients living in Switzerland but sharing the same original region of origin were consistent with their place of birth. CONCLUSIONS The molecular epidemiology of HBV infection in Switzerland is driven by migration patterns and not by the genotype distribution of the native population. The prevalence of positive anti-HDV antibodies in our cohort was very low.
Resumo:
Aims. We report on the first major temporal morphological changes observed on the surface of the nucleus of comet 67P/Churyumov-Gerasimenko in the smooth terrains of the Imhotep region. Methods. We used images of the OSIRIS cameras onboard Rosetta to follow the temporal changes from 24 May 2015 to 11 July 2015. Results. The morphological changes observed on the surface are visible in the form of roundish features that are growing in size from a given location in a preferential direction at a rate of 5.6-8.1 x 10(-5) m s(-1) during the observational period. The location where the changes started and the contours of the expanding features are bluer than the surroundings, which suggests that ices (H2O and/or CO2) are exposed on the surface. However, sublimation of ices alone is not sufficient to explain the observed expanding features. No significant variations in the dust activity pattern are observed during the period of changes.
Resumo:
Since the tragic events of September, 11 2001 the United States bioterrorism and disaster preparedness has made significant progress; yet, numerous research studies of nationwide hospital emergency response have found alarming shortcomings in surge capacity and training level of health care personnel in responding to bioterrorism incidents. The primary goals of this research were to assess hospital preparedness towards the threat of bioterrorist agents in the Southwest Region of the United States and provide recommendations for its improvement. Since little formal research has been published on the hospital preparedness of Oklahoma, Arizona, Texas and New Mexico, this research study specifically focused on the measurable factors affecting the respective states' resources and level of preparedness, such as funding, surge capacity and preparedness certification status.^ Over 300 citations of peer-reviewed articles and 17 Web sites were reviewed, of which 57 reports met inclusion criteria. The results of the systematic review highlighted key gaps in the existing literature and the key targets for future research, as well as identified strengths and weaknesses of the hospital preparedness in the Southwest states compared to the national average. ^ Based on the conducted research, currently, the Southwest states hospital systems are unable fully meet presidential preparedness mandates for emergency and disaster care: the staffed beds to 1,000 population value fluctuated around 1,5 across the states; funding for the hospital preparedness lags behind hospital costs by millions of dollars; and public health-hospital partnership in bioterrorism preparedness is quite weak as evident in lack of joint exercises and training. However, significant steps towards it are being made, including on-going hospital preparedness certification by the Joint Commission of Health Organization. Variations in preparedness levels among states signify that geographic location might determine a hospital level of bioterrorism preparedness as well, tending to favor bigger states such as Texas.^ Suggested recommendations on improvement of the hospital bioterrorism preparedness are consistent with the existing literature and include establishment and maintenance of solid partnerships between hospitals and public health agencies, conduction of joint exercises and drills for the health care personnel and key partners, improved state and federal funding specific to bioterrorism preparedness objectives, as well as on-going training of the clinical personnel on recognition of the bioterrorism agents.^
Resumo:
It is the aim of this paper to examine iron supplementation programs which receive funding from United States Agency for International Development (USAID) but approach combating iron deficiency anemia in two vastly different ways. A brief literature review and background information on iron deficiencies and the differences between supplementation programs and micronutrient fortification were reviewed. Two non-governmental organizations (NGO's) were examined for this paper: the Food and Nutrition Technical Assistance II (FANTA) and the MicroNutrient Initiative. The FANTA program included an educational component to their supplementation program while the MicroNutrient Initiative solely used supplementation of micronutrients to their population. Methods used were cost-benefit analysis and cost-effectiveness analysis to determine the overall effectiveness of each program in reducing iron deficiency anemia in each population, if the added costs of the incentives in the FANTA program changed the cost-effectiveness of the program compared to the MicroNutrient Initiative program and to determine which program imparted the greatest benefit to each population by reducing the disease burden in Disability Adjusted Life Years (DALY). Results showed that the unit cost of the FANTA program per person was higher than the MicroNutrient Initiative program due to the educational component. The FANTA program reduced iron deficiency anemia less overall but cost less for each percentage point of anemia decreased in their respective populations. The MicroNutrient Initiative program had a better benefit cost ratio for the populations it served. The MicroNutrient Initiative's large scale program imparted many advantages by reducing unit cost per person and decreasing iron deficiency anemia. The FANTA program was more effective at decreasing iron deficiency anemia with less money: $5,660 per 1% decrease in iron deficiency anemia versus $18,450 per 1% decrease in iron deficiency anemia for the MicroNutrient Initiative program. ^ In conclusion, economic analysis cannot measure all of the benefits associated with programs that contain an educational component or large scale supplementation. More information needs to be gathered by NGOs and reported to USAID, such as detailed prevalence rates of iron deficiency anemia among the populations served. Further research is needed to determine the effects an educational supplementation program has on compliance rates of participants and motivation to participate in supplementation programs whose aim is to decrease iron deficiency anemia in a targeted population.^
Commercial Sexual Exploitation and Missing Children in the Coastal Region of Sao Paulo State, Brazil
Resumo:
The commercial sexual exploitation of children (CSEC) has emerged as one of the world’s most heinous crimes. The problem affects millions of children worldwide and no country or community is fully immune from its effects. This paper reports first generation research of the relationship that exists between CSEC and the phenomenon of missing children living in and around the coastal regions of the state of Sao Paulo, Brazil, the country’s richest State. Data are reported from interviews and case records of 64 children and adolescents, who were receiving care through a major youth serving non-governmental organization (NGO) located in the coastal city of Sao Vicente. Also, data about missing children and adolescents were collected from Police Reports – a total of 858 Police Reports. In Brazil, prostitution is not a crime itself, however, the exploitation of prostitution is a crime. Therefore, the police have no information about children or adolescents in this situation, they only have information about the clients and exploiters. Thus, this investigation sought to accomplish two objectives: 1) to establish the relationship between missing and sexual exploited children; and 2) to sensitize police and child-serving authorities in both the governmental and nongovernmental sectors to the nature, extent, and seriousness of many unrecognized cases of CSEC and missing children that come to their attention. The observed results indicated that the missing children police report are significantly underestimated. They do not represent the number of children that run away and/or are involved in commercial sexual exploitation.
Resumo:
Tumor Suppressor Candidate 2 (TUSC2) is a novel tumor suppressor gene located in the human chromosome 3p21.3 region. TUSC2 mRNA transcripts could be detected on Northern blots in both normal lung and some lung cancer cell lines, but no endogenous TUSC2 protein could be detected in a majority of lung cancer cell lines. Mechanisms regulating TUSC2 protein expression and its inactivation in primary lung cancer cells are largely unknown. We investigated the role of the 5’- and 3’-untranslated regions (UTRs) of the TUSC2 gene in the regulation of TUSC2 protein expression. We found that two small upstream open-reading frames (uORFs) in the 5’UTR of TUSC2 could markedly inhibit the translational initiation of TUSC2 protein by interfering with the “scanning” of the ribosome initiation complexes. Site-specific stem-loop array reverse transcription-polymerase chain reaction (SLA-RT-PCR) verified several micoRNAs (miRNAs) targeted at 3’UTR and directed TUSC2 cleavage and degradation. In addition, we used the established let-7-targeted high mobility group A2 (Hmga2) mRNA as a model system to study the mechanism of regulation of target mRNA by miRNAs in mammalian cells under physiological conditions. There have been no evidence of direct link between mRNA downregulation and mRNA cleavages mediated by miRNAs. Here we showed that the endonucleolytic cleavages on mRNAs were initiated by mammalian miRNA in seed pairing style. Let-7 directed cleavage activities among the eight predicted potential target sites have varied efficiency, which are influenced by the positional and the structural contexts in the UTR. The 5’ cleaved RNA fragments were mostly oligouridylated at their 3’-termini and accumulated for delayed 5’–3’ degradation. RNA fragment oligouridylation played important roles in marking RNA fragments for delayed bulk degradation and in converting RNA degradation mode from 3’–5’ to 5’–3’ with cooperative efforts from both endonucleolytic and non-catalytic miRNA-induced silencing complex (miRISC). Our findings point to a mammalian miRNA-mediated mechanism for the regulation of mRNA that miRNA can decrease target mRNA through target mRNA cleavage and uridine addition
Resumo:
Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^