Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Análise química da madeira e casca de diferentes tipos de eucalipto antes e durante o cultivo de shiitake em toras

Avaliaram-se a composição química da madeira e da casca de sete espécies (E. saligna E. grandis, E. urophylla, E. camaldulensis, E. citriodora, E. paniculata e E. pellita) e três clones de eucalipto (híbridos de E. grandis x E. urophylla), antes e durante o cultivo das linhagens LE-95/01 e LE-96/18 de shiitake (Lentinula edodes), em toras. Cada linhagem de shiitake foi inoculada em nove toras de cada tipo de eucalipto com 1 m de comprimento e 9 a 14 cm de diâmetro. Assim, o delineamento experimental foi inteiramente casualizado, com 20 tratamentos e nove repetições, sendo cada repetição correspondente a uma tora. As toras foram mantidas em estufa climatizada, com temperatura de 25 ºC ± 5 e umidade relativa do ar entre 60-80%, durante 12 meses. Para a determinação da composição química da madeira, analisaram-se cunhas de discos e cascas de eucalipto recém-cortadas (sem inoculação das linhagens de L. edodes) e cunhas de discos e cascas retirados de toras já inoculadas com as linhagens de L. edodes após oito meses de incubação. Os resultados mostraram diferenças nos teores de holocelulose, lignina e extrativos totais na madeira e casca após o corte e depois de oito meses de incubação nas espécies e clones de eucalipto; o maior índice de decomposição da holocelulose na madeira, ao longo do tempo, ocorreu no E. saligna (5,5%), indicando, assim, ser o mais favorável para o desenvolvimento micelial do L. edodes. Já na casca aconteceu no clone 24 (22,2%). O E. camaldulensis apresentou o maior índice de decomposição da lignina na madeira (6,8%), ao longo do tempo. Já na casca, entre os eucaliptos testados, o E. grandis sofreu a maior decomposição de lignina (21,9%); o L. edodes degradou muito mais a holocelulose e lignina da casca que da madeira, tornando evidente a importância da casca; a casca da maioria dos tipos de eucaliptos apresentou menor teor de holocelulose, maior teor de extrativos totais e teores de lignina semelhantes ou superiores quando comparados com a madeira. O fator tipo de eucalipto (espécies e clones) teve maior efeito que o fator linhagem de L. edodes na degradação da holocelulose e lignina.

Avaliação, identificação e atividade enzimática de bactérias psicotróficas presentes no leite cru refrigerado

Extended storage of refrigerated milk can lead to reduced quality of raw and processed milk, which is a consequence of the growth and metabolic activities of psychrotrophic bacteria, able to grow under 7oC or lower temperatures. Although most of these microorganisms are destroyed by heat treatment, some have the potential to produce termoresistant proteolytic and lipolytic enzymes that can survive even UHT processing and reduce the processed products quality. Recently, the IN 51 determineds that milk should be refrigerated and stored at the farm what increased the importance of this group of microorganisms. In this work, psychrotrophic bacteria were isolated from 20 communitarian bulk tanks and 23 individual bulk tanks from dairy farms located at Zona da Mata region of Minas Gerais State and from southeastern Rio de Janeiro. Selected milk dilutions were plated on standard agar and after incubation for 10 days at 7oC, five colonies were isolated, firstly using nutrient agar and after using McConkey agar for 24 hours at 21oC. The isolates were identified by morphology, Gram stain method, catalase production, fermentative/oxidative metabolism and by API 20E, API 20NE, API Staph, API Coryne or API 50 CH (BioMerieux). In order to ensure reproductibility, API was repeated for 50% of the isolates. Species identification was considered when APILAB indexes reached 75% or higher. 309 strains were isolated, 250 Gram negative and 59 Gram positive. 250 Gram negative isolates were identified as: Acinetobacter spp. (39), Aeromonas spp. (07), A. Hydrophila (16), A. sobria (1), A. caviae (1), Alcaligenes feacalis (1), Burkholderia cepacia (12), Chryseomonas luteola (3), Enterobacter sp. (1), Ewingella americana(6), Hafnia alvei (7), Klebsiella sp. (1), Klebsiella oxytoca (10), Yersinia spp. (2), Methylobacterium mesophilicum (1), Moraxella spp. (4), Pantoea spp. (16), Pasteurella sp. (1), Pseudomonas spp. (10), P. fluorescens (94), P. putida (3), Serratia spp. (3), Sphigomonas paucomobilis (1). Five isolates kept unidentified. Pseudomonas was the predominant bacteria found (43%) and P. fluorescens the predominant species (37.6%), in accordance with previous reports. Qualitative analysis of proteolytic and lipolytic activity was based on halo formation using caseinate agar and tributirina agar during 72 hours at 21oC and during 10 days at 4°C, 10oC and 7°C. Among 250 Gram negative bacteria found, 104 were identified as Pseudomonas spp. and 60,57% of this group showed proteolytic and lipolytic acitivities over all four studied temperatures. 20% of Acinetobacter, Aeromonas, Alcaligenes, Burkholderia, Chryseomonas, Methylobacterium, Moraxella presented only lipolytic activity. Some isolates presented enzymatic activity in one or more studied temperatures. Among Gram positive bacteria, 30.51% were proteolytic and lipolytic at 10oC, 8.47% were proteolytic at 7oC, 10oC, and 21oC, 8.47% were proteolytic at all studied temperatures (4oC, 7oC, 10oC and 21oC) and 3.38% were proteolytic only at 21oC. At 4oC, only one isolate showed proteolytic activity and six isolates were lipolytic. In relation to Gram negative microorganisms, 4% were proteolytic and lipolytic at 7oC, 10oC and 21oC, 10% were proteolytic at 10oC and 4.4% were lipolytic at 4oC, 7oC, 10oC and 21oC, while 6.4% of all isolates were proteolytic and lipolytic at 10oC and 21oC as well as lipolytic at 4oC and 7oC. These findings are in accordance with previous researches that pointed out Pseudomonas as the predominant psycrotrophic flora in stored refrigerated raw milk

Estudo comparativo da constituição nutricional da madeira e casca de espécies e clones de Eucalipto visando o cultivo de Shiitake em toras

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Utilização de análise de segregantes agrupados na identificação de marcadores ligados a genes que controlam a resistência à ferrugem (Puccinia psidii Winter) em Eucalyptus sp.

Devido a grande importância da cultura de Eucalyptus no Brasil, empresas do setor florestal têm buscado através de programas de melhoramento genético, reduzir as perdas de produção e atender a demanda do mercado de papel e celulose. Um exemplo, é a busca por genes de resistência a doenças, principalmente a ferrugem causada por Puccinia psidii Winter, que resulta em redução da produtividade em plantas altamente suscetíveis. No presente trabalho, mudas de Eucalyptus pertencentes a uma geração F1, provenientes do cruzamento controlado entre parentais híbridos E. grandis X E. urophylla, sendo eles resistente e suscetível, foram inoculadas com Puccinia psidii em casa de vegetação e acompanhadas até o aparecimento dos sintomas da ferrugem. Foram classificadas, em dois grupos: resistentes (ausência de sintomas) e suscetíveis (presença de sintomas e esporulação). As amostras de DNA foram comparadas com o uso de marcadores moleculares associado ao método de BSA (Bulked Segregant Analysis). O polimorfismo entre os grupos foi geneticamente relacionado ao loco que determina a característica de resistência ou sucetibilidade. Dentre os 720 primers testados, 19 foram polimórficos, porém, apenas o marcador AK 01 manteve-se presente, quando testado em todos os indivíduos da população, mostrando-se a uma distância genética estimada de 20 cM em repulsão ao gene de resistência.

Bidens mosaic virus: detecção via RT-PCR e identificação de Galinsoga parviflora como um novo hospedeiro natural do vírus

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Identificação de áreas com precipitação pluvial homogênea no Estado do Rio Grande do Norte

O estudo da variabilidade da precipitação é importante para o planejamento das atividades econômicas, possibilitando o uso mais eficiente e racional dos recursos hídricos. Dessa forma, o objetivo desta pesquisa é caracterizar o estado do Rio Grande do Norte com relação à variabilidade temporal da precipitação, agrupá-lo em regiões homogêneas e comparar diferentes técnicas de agrupamento. Para o estudo da variabilidade pluvial foram utilizados os índices: Grau de Concentração de Precipitação (PCD), que representa o grau em que a precipitação é distribuída ao longo do ano; e o Período de Concentração de Precipitação (PCP), que reflete o período no qual a precipitação está mais concentrada. Para a realização dos agrupamentos foram escolhidas as variáveis: PCD, PCP, médias da precipitações anuais e médias das precipitações mensais. Posteriormente, foi aplicada a análise de agrupamento para obter grupos com características similares. Os resultados mostraram que as precipitações são melhor distribuídas na região leste do estado, neste caso, os meses mais chuvosos são de maio a agosto. Os municípios localizados nessa área possuem dois picos de chuvas, devido à atuação de dois sistemas: Perturbações Ondulatórias dos Alísios (POA s) e Zona de Convergência Intertropical (ZCIT). Nas regiões localizadas a oeste os meses que possuem maior concentração de chuvas são março e abril, neste caso temos apenas um pico de precipitação, devido a atuação da ZCIT. A identificação de áreas homogêneas favorece o planejamento adequado de acordo com as características de cada grupo formado e o RN pode foi dividido em 4 (quatro) regiões homogêneas. As técnicas de agrupamento utilizadas apresentaram resultados semelhantes, porém, sugere-se o uso de mais de uma técnica para que se possa analisar qual delas reflete melhor a realidade local. O estudo da variabilidade de precipitação, através dos índices estudados e do agrupamento realizado, são ferramentas adequadas ao planejamento ambiental e econômico

Focalização isoelétrica na identificação das hemoglobinas

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Representações espectrais de sistemas complexos: aplicações à síntese de superfícies brownianas fracionárias anisotrópicas, filtragem de sinais e identificação de correlações

In this thesis, we study the application of spectral representations to the solution of problems in seismic exploration, the synthesis of fractal surfaces and the identification of correlations between one-dimensional signals. We apply a new approach, called Wavelet Coherency, to the study of stratigraphic correlation in well log signals, as an attempt to identify layers from the same geological formation, showing that the representation in wavelet space, with introduction of scale domain, can facilitate the process of comparing patterns in geophysical signals. We have introduced a new model for the generation of anisotropic fractional brownian surfaces based on curvelet transform, a new multiscale tool which can be seen as a generalization of the wavelet transform to include the direction component in multidimensional spaces. We have tested our model with a modified version of the Directional Average Method (DAM) to evaluate the anisotropy of fractional brownian surfaces. We also used the directional behavior of the curvelets to attack an important problem in seismic exploration: the atenuation of the ground roll, present in seismograms as a result of surface Rayleigh waves. The techniques employed are effective, leading to sparse representation of the signals, and, consequently, to good resolutions

Papel de sinais cromáticos na identificação de parceiros sexuais em sagüi comum (callithrix jacchus)

The literature concerning color vision shows a trichromatic advantage in detecting ripe fruits and young leaves, but there are contradictory results. There is also the suggestion of this type of vision being adapted to perceive socio-sexual signals. Indeed, Old World primates utilize the skin color of conspecifics as a factor of attraction. But in New World primates there is no record of a coloration signal in the body that can be utilized by other group members. The present study aims to: 1- test whether there is a relation between coloration of body regions and ovulatory cycle in female Callithrix jacchus; 2- Determine if this species uses visual signals to choose mates that are sexually receptive. We collected feces from six females during one month to quantify progesterone concentration by EIA. Body region coloration was measured using a portable spectrometer and modeled to obtain the quantum catch of each photoreceptor, the opponency channels and chromatic distance between the points in units of JND. We recorded the behavior of six males exposed to three pairs of females with a cycling and a non-cycling female in each pair using a transparent plexiglass apparatus. The color of different body regions presented a correlation between progesterone concentration and the yellow-blue and red-green visual axes, with the genitalia as the region showing the highest correlation. The visual axis more apt to see the color variations was the yellow-blue in dichromats, and in trichromats were the red-green to face, yellow-blue to abdomen and both chromatic axes to genitalia. There was no difference in the signal detectability between trichromats and dichromats, but the perception pattern differed between the phenotypes, with a better signal detection by the dichromat phenotype 562 and the trichromat phenotype 543/562. During the behavioral experiments males presented longer gaze duration in periods of experimental manipulation and gaze duration was always longer towards cycling females compared to non-cycling females. Male locomotion during experimental manipulation was greater than in the control only during the periovulatory period of the female, indicating greater excitement. The behavior of cycling females was more active than the behavior of the non-cycling ones regarding locomotion and touching of the plexiglass division of the apparatus. Male gaze duration to cycling females increased with decreasing progesterone concentration, but none of the coloration parameters was correlated to the mate preference exhibited. This coloration signal can transmit information to animals of the group about fertility of female. Different from the intense red of the genitalia swellings of Old World primates, marmoset female genitalia became more bluish-green in the fertile period. Males chose fertile females and were able to visually identify the periovulatory period of females. Choice is related to progesterone concentration, but our results do not show relation between coloration and mate preference. Maybe some behavioral measure is associated with the choice

Fidelidade à área e padrão de associação em Sotalia guianensis, baseado na técnica de foto-identificação

The behavioral patterns follow to environmental changes, including area fidelity and individuals association patterns. Several techniques are used to record these behavioral patterns and the photo-identification has been suggested as a proper tool because of its various advantages. Based on this technique, this research verified, between August of 2005 and January of 2006, area fidelity and association patterns of Sotalia guianensis, at Distrito de Pipa s bays, Rio Grande do Norte State south coast. Besides, we measured the association patterns by using the Jaccard index or Half-Weight Index (HWI). According the observation, 22 individuals were not resighted, 11 were resighted, and 36 new individuals were recorded. Nowadays, 69 individuals are cataloged. The residency rate indicated heterogeneity on studied area permanence and the association patterns between photo-identified seem to be context-specific. In addiction, the comparison of associations between two different age classes showed some individuals more frequently interacting with immature individuals. We also observed fluidity on association patterns among our individuals. We suggest that S. guianensis population from Pipa shows plasticity

Desenvolvimento e teste de um modelo estatístico de identificação das proporções de água produzida em zonas de produção de um campo maduro de petróleo

This study investigates the chemical species produced water from the reservoir areas of oil production in the field of Monte Alegre (onshore production) with a proposal of developing a model applied to the identification of the water produced in different zones or groups of zones.Starting from the concentrations of anions and cátions from water produced as input parameters in Linear Discriminate Analysis, it was possible to estimate and compare the model predictions respecting the particularities of their methods in order to ascertain which one would be most appropriate. The methods Resubstitution, Holdout Method and Lachenbruch were used for adjustment and general evaluation of the built models. Of the estimated models for Wells producing water for a single production area, the most suitable method was the "Holdout Method and had a hit rate of 90%. Discriminant functions (CV1, CV2 and CV3) estimated in this model were used to modeling new functions for samples ofartificial mixtures of produced water (producedin our laboratory) and samples of mixtures actualproduced water (water collected inwellsproducingmore thanonezone).The experiment with these mixtures was carried out according to a schedule experimental mixtures simplex type-centroid also was simulated in which the presence of water from steam injectionin these tanks fora part of amostras. Using graphs of two and three dimensions was possible to estimate the proportion of water in the production area

Sensoriamento remoto na identificação do uso e ocupação da terra na área do projeto Conquista da Água, Ilha Solteira - SP, Brasil

A cidade de Ilha Solteira está propondo o projeto Conquista da Água, visando ao desenvolvimento sustentável do Município, a partir do turismo, da cultura e da ciência e tecnologia. Para atingir esse objetivo, os planejadores do meio físico-ambiental necessitam de dados que possam auxiliá-los na seleção dos melhores locais onde serão instalados as avenidas, o aeroporto e os demais espaços que comporão esse projeto. A elaboração do mapa de uso e cobertura do solo da área de interesse do projeto constitui um dos temas necessários ao banco de dados a ser utilizado pelos planejadores. Neste trabalho, é apresentado o estado de degradação dessa área, o que auxiliará na definição das estratégias de conservação ambiental.

Hidrocarbonetos policíclicos aromáticos no meio ambiente: diferenciação de fontes em sedimentos e metabólitos em bile de peixes

Many studies on environmental ecosystems quality related to polycyclic aromatic hydrocarbons (PAH) have been carried out routinely due to their ubiquotus presence worldwide and to their potential toxicity after its biotransformation. PAH may be introduced into the environmet by natural and anthropogenic processes from direct runoff and discharges and indirect atmospheric deposition. Sources of naturally occurring PAHs include natural fires, natural oil seepage and recent biological or diagenetic processes. Anthropogenic sources of PAHs, acute or chronic, are combustion of organic matter (petroleum, coal, wood), waste and releases/spills of petroleum and derivatives (river runoff, sewage outfalls, maritime transport, pipelines). Besides the co-existence of multiples sources of PAH in the environmental samples, these compounds are subject to many processes that lead to geochemical fates (physical-chemical transformation, biodegradation and photo-oxidation), which leads to an alteration of their composition. All these facts make the identification of the hydrocarbons sources, if petrogenic, pyrolytic or natural, a challenge. One of the objectives of this study is to establish tools to identify the origin of hydrocarbons in environmental samples. PAH diagnostic ratios and PAH principal component analysis were tested on a critical area: Guanabara Bay sediments. Guanabara Bay is located in a complex urban area of Rio de Janeiro with a high anthropogenic influence, being an endpoint of chronic pollution from the Greater Rio and it was the scenario of an acute event of oil release in January 2000. It were quantified 38 compounds, parental and alkylated PAH, in 21 sediment samples collected in two surveys: 2000 and 2003. The PAH levels varied from 400 to 58439 ng g-1. Both tested techniques for origin identification of hydrocarbons have shown their applicability, being able to discriminate the PAH sources for the majority of the samples analysed. The bay sediments were separated into two big clusters: sediments with a clear pattern of petrogenic introduction of hydrocarbons (from intertidal area) and sediments with combustion characteristics (from subtidal region). Only a minority of the samples could not display a clear contribution of petrogenic or pyrolytic input. The diagnostic ratios that have exhibited high ability to distinguish combustion- and petroleum-derived PAH inputs for Guanabara Bay sediments were Phenanthrene+Anthracene/(Phenanthrene+Anthracene+C1Phenanthrene); Fluorantene/(Fluorantene+Pyrene); Σ (other 3-6 ring PAHs)/ Σ (5 alkylated PAH series). The PCA results prooved to be a useful tool for PAH source identification in the environment, corroborating the diagnostic indexes. In relation to the temporal evaluation carried out in this study, it was not verified significant changes on the class of predominant source of the samples. This result indicates that the hydrocarbons present in the Guanabara Bay sediments are mainly related to the long-term anthropogenic input and not directly related to acute events such as the oil spill of January 2000. This findings were similar to various international estuarine sites. Finally, this work had a complementary objective of evaluating the level of hydrocarbons exposure of the aquatic organisms of Guanabara Bay. It was a preliminary study in which a quantification of 12 individual biliar metabolites of PAH was performed in four demersal fish representing three different families. The analysed metabolites were 1-hydroxynaphtalene, 2-hidroxinaphtalene, 1hydroxyphenanthrene, 9-hydroxyphenanthrene, 2-hydroxyphenanthrene, 1hydroxypyrene, 3-hidroxibiphenil, 3- hydroxyphenanthrene, 1-hydroxychrysene, 9hydroxyfluorene, 4-hydroxyphenanthrene, 3-hydroxybenz(a)pyrene. The metabolites concentrations were found to be high, ranging from 13 to 177 µg g-1, however they were similar to worldwide regions under high anthropogenic input. Besides the metabolites established by the used protocol, it was possible to verified high concentrations of three other compounds not yet reported in the literature. They were related to pyrolytic PAH contribution to Guanabara Bay aquatic biota: 1-hydroxypyrine and 3-hydroxybenz(a)pyrine isomers

Diferenças entre critérios normativos e autopercebidos na identificação da necessidade de tratamento ortodôntico, satisfação com a aparência e mastigação em adolescentes

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior