924 resultados para Combined informations


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The note proposes an efficient nonlinear identification algorithm by combining a locally regularized orthogonal least squares (LROLS) model selection with a D-optimality experimental design. The proposed algorithm aims to achieve maximized model robustness and sparsity via two effective and complementary approaches. The LROLS method alone is capable of producing a very parsimonious model with excellent generalization performance. The D-optimality design criterion further enhances the model efficiency and robustness. An added advantage is that the user only needs to specify a weighting for the D-optimality cost in the combined model selecting criterion and the entire model construction procedure becomes automatic. The value of this weighting does not influence the model selection procedure critically and it can be chosen with ease from a wide range of values.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A new robust neurofuzzy model construction algorithm has been introduced for the modeling of a priori unknown dynamical systems from observed finite data sets in the form of a set of fuzzy rules. Based on a Takagi-Sugeno (T-S) inference mechanism a one to one mapping between a fuzzy rule base and a model matrix feature subspace is established. This link enables rule based knowledge to be extracted from matrix subspace to enhance model transparency. In order to achieve maximized model robustness and sparsity, a new robust extended Gram-Schmidt (G-S) method has been introduced via two effective and complementary approaches of regularization and D-optimality experimental design. Model rule bases are decomposed into orthogonal subspaces, so as to enhance model transparency with the capability of interpreting the derived rule base energy level. A locally regularized orthogonal least squares algorithm, combined with a D-optimality used for subspace based rule selection, has been extended for fuzzy rule regularization and subspace based information extraction. By using a weighting for the D-optimality cost function, the entire model construction procedure becomes automatic. Numerical examples are included to demonstrate the effectiveness of the proposed new algorithm.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

There is growing interest, especially for trials in stroke, in combining multiple endpoints in a single clinical evaluation of an experimental treatment. The endpoints might be repeated evaluations of the same characteristic or alternative measures of progress on different scales. Often they will be binary or ordinal, and those are the cases studied here. In this paper we take a direct approach to combining the univariate score statistics for comparing treatments with respect to each endpoint. The correlations between the score statistics are derived and used to allow a valid combined score test to be applied. A sample size formula is deduced and application in sequential designs is discussed. The method is compared with an alternative approach based on generalized estimating equations in an illustrative analysis and replicated simulations, and the advantages and disadvantages of the two approaches are discussed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In this paper, data from spaceborne radar, lidar and infrared radiometers on the “A-Train” of satellites are combined in a variational algorithm to retrieve ice cloud properties. The method allows a seamless retrieval between regions where both radar and lidar are sensitive to the regions where one detects the cloud. We first implement a cloud phase identification method, including identification of supercooled water layers using the lidar signal and temperature to discriminate ice from liquid. We also include rigorous calculation of errors assigned in the variational scheme. We estimate the impact of the microphysical assumptions on the algorithm when radiances are not assimilated by evaluating the impact of the change in the area-diameter and the density-diameter relationships in the retrieval of cloud properties. We show that changes to these assumptions affect the radar-only and lidar-only retrieval more than the radar-lidar retrieval, although the lidar-only extinction retrieval is only weakly affected. We also show that making use of the molecular lidar signal beyond the cloud as a constraint on optical depth, when ice clouds are sufficiently thin to allow the lidar signal to penetrate them entirely, improves the retrieved extinction. When infrared radiances are available, they provide an extra constraint and allow the extinction-to-backscatter ratio to vary linearly with height instead of being constant, which improves the vertical distribution of retrieved cloud properties.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The structure of the chiral kinked Pt{531} surface has been determined by low-energy electron diffraction intensity-versus-energy (LEED-IV) analysis and density functional theory (DFT). Large contractions and expansions of the vertical interlayer distances with respect to the bulk-terminated surface geometry were found for the first six layers (LEED: d(12) = 0.44 angstrom, d(23) = 0.69 angstrom, d(34) = 0.49 angstrom, d(45) = 0.95 angstrom, d(56) = 0.56 angstrom; DFT: d(12) = 0.51 angstrom, d(23) = 0.55 angstrom, d(34) = 0.74 angstrom, d(45) = 0.78 angstrom, d(56) = 0.63 angstrom; d(bulk) = 0.66 angstrom). Energy-dependent cancellations of LEED spots over unusually large energy ranges, up to 100 eV, can be explained by surface roughness and reproduced by applying a model involving 0.25 ML of vacancies and adatoms in the scattering calculations. The agreement between the results from LEED and DFT is not as good as in other cases, which could be due to this roughness of the real surface.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fermentability of rice bran (RB), alone or in combination with one of two probiotics, by canine faecal microbiota was evaluated in stirred, pH-controlled, anaerobic batch cultures. RB enhanced the levels of bacteria detected by probes Bif164 (bifidobacteria) and Lab158 (lactic acid bacteria); however, addition of the probiotics did not have a significant effect on the predominant microbial counts compared with RB alone. RB sustained levels of Bifidobacterium longum 05 throughout the fermentation; in contrast, Lactobacillus acidophilus 14 150B levels decreased significantly after 5-h fermentation. RB fermentation induced changes in the short-chain fatty acid (SCFA) profile. However, RB combined with probiotics did not alter the SCFA levels compared with RB alone. Denaturing gradient gel electrophoresis analysis of samples obtained at 24 h showed a treatment effect with RB, which was not observed in the RB plus probiotic systems. Overall, the negative controls displayed lower species richness than the treatment systems and their banding profiles were distinct. This study illustrates the ability of a common ingredient found in pet food to modulate the canine faecal microbiota and highlights that RB may be an economical alternative to prebiotics for use in dog food.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper presents the results of the crowd image analysis challenge of the Winter PETS 2009 workshop. The evaluation is carried out using a selection of the metrics developed in the Video Analysis and Content Extraction (VACE) program and the CLassification of Events, Activities, and Relationships (CLEAR) consortium [13]. The evaluation highlights the detection and tracking performance of the authors’systems in areas such as precision, accuracy and robustness. The performance is also compared to the PETS 2009 submitted results.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We consider the classical coupled, combined-field integral equation formulations for time-harmonic acoustic scattering by a sound soft bounded obstacle. In recent work, we have proved lower and upper bounds on the $L^2$ condition numbers for these formulations, and also on the norms of the classical acoustic single- and double-layer potential operators. These bounds to some extent make explicit the dependence of condition numbers on the wave number $k$, the geometry of the scatterer, and the coupling parameter. For example, with the usual choice of coupling parameter they show that, while the condition number grows like $k^{1/3}$ as $k\to\infty$, when the scatterer is a circle or sphere, it can grow as fast as $k^{7/5}$ for a class of `trapping' obstacles. In this paper we prove further bounds, sharpening and extending our previous results. In particular we show that there exist trapping obstacles for which the condition numbers grow as fast as $\exp(\gamma k)$, for some $\gamma>0$, as $k\to\infty$ through some sequence. This result depends on exponential localisation bounds on Laplace eigenfunctions in an ellipse that we prove in the appendix. We also clarify the correct choice of coupling parameter in 2D for low $k$. In the second part of the paper we focus on the boundary element discretisation of these operators. We discuss the extent to which the bounds on the continuous operators are also satisfied by their discrete counterparts and, via numerical experiments, we provide supporting evidence for some of the theoretical results, both quantitative and asymptotic, indicating further which of the upper and lower bounds may be sharper.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Many environmental compounds with oestrogenic activity are measurable in the human breast and oestrogen is a known factor in breast cancer development. Exposure to environmental oestrogens occurs through diet, household products and cosmetics, but concentrations of single compounds in breast tissue are generally lower than needed for assayable oestrogenic responses. Results presented here and elsewhere demonstrate that in combination, chemicals can give oestrogenic responses at lower concentrations, which suggests that in the breast, low doses of many compounds could sum to give a significant oestrogenic stimulus. Updated incidence figures show a continued disproportionate incidence of breast cancer in Britain in the upper outer quadrant of the breast which is also the region to which multiple cosmetic chemicals are applied. CONCLUSION: If exposure to complex mixtures of oestrogenic chemicals in consumer products is a factor in breast cancer development, then a strategy for breast cancer prevention could become possible.