966 resultados para Pacific-specific Core Gene Sequences
Resumo:
Minisatellite core sequences were used as single primers in polymerase chain reaction (PCR) to amplify genomic DNA in a way similar to the random amplified polymorphic DNA methodology. This technique, known as Directed Amplification of Minisatellite-region DNA, was applied in order to differentiate three neotropical fish species (Brycon orbignyanus, B. microlepis and B. lundii ) and to detect possible genetic variations among samples of the threatened species, B. lundii , collected in two regions with distinct environmental conditions in the area of influence of a hydroelectric dam. Most primers generated species-specific banding patterns and high levels of intraspecific polymorphism. The genetic variation observed between the two sampling regions of B. lundii was also high enough to suggest the presence of distinct stocks of this species along the same river basin. The results demonstrated that minisatellite core sequences are potentially useful as single primers in PCR to assist in species and population identification. The observed genetic stock differentiation in B. lundii associated with ecological and demographic data constitute a crucial task to develop efficient conservation strategies in order to preserve the genetic diversity of this endangered fish species.
Resumo:
BACKGROUND Among other mismatches between human and pig, incompatibilities in the blood coagulation systems hamper the xenotransplantation of vascularized organs. The provision of the porcine endothelium with human thrombomodulin (hTM) is hypothesized to overcome the impaired activation of protein C by a heterodimer consisting of human thrombin and porcine TM. METHODS We evaluated regulatory regions of the THBD gene, optimized vectors for transgene expression, and generated hTM expressing pigs by somatic cell nuclear transfer. Genetically modified pigs were characterized at the molecular, cellular, histological, and physiological levels. RESULTS A 7.6-kb fragment containing the entire upstream region of the porcine THBD gene was found to drive a high expression in a porcine endothelial cell line and was therefore used to control hTM expression in transgenic pigs. The abundance of hTM was restricted to the endothelium, according to the predicted pattern, and the transgene expression of hTM was stably inherited to the offspring. When endothelial cells from pigs carrying the hTM transgene--either alone or in combination with an aGalTKO and a transgene encoding the human CD46-were tested in a coagulation assay with human whole blood, the clotting time was increased three- to four-fold (P<0.001) compared to wild-type and aGalTKO/CD46 transgenic endothelial cells. This, for the first time, demonstrated the anticoagulant properties of hTM on porcine endothelial cells in a human whole blood assay. CONCLUSIONS The biological efficacy of hTM suggests that the (multi-)transgenic donor pigs described here have the potential to overcome coagulation incompatibilities in pig-to-primate xenotransplantation.
Resumo:
The formation of the placenta is one of the first and most important developmental events that occur in early mammalian embryogenesis. Even given this importance of the placenta, the academic community has largely ignored studying gene regulation during the development and maturation of the placenta. For this reason, an in-depth study of gene regulation in the trophoblast layer of the placenta using murine Adenosine Deaminase (Ada) as a model system has been undertaken. It has been determined that Ada is highly expressed in the placenta and is critical for embryo development. Dr. Kellems' laboratory has previously described a 1.8 kb fragment of the Ada 5 ′ flanking region that is capable of directing trophoblast specific expression in a transgenic model system. Preliminary studies have demonstrated several critical portions of this fragment that are necessary for the correct tissue specific expression in the placenta. My first specific aim was to elucidate the trans factor binding to one of these sequences, the FP3. Through electromobility shift assays (EMSA), the 30 bp FP3 was narrowed to a 5 bp sequence which computer databases predicted bound to Acute Myeloid Leukemia 1 (AML-1). This was confirmed by supershift analysis. The functional importance of this binding was demonstrated by a transgenic approach. A significant difference in expression of the reporter in the placenta was seen when the 5 bp sequence was mutated. This finding is a novel use for the AML-1 transcription factor which is the DNA binding portion of the heterodimer Core Binding Protein (CBP). The 5′ 240 bp region has also been demonstrated to contain functionally significant sequence. Through EMSA assays and computer predictions, the area has been narrowed to two pertinent regions that are predicted to contain GATA binding motifs. ^
Resumo:
Promoter and silencer elements of the immediate 5' flanking region of the gene coding for human factor VII were identified and characterized. The major transcription start site, designated as +1, was determined by RACE (rapid amplification of cDNA ends) analysis of human liver cDNA and was found to be located 50 bp upstream from the translation start site. Two minor transcription start sites were found at bp +32 bp and +37. Progressive deletions of the 5' flanking region were fused to the chloramphenicol acetyltransferase reporter gene and transient expression in HepG2 and HeLa cells was measured. Two promoter elements that were essential for hepatocyte-specific transcription were identified. The first site, FVIIP1, located at bp -19 to +1, functioned independently of orientation or position and contributed about one-third of the promoter activity of the factor VII gene. Electrophoretic mobility-shift, competition, and anti-hepatocyte nuclear factor 4 (HNF4) antibody supershift experiments demonstrated that this site contained an HNF-4 binding element homologous to the promoters in the genes coding for factor IX and factor X. The second site, FVIIP2, located at bp -50 to -26, also functioned independent of orientation or position and contributed about two thirds of the promoter activity in the gene for factor VII. Functional assays with mutant sequences demonstrated that a 10-bp G + C-rich core sequence which shares 90% sequence identity with the prothrombin gene enhancer was essential for the function of the second site. Mobility-shift and competition assays suggested that this site also binds hepatic-specific factors as well as the transcription factor Sp1. Two silencer elements located upstream of the promoter region spanning bp -130 to -103 (FVIIS1 site) and bp -202 to -130 (FVIIS2) were also identified by reporter gene assays.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.
Resumo:
The analysis of keratin 6 expression is complicated by the presence of multiple isoforms that are expressed constitutively in a number of internal stratified epithelia, in palmoplantar epidermis, and in the companion cell layer of the hair follicle. In addition, keratin 6 expression is inducible in interfollicular epidermis and the outer root sheath of the follicle, in response to wounding stimuli, phorbol esters, or retinoic acid. In order to establish the critical regions involved in the regulation of keratin 6a (the dominant isoform in mice), we generated transgenic mice with two different-sized mouse keratin 6a constructs containing either 1.3 kb or 0.12 kb of 5' flanking sequence linked to the lacZ reporter gene. Both constructs also contained the first intron and the 3' flanking sequence of mouse keratin 6a. Ectopic expression of either transgene was not observed. Double-label immunofluorescence analyses demonstrated expression of the reporter gene in keratin 6 expressing tissues, including the hair follicle, tongue, footpad, and nail bed, showing that both transgenes retained keratinocyte-specific expression. Quantitative analysis of beta -galactosidase activity verified that both the 1.3 and 0.12 kb keratin 6a promoter constructs produced similar levels of the reporter. Notably, both constructs were constitutively expressed in the outer root sheath and interfollicular epidermis in the absence of any activating stimulus, suggesting that they lack the regulatory elements that normally silence transcription in these cells. This study has revealed that a keratin 6a minigene contains critical cis elements that mediate tissue-specific expression and that the elements regulating keratin 6 induction lie distal to the 1.3 kb promoter region.
A highly conserved c-fms gene intronic element controls macrophage-specific and regulated expression
Resumo:
The c fins gene encodes the receptor for macrophage colony-stimulating factor-1. This gene is expressed selectively in the macrophage cell lineage. Previous studies have implicated sequences in intron 2 that control transcript elongation in tissue-specific and regulated expression of c -fms. Four macrophage-specific deoxyribonuclease I (DNase I)-hypersensitive sites (DHSS) were identified within mouse intron 2. Sequences of these DHSS were found to be highly conserved compared with those in the human gene. A 250-bp region we refer to as the fins intronic regulatory element (FIRE), which is even more highly conserved than the c-fins proximal promoter, contains many consensus binding sites for macrophage-expressed transcription factors including Spl, PU.1, and C/EBP. FIRE was found to act as a macrophage-specific enhancer and as a promoter with an antisense orientation preference in transient transfections. In stable transfections of the macrophage line RAW264, as well as in clones selected for high and low-level c -fms mRNA expression, the presence of intron 2 increased the frequency and level of expression of reporter genes compared with those attained using the promoter alone. Removal of FIRE abolished reporter gene expression, revealing a suppressive activity in the remaining intronic sequences. Hence, FIRE is shown to be a key regulatory element in the fins gene.
Resumo:
A proportion of melanoma,prone individuals in both familial and non,familial contexts has been shown to carry inactivating mutations in either CDKN2A or, rarely, CDK4. CDKN2A is a complex locus that encodes two unrelated proteins from alternately spliced transcripts that are read in different frames. The alpha transcript (exons 1a, 2, and 3) produces the p16INK4A cyclin-dependent kinase inhibitor, while the beta transcript (exons 1beta and 2) is translated as p14ARF, a stabilizing factor of p53 levels through binding to MDM2. Mutations in exon 2 can impair both polypeptides and insertions and deletions in exons 1alpha, 1beta, and 2, which can theoretically generate p16INK4A,p14ARF fusion proteins. No online database currently takes into account all the consequences of these genotypes, a situation compounded by some problematic previous annotations of CDKN2A related sequences and descriptions of their mutations. As an initiative of the international Melanoma Genetics Consortium, we have therefore established a database of germline variants observed in all loci implicated in familial melanoma susceptibility. Such a comprehensive, publicly accessible database is an essential foundation for research on melanoma susceptibility and its clinical application. Our database serves two types of data as defined by HUGO. The core dataset includes the nucleotide variants on the genomic and transcript levels, amino acid variants, and citation. The ancillary dataset includes keyword description of events at the transcription and translation levels and epidemiological data. The application that handles users' queries was designed in the model,view. controller architecture and was implemented in Java. The object-relational database schema was deduced using functional dependency analysis. We hereby present our first functional prototype of eMelanoBase. The service is accessible via the URL www.wmi.usyd.e, du.au:8080/melanoma.html.
Resumo:
The gene encoding the cAMP-responsive transcription factor CREB consists of multiple small exons some of which undergo alternative RNA splicing. We describe the finding of a novel transcript of the CREB gene expressed at high levels in the germ cells of the rat testis. The transcript contains an alternatively spliced exon inserted within the sequence encoding the transcriptional transactivation domain of CREB and this exon contains multiple in-frame stop codons. Furthermore, the exon is conserved in both rat and human genes (75% nucleotide identity). Although the function(s) of this RNA or the truncated CREB protein predicted to result from the translation of this unusual transcript is unknown, the high level of expression in the testicular germ cells and remarkable conservation of sequences in rat and human suggests that it may have a unique biological function in these cells.
Biased gene conversion and GC-content evolution in the coding sequences of reptiles and vertebrates.
Resumo:
Mammalian and avian genomes are characterized by a substantial spatial heterogeneity of GC-content, which is often interpreted as reflecting the effect of local GC-biased gene conversion (gBGC), a meiotic repair bias that favors G and C over A and T alleles in high-recombining genomic regions. Surprisingly, the first fully sequenced nonavian sauropsid (i.e., reptile), the green anole Anolis carolinensis, revealed a highly homogeneous genomic GC-content landscape, suggesting the possibility that gBGC might not be at work in this lineage. Here, we analyze GC-content evolution at third-codon positions (GC3) in 44 vertebrates species, including eight newly sequenced transcriptomes, with a specific focus on nonavian sauropsids. We report that reptiles, including the green anole, have a genome-wide distribution of GC3 similar to that of mammals and birds, and we infer a strong GC3-heterogeneity to be already present in the tetrapod ancestor. We further show that the dynamic of coding sequence GC-content is largely governed by karyotypic features in vertebrates, notably in the green anole, in agreement with the gBGC hypothesis. The discrepancy between third-codon positions and noncoding DNA regarding GC-content dynamics in the green anole could not be explained by the activity of transposable elements or selection on codon usage. This analysis highlights the unique value of third-codon positions as an insertion/deletion-free marker of nucleotide substitution biases that ultimately affect the evolution of proteins.
Resumo:
We have previously demonstrated that clock genes contribute to the homeostatic aspect of sleep regulation. Indeed, mutations in some clock genes modify the markers of sleep homeostasis and an increase in homeostatic sleep drive alters clock gene expression in the forebrain. Here, we investigate a possible mechanism by which sleep deprivation (SD) could alter clock gene expression by quantifying DNA-binding of the core-clock transcription factors CLOCK, NPAS2, and BMAL1 to the cis-regulatory sequences of target clock genes in mice. Using chromatin immunoprecipitation (ChIP), we first showed that, as reported for the liver, DNA-binding of CLOCK and BMAL1 to target clock genes changes in function of time-of-day in the cerebral cortex. Tissue extracts were collected at ZT0 (light onset), -6, -12, and -18, and DNA enrichment of E-box or E'-box containing sequences was measured by qPCR. CLOCK and BMAL1 binding to Cry1, Dbp, Per1, and Per2 depended on time-of-day, with maximum values reached at around ZT6. We then observed that SD, performed between ZT0 and -6, significantly decreased DNA-binding of CLOCK and BMAL1 to Dbp, consistent with the observed decrease in Dbp mRNA levels after SD. The DNA-binding of NPAS2 and BMAL1 to Per2 was also decreased by SD, although SD is known to increase Per2 expression in the cortex. DNA-binding to Per1 and Cry1 was not affected by SD. Our results show that the sleep-wake history can affect the clock molecular machinery directly at the level of chromatin binding thereby altering the cortical expression of Dbp and Per2 and likely other targets. Although the precise dynamics of the relationship between DNA-binding and mRNA expression, especially for Per2, remains elusive, the results also suggest that part of the reported circadian changes in DNA-binding of core clock components in tissues peripheral to the suprachiasmatic nuclei could, in fact, be sleep-wake driven.
Resumo:
A defect in glucose sensing of the pancreatic beta-cells has been observed in several animal models of type II diabetes and has been correlated with a reduced gene expression of the glucose transporter type 2 (Glut2). In a transgenic mouse model, expression of Glut2 antisense RNA in pancreatic beta-cells has recently been shown to be associated with an impaired glucose-induced insulin secretion and the development of diabetes. To identify factors that may be involved in the specific decrease of Glut2 in the beta-cells of the diabetic animal, an attempt was made to localize the cis-elements and trans-acting factors involved in the control of Glut2 expression in the endocrine pancreas. It was demonstrated by transient transfection studies that only 338 base pairs (bp) of the murine Glut2 proximal promoter are needed for reporter gene expression in pancreatic islet-derived cell lines, whereas no activity was detected in nonpancreatic cells. Three cis-elements, GTI, GTII, and GTIII, have been identified by DNAse I footprinting and gel retardation experiments within these 338 bp. GTI and GTIII bind distinct but ubiquitously expressed trans-acting factors. On the other hand, nuclear proteins specifically expressed in pancreatic cell lines interact with GTII, and their relative abundance correlates with endogenous Glut2 expression. These GTII-binding factors correspond to nuclear proteins of 180 and 90 kilodaltons as defined by Southwestern analysis. The 180-kilodalton factor is present in pancreatic beta-cell lines but not in an alpha-cell line. Mutation of the GTI or GTIII cis-elements decreases transcriptional activity directed by the 338-bp promoter, whereas mutation of GTII increases gene transcription. Thus negative and positive regulatory sequences are identified within the proximal 338 bp of the GLUT2 promoter and may participate in the islet-specific expression of the gene by binding beta-cell specific trans-acting factors.
Resumo:
A 6008 base pair fragment of the vaccinia virus DNA containing the gene for the precursor of the major core protein 4 a, which has been designated P4 a, was sequenced. A long open reading frame (ORF) encoding a protein of molecular weight 102,157 started close to the position where the P4 a mRNA had been mapped. Analysis of the mRNA by S1 nuclease mapping and primer extension indicated that the 5' end defined by the former method is not the true 5' end. This suggests that the P4 a coding region is preceded by leader sequences that are not derived from the immediate vicinity of the gene, similar to what has been reported for another late vaccinia virus mRNA. The sequenced DNA contained several further ORFs on the same, or opposite DNA strand, providing further evidence for the close spacing of protein-coding sequences in the viral genome.
Resumo:
The malic enzyme (ME) gene is a target for both thyroid hormone receptors and peroxisome proliferator-activated receptors (PPAR). Within the ME promoter, two direct repeat (DR)-1-like elements, MEp and MEd, have been identified as putative PPAR response elements (PPRE). We demonstrate that only MEp and not MEd is able to bind PPAR/retinoid X receptor (RXR) heterodimers and mediate peroxisome proliferator signaling. Taking advantage of the close sequence resemblance of MEp and MEd, we have identified crucial determinants of a PPRE. Using reciprocal mutation analyses of these two elements, we show the preference for adenine as the spacing nucleotide between the two half-sites of the PPRE and demonstrate the importance of the two first bases flanking the core DR1 in 5'. This latter feature of the PPRE lead us to consider the polarity of the PPAR/RXR heterodimer bound to its cognate element. We demonstrate that, in contrast to the polarity of RXR/TR and RXR/RAR bound to DR4 and DR5 elements respectively, PPAR binds to the 5' extended half-site of the response element, while RXR occupies the 3' half-site. Consistent with this polarity is our finding that formation and binding of the PPAR/RXR heterodimer requires an intact hinge T region in RXR while its integrity is not required for binding of the RXR/TR heterodimer to a DR4.
Resumo:
Epigenetic silencing of the DNA repair protein O(6)-methylguanine-DNA methyltransferase (MGMT) by promoter methylation predicts successful alkylating agent therapy, such as with temozolomide, in glioblastoma patients. Stratified therapy assignment of patients in prospective clinical trials according to tumor MGMT status requires a standardized diagnostic test, suitable for high-throughput analysis of small amounts of formalin-fixed, paraffin-embedded tumor tissue. A direct, real-time methylation-specific PCR (MSP) assay was developed to determine methylation status of the MGMT gene promoter. Assay specificity was obtained by selective amplification of methylated DNA sequences of sodium bisulfite-modified DNA. The copy number of the methylated MGMT promoter, normalized to the beta-actin gene, provides a quantitative test result. We analyzed 134 clinical glioma samples, comparing the new test with the previously validated nested gel-based MSP assay, which yields a binary readout. A cut-off value for the MGMT methylation status was suggested by fitting a bimodal normal mixture model to the real-time results, supporting the hypothesis that there are two distinct populations within the test samples. Comparison of the tests showed high concordance of the results (82/91 [90%]; Cohen's kappa = 0.80; 95% confidence interval, 0.82-0.95). The direct, real-time MSP assay was highly reproducible (Pearson correlation 0.996) and showed valid test results for 93% (125/134) of samples compared with 75% (94/125) for the nested, gel-based MSP assay. This high-throughput test provides an important pharmacogenomic tool for individualized management of alkylating agent chemotherapy.