952 resultados para METAL NITROSYL COMPLEXES


Relevância:

30.00% 30.00%

Publicador:

Resumo:

By the reaction of Cp3Ln (Cp = C5H5; Ln = Dy, Ho, Yb) with equimolar n-propyl alcohol in THF (tetrahydrofuran) at room temperature three new binuclear organolanthanide complexes, [CP2Ln(mu-OCH2CH2CH3)]2 (Ln = Dy, Ho, Yb), have been synthesized, as shown by X-ray single-crystal structure analysis for the complex [Cp2Yb(mu-OCH2CH2CH3)]2. All the complexes were characterized by elemental analysis, IR and MS spectra. The Yb2O2 unit is planar, and the ytterbium atom is coordinated by two Cp ring centroids and two oxygen atoms of two n-propyloxide ligands to form a distorted tetrahedral geometry. The average Yb-C (Cp) bond distance is 2.589(17) angstrom. The average Yb-O distance is 2.199(5) angstrom. The Yb-Yb separation [3.521(1) angstrom] indicates that no metal-metal interaction is present.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The transfer of H+, Li+, Na+, Zn2+, Mg2+ and Cu2+ facilitated by ionophore ETH 129 (N, N, N', N'-tetracyolohexyl-3-oxapentanediamide) across water/nitrobenzene interface has been studied by the cyclic voltammetry. The mechanism of the transfer process has been discussed. The diffusion coefficients and the stability constants of the complexes formed in the nitrobenzene phase have been determined.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Reaction of lanthanoid trichloride with two equivalents of sodium t-butylcyclopentadienide in tetrahydrofuran affords bis(t-butylcyclopentadienyl)lanthanoid chloride complexes (t-BuCp)2LnCl. nTHF (Ln = Pr, Nd, n = 2; Ln = Gd, Yb, n = 1). The compound (t-BuCp)2PrCl.2THF (1) crystallizes from THF in monoclinic space group P2(1)/c with unit cell dimensions a = 15.080(3), b = 8.855(2), c = 21.196(5) angstrom, beta = 110.34(2)degrees, V = 2653.9 angstrom-3 and D(calcd) = 1.41 g/cm3 for Z = 4. The central metal Pr is coordinated to two t-BuCp ring centroids, one chlorine atom and two THF forming a distorted trigonal bipyramid. The crystal of (t-BuCp)2YbCl.THF (2) belongs to the monoclinic crystal system, space group P2(1)/n with a = 7.726(1), b = 12.554(2), c = 23.200(6) angstrom, beta = 97.77(2)degrees, V = 2229.56 angstrom-3, D(calcd) = 1.50 g/cm3 and Z = 4. The t-BuCp ring centroids, the chlorine atom and the oxygen atom of the THF describe a distorted tetrahedron around the central ion of ytterbium.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The rare earth monophthalocyanine complexes, LnPcCl and LnPc(OAc)2 (Ln = Tb, Ho, Tm, Lu, Pc=Phthalocyanine, OAc = Acetate), were synthesized. The electronic structures of the complexes have been studied by means of XPS. The experimental results of binding energies for the complexes indicate that the bonds of the complexes have a certain covalent character depending on L-->Ln charge transfer. This L-->Ln charge transfer process of phythalocyanine complexes differs from that of crown ether complexes. Both coordination and substitution are included in the former case, but only coordination in the latter. Phthalocyanine ring is an electrophilic group and its electronegativity is large. So, the O1s binding energies of coordinating oxygen atoms of acetate in LnPc(OAc)2 are larger than those of Ln(OAc)3. The magnitude of valent charge delocalized from ligand onto metal atom is dependent on electronegativity, coordination number, valence state and so on. Because coordination number of Ln in LnPc(OAc)2 is larger than that in LnPcCl and electronegativity of Clin LnPcCl is larger than that of O in LnPc(OAc)2, the Ln4d5/2 binding energies of LnPc (OAc)2 are less than those of LnPcCl.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Two different kinds of sensors have been developed by using the same kind of vapochromic complexes. The vapochromic materials [Au2Ag2(C6F5)(4)L-2](n) have different colours depending on the ligand L. These materials change, reversibly, their optical properties, colour and fluorescence, in the presence of the vapours of volatile organic compounds (VOCs). For practical applications, two different ways of fixing the vapochromic material to the optical fibre have been used: the sol-gel technique and the electrostatic self-assembly method (ESA). With the first technique the sensors can even be used to detect VOCs in aqueous solutions, and using the second method it has been possible to develop nanosensors.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

This thesis focuses on the synthesis and analysis of novel chloride based platinum complexes derived from iminophosphine and phosphinoamide ligands, along with studies on their reactivity towards substitution and oxidation reactions. Also explored here are the potential applications of these complexes for biological and luminescent purposes. Chapter one provides an extensive overview of platinum coordination chemistry with examples of various mixed donor ligands along with the history of platinum anticancer therapy. It also looks at metals in medicine, both for biological functions as well as for therapeutic purposes and gives a background to some other applications for platinum complexes. Chapter two outlines the design and synthetic strategies employed for the development of novel platinum (II) chloride complexes from iminophosphine and phosphinoamide ligands. Also reported is the cyclometallation of these complexes to form stable tridentate mixed donor platinum (II) compounds. In Chapter three the development of a direct method for displacing a chloride from a platinum metal centre with a desired phosphine is reported. Numerous methods for successful oxidation of the platinum (II) complexes will also be explored, leading to novel platinum (IV) complexes being reported here also. The importance of stabilisation of the displaced anion, chloride, by the solvent system will also be discussed in this chapter. Chapter four investigates the reactivity of the platinum (II) complexes towards two different biomolecules to form novel platinum bio-adducts. The potential application of the platinum (II) cyclometallates as chemotherapeutics will also be explored here using in-vitro cancer cell testing. Finally, luminescence studies are also reported here for the ligands and platinum complexes reported in chapter two and three to investigate potential applications in this field also. Chapter five provides a final conclusion and an overall summary of the entire project as well as identifying key areas for future work.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Using quantum chemical calculations, we investigate surface reactions of copper precursors and diethylzinc as the reducing agent for effective Atomic Layer Deposition (ALD) of Cu. The adsorption of various commonly used Cu(II) precursors is explored. The precursors vary in the electronegativity and conjugation of the ligands and flexibility of the whole molecule. Our study shows that the overall stereochemistry of the precursor governs the adsorption onto its surface. Formation of different Cu(II)/Cu(I)/Cu(0) intermediate complexes from the respective Cu(II) compounds on the surface is also explored. The surface model is a (111) facet of a Cu55 cluster. Cu(I) compounds are found to cover the surface after the precursor pulse, irrespective of the precursor chosen. We provide new information about the surface chemistry of Cu(II) versus Cu(I) compounds. A pair of CuEt intermediates or the dimer Cu2Et2 reacts in order to deposit a new Cu atom and release gaseous butane. In this reaction, two electrons from the Et anions are donated to copper for reduction to metallic form. This indicates that a ligand exchange between the Cu and Zn is important for the success of this transmetalation reaction. The effect of the ligands in the precursor on the electron density before and after adsorption onto the surface has also been computed through population analysis. In the Cu(I) intermediate, charge is delocalized between the Cu precursor and the bare copper surface, indicating metallic bonding as the precursor densifies to the surface.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

[Ru(BPY)2POQ-Nmet]2+ and [Ru(TAP)2POQ-Nmet]2+ (1 and 3) are bifunctional complexes composed of a metallic unit linked by a flexible chain to an organic unit. They have been prepared as photoprobes or photoreagents of DNA. In this work, the spectroscopic properties of these bifunctional complexes in the absence of DNA are compared with those of the monofunctional analogues [Ru(BPY)2Phen]2+, [Ru-(BPY)2acPhen]2+, [Ru(TAP)2Phen]2+, and [Ru(TAP)2acPhen]2+ (2 and 4). The electrospray mass spectrometry and absorption data show that the quinoline moiety exists in the protonated and nonprotonated form. Although the bifunctional complex containing 2,2′-bipyridine (BPY) ligands exhibits photophysical properties similar to those of the monofunctional compounds, the bifunctional complex with 1,4,5,8-tetraazaphenanthrene (TAP) ligands behaves quite differently. It has weaker relative emission quantum yields and shorter luminescence lifetimes than the monofunctional TAP analogue when the quinoline unit is nonprotonated. This indicates an efficient intramolecular quenching of the 3MLCT (metal to ligand charge transfer) excited state of the TAP metallic moiety. When the organic unit is protonated, there is no internal quenching. In organic solvent, the nonquenched excited metallic unit (bearing a protonated quinoline) and the quenched one (bearing a nonprotonated organic unit) are in slow equilibrium as compared to the lifetime of the two emitters. In aqueous solution this equilibrium is faster and is catalysed by the presence of phosphate buffer. Flash photolysis experiments suggest that the intramolecular quenching process originates from a photoinduced electron transfer from the nonprotonated quinoline to the excited Ru(TAP)2 2+ moiety.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The photophysical properties of Ru(II) and Re(I) polypyridyl complexes including a bis-bipyridyl pyrene ligand are presented. The complexes ([(bpy)(2)Ru](2)bpb)(4+) and [(CO)(3)ReCl(bpb)] (bpy = 2,2'-bipyridine, bpb = 1,6-bis-(4-(2,2'-bipyrid-yl)-pyrene) were designed with the intent of examining intramolecular energy migration between MLCT states localized on the metal complexes and pyrene-localized (3)(pi-pi) states. Absorption spectroscopy of both complexes containing the bpb ligand reveals that in addition to the MLCT and the pyrene-centered (1)(pi-pi) transitions, a new absorption band is observed near 400 nm for both complexes. Absorption spectral data for the Re(I) complex strongly suggest the presence of a pyrene(pi) to bpy(pi) intraligand charge transfer (ILCT) transition. Emission spectra at room temperature and at 77 K are almost identical for the Ru(II) and Re(I) complexes containing the bpb ligand. The (3)MLCT emission of related bipyridyl compounds lacking the pyrene is observed at higher energy than for the pyrene-containing complexes, ([(bpy)(2)Ru](2)bpb)(4+) and [(CO(3)ReCl(bpb)]. The Ru(II) complex emits at room temperature with a remarkably long lifetime (130 micros in degassed DMSO). This emission is also strongly sensitive to oxygen and is almost entirely quenched in an aerated solution. In addition, excited-state absorption spectra exhibit features not consistent with (3)MLCT or (3)(pi-pi) states of the parent chromophores. The combined characteristics suggest the emission arises from either (3)(pi-pi) or (3)ILCT states or a state with mixed parentage.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The synthesis of a number of new 2,2'-bipyridine ligands, functionalized with bulky ester side groups is reported (L2 - L8). Their reaction with [Ru(DMSO)4Cl2] gives rise to tris-chelate ruthenium(II) metal complexes which show an unusually high proportion of the fac-isomer, as judged by 1H NMR following conversion to the ruthenium(II) complex of 2,2'-bipyridine-5-carboxylic acid methyl ester (L1). The initial reaction appears to have thermodynamic control with the steric bulk of the ligands causing the third ligand to be labile under the reaction conditions used, giving rise to disappointing yields and allowing rearrangement to the more stable facial form. DFT studies indicate that this does not appear to be as a consequence of a metal centered electronic effect. The two isomers of [Ru(L1)3](PF6)2 were separated into the two individual forms using silica preparative plate chromatographic procedures, and the photophysical characteristics of the two forms compared. The results appear to indicate that there is no significant difference in both their room temperature electronic absorption and emission spectra or their excited state lifetimes at 77K.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A thorough and detailed study of diastereointerconversion in the chiral platinum complexes [(NUPHOS)Pt{(S)-BINOL}] (3a-e) has been undertaken and compared with the results of a similar study with [(BIPHEP)Pt{(S)-BINOL}]. Rate data revealed that this process obeys first-order relaxation kinetics, and rate constants for conversion of the minor to the major diastereoisomer have been obtained. Eyring analysis of the data gave DeltaH(double dagger) and DeltaS(double dagger) values of 22-25 kcal mol(-1) and -1 to -16 eu, respectively. In combination with computational analysis, these studies indicate that atropinversion most likely occurs via an on-metal pathway involving a planar seven-membered transition state. Substitution of (S)-BINOL for (S,S)-DPEN results in a marked reduction in the barrier to atropinversion; a DeltaH(double dagger) value of 17 kcal mol(-1) has been determined for the conversion of delta-[(Ph-4-NUPHOS)Pt{(S,S)-DPEN}]Cl-2 to lambda-[(Ph-4-NUPHOS)Pt{(S,S)-DPEN}]Cl-2, which could indicate that an alternative mechanism operates.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A series of dinuclear (bipyridine)tricarbonylrhenium(I) and tris(bipyridine)ruthenium(II) complexes have been isolated and characterised, bridged by a flexible diamido ethylene glycol chain. A new stepwise synthetic pathway has been investigated to heterometallic complexes, with the rhenium(I) complexes exhibiting an unusual configuration and inequivalence of the metal centres potentially arising from a surprising hydrogen-bonding interaction between an Re–CO group and an amide proton in low-polarity solvents. This interaction appears to be broken by competing hydrogen-bonding species such as dihydrogen phosphate. This effect was not observed in the corresponding ruthenium(II) complexes, which showed very little interaction with anions. The photophysical characterisation shows that the inclusion of two ester/amide groups to the rhenium centre effectively quenches the fluorescence at room temperature. The ruthenium(II) complexes have considerably stronger fluorescence than the rhenium species, and are less affected by theinclusion of ester and amide groups to the 2,2'-bipyridine chelating group.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A series of benzothiazole-substituted trisbipyridine ruthenium(II) analogues {[Ru(bpy)(2)(4,5'-bbtb)](2+), [Ru(bpy)(2)(5,5'-bbtb)](2+) and [Ru(bpy)(2)(5-mbtb)](2+) [bpy is 2,2'-bipyridine, bbtb is bis(benzothiazol-2-yl)-2,2'-bipyridine, 5-mbtb is 5-(benzothiazol-2-yl),5'-methyl-2,2'-bipyridine]} have been prepared and compared with the complex [Ru(bpy)(2)(4,4'-bbtb)](2+) reported previously. From the UV-vis spectral studies, substitution at the 5-position of the bpy causes the ligand-centred transitions to occur at considerably lower energy than for those with the functionality at the 4-position, while at the same time causing the emission to be effectively quenched. However, substitution at the 4-position causes the metal-to-ligand charge transfer to occur at lower energies. Fluorescent intercalator displacement studies indicate that the doubly substituted complexes displace ethidium bromide from a range of oligonucleotides, with the greater preference shown for bulge and hairpin sequences by the Lambda enantiomer. Since the complexes only show small variation in the UV-vis spectra on the introduction of calf thymus DNA and a small increase in fluorescence they do not appear to be intercalators, but appear to associate within one of the grooves. All of the reported bisbenzothiazole complexes show reasonable cytotoxicity against a range of human cancer cell lines.