The expression of TLR9 in human cutaneous leishmaniasis is associated with granuloma

P>The Toll-like receptor (TLR) signalling pathway is the first system that defends against Leishmania. After recognising Leishmania as nonself, TLRs trigger NF-kappa B expression. NF-kappa B proceeds to the nucleus and promotes the transcription of pro-inflammatory cytokines. TLR9 is thus an important factor in the induction of an effective immune response against Leishmania. We examined the pattern of TLR9 expression in 12 patients with cutaneous leishmaniasis caused by Leishmania braziliensis detected by polymerase chain reaction. Normal skin was analysed as a negative control. TLR9 expression was examined in the dermis and epidermis by immunohistochemical analysis of paraffin-embedded biopsy tissue. TLR9 expression was primarily observed in the granuloma. The protein was detected in a few cells in the dermis. A lower expression level was detected in the epidermis of patients with leishmaniasis when compared with normal skin. The presence of TLR9 in the skin of patients with cutaneous leishmaniasis is associated with granuloma and expressed by macrophages.

Adenotonsillectomy improves the strength of respiratory muscles in children with upper airway obstruction

Objective: The aim of this paper is to study the respiratory muscle strength by evaluating the maximal inspiratory pressure (MIP), maximal expiratory pressure (MEP) and lung volume before and 3 and 6 months after adenotonsillectomy. This is an interventional, before and after trial. It was set at the Department of Otolaryngology. University of Sao Paulo, School of Medicine. We included 29 children (6-13 years old), both genders, consecutively recruited from the waiting list for adenotonsillectomy. Children were submitted to maximal inspiratory pressures (MIP), maximal expiratory pressure (MEP) evaluation using an analog manovacuometer, lung volume, using incentive expirotometer and thoracic and abdominal perimeter using a centimeter tape. Children were evaluated in 3 different moments: 1 week before and 3 and 6 months after surgery. Results: MIP improved significantly 3 months (p < 0.001) after adenotonsillectomy and MEP did not change (p = 1). There were increases in lung volume (p = 000), chest (p = 0.017) and abdominal perimeter (p = 0.05). Six months after surgery, all parameters improved. MIP (p = 0), MEP (p = 0), lung volume (p = 0.02), chest (p = 0.034) and abdominal perimeter (p = 0.23). Conclusion: This study suggests that there was an improvement in respiratory muscular strength, once there was a significant improvement in maximal inspiratory pressure, lung volume and other parameters after adenotonsillectomy. (C) 2010 Elsevier Ireland Ltd. All rights reserved.

Neck Nerve Trunks Schwannomas: Clinical Features and Postoperative Neurologic Outcome

Objectives/Hypothesis: To analyze clinical and epidemiological features of neck nerve schwannomas, with emphasis on the neurologic outcome after surgical excision sparing as much of nerve fibers as possible with enucleation technique. Study Design: Retrospective study. Methods: Review of medical records from 1987 to 2006 of patients with neck nerve schwannomas, treated in a single institution. Results: Twenty-two patients were identified. Gender distribution was equal and age ranged from 15 to 61 years (mean: 38.6 years). Seven vagal, four brachial plexus, four sympathetic trunk, three cervical plexus, and two lesions on other sites could be identified. Most common symptom was neck mass. Local or irradiated pain also occurred in five cases. Median growing rate of tumors was 3 mm per year. Nerve paralysis was noted twice (a vagal schwannoma and a hypoglossal paralysis compressed by a vagal schwannoma). Different techniques were employed, and seven out of nine patients kept their nerve function (78%) after enucleation. No recurrence was observed in follow-up. Conclusions: Schwannomas should be treated surgically because of its growing potential, leading to local and neural compression symptoms. When possible, enucleation, which was employed in 10 patients of this series, is the recommended surgical option, allowing neural function preservation or restoration in most instances. This is especially important in the head and neck, where denervation may have a significant impact on the quality of life.

Biological activity and metabolic clearance of recombinant human follicle stimulating hormone produced in Sp2/0 myeloma cells

Human follicle stimulating hormone is a pituitary glycoprotein that is essential for the maintenance of ovarian follicle development and testicular spermatogenesis. Like other members of the glycoprotein hormone family, it contains a common a subunit and a hormone specific beta subunit. Each subunit contains two glycosylation sites. The specific structures of the oligosaccharides of human follicle stimulating hormone have been shown to influence both the in vitro and in vivo bioactivity. Since the carbohydrate structure of a protein reflects the glycosylation apparatus of the host cells in which the protein is expressed, we examined the isoform profiles, in vitro bioactivity and metabolic clearance of a preparation of purified recombinant human follicle stimulating hormone derived from a stable, transfected Sp2/0 myeloma cell line, and pituitary human follicle stimulating hormone. Isoelectric focussing and chromatofocussing studies of human follicle stimulating hormone preparations both showed a more basic isoform profile for the recombinant human follicle stimulating hormone compared to that of pituitary human follicle stimulating hormone. The recombinant human follicle stimulating hormone had a significantly higher radioreceptor activity compared to that of pituitary human follicle stimulating hormone, consistent with a greater in vitro potency. Pharmacokinetic studies in rats indicated a similar terminal half life (124 min) to that of the pituitary human follicle stimulating hormone (119 min). Preliminary carbohydrate analysis showed recombinant human follicle stimulating hormone to contain high mannose and/or hybrid type, in addition to complex type carbohydrate chains, terminating with both alpha 2,3 and alpha 2,6 linked sialic acids. These results demonstrate that recombinant human follicle stimulating hormone made in the Sp2/0 myeloma cells is sialylated, has a more basic isoform profile, and has a greater in vitro biological potency compared to those of the pituitary human follicle stimulating hormone.

Processing of mutated human proinsulin to mature insulin in the non-endocrine cell line, CHO

Heterologous genes encoding proproteins, including proinsulin, generally produce mature protein when expressed in endocrine cells while unprocessed or partially processed protein is produced in non-endocrine cells. Proproteins, which are normally processed in the regulated pathway restricted to endocrine cells, do not always contain the recognition sequence for cleavage by furin, the endoprotease specific to the constitutive pathway, the principal protein processing pathway in non-endocrine cells. Human proinsulin consists of B-Chain-C-peptide-A-Chain and cleavage at the B/C and C/A junctions is required for processing. The B/C, but not the C/A junction, is recognised and cleaved in the constitutive pathway. We expressed a human proinsulin and a mutated proinsulin gene with an engineered furin recognition sequence at the C/A junction and compared the processing efficiency of the mutant and native proinsulin in Chinese Hamster Ovary cells. The processing efficiency of the mutant proinsulin was 56% relative to 0.7% for native proinsulin. However, despite similar levels of mRNA being expressed in both cell lines, the absolute levels of immunoreactive insulin, normalized against mRNA levels, were 18-fold lower in the mutant proinsulin-expressing cells. As a result, there was only a marginal increase in absolute levels of insulin produced by these cells. This unexpected finding may result from preferential degradation of insulin in non-endocrine cells which lack the protection offered by the secretory granules found in endocrine cells.

Mathematical constraints on a theory of human memory - Response

Colonius suggests that, in using standard set theory as the language in which to express our computational-level theory of human memory, we would need to violate the axiom of foundation in order to express meaningful memory bindings in which a context is identical to an item in the list. We circumvent Colonius's objection by allowing that a list item may serve as a label for a context without being identical to that context. This debate serves to highlight the value of specifying memory operations in set theoretic notation, as it would have been difficult if not impossible to formulate such an objection at the algorithmic level.

Reconstruction of large cranial defects in nonimmunosuppressed experimental design with human dental pulp stem cells

The main aim of this study is to evaluate the capacity of human dental pulp stem cells (hDPSC), isolated from deciduous teeth, to reconstruct large-sized cranial bone defects in nonimmunosuppressed (NIS) rats. To our knowledge, these cells were not used before in similar experiments. We performed two symmetric full-thickness cranial defects (5 x 8 mm) on each parietal region of eight NIS rats. In six of them, the left side was supplied with collagen membrane only and the right side (RS) with collagen membrane and hDPSC. In two rats, the RS had collagen membrane only and nothing was added at the left side (controls). Cells were used after in vitro characterization as mesenchymal cells. Animals were euthanized at 7, 20, 30, 60, and 120 days postoperatively and cranial tissue samples were taken from the defects for histologic analysis. Analysis of the presence of human cells in the new bone was confirmed by molecular analysis. The hDPSC lineage was positive for the four mesenchymal cell markers tested and showed osteogenic, adipogenic, and myogenic in vitro differentiation. We observed bone formation 1 month after surgery in both sides, but a more mature bone was present in the RS. Human DNA was polymerase chain reaction-amplified only at the RS, indicating that this new bone had human cells. The us e of hDPSC in NIS rats did not cause any graft. rejection. Our findings suggest that hDPSC is an additional cell resource for correcting large cranial defects in rats and constitutes a promising model for reconstruction of human large cranial defects in craniofacial surgery.

Relationship between the appearance of tongue carcinoma on intraoral ultrasonography and neck metastasis

To evaluate the usefulness of intraoral ultrasonography (IOUS) as a tool for predicting neck metastasis. Squamous cell carcinoma (SCC) of the tongue is aggressive and has a great propensity to metastasize to cervical lymph nodes. SCC of the oral cavity has a worse prognosis when associated with metastatic cervical nodes. Therefore, the metastatic potential of tongue carcinoma should be graded preoperatively to help determine the requirement for neck dissection. Nineteen patients (11 men, 8 women) between 36 and 79 years of age (mean age 60) with T1 to T4a TNM-stage tongue carcinomas were evaluated preoperatively with IOUS. Clinical and pathological TNM classifications were performed. The average tumor thicknesses measured using histological sections were significantly (p < 0.01) lower than those with IOUS (1.3 vs. 1.6 cm, respectively). A significant correlation was observed between the tumor thickness measured using ultrasonography and that measured using histological sections (pathology). Based on this greater accuracy, the cutoff point of tumor thickness based on IOUS evaluation for predicting neck metastasis was determined to be 1.8 cm. Some factors may influence neck metastasis. A knowledge of these would help to avoid unnecessary surgical intervention for N0 patients. The results of this study indicates that there is a significant correlation between neck metastasis and tumor thickness. Intraoral ultrasonography is useful tool for identifying tongue tumors and measuring their thickness, with the thickness measured by IOUS showing a very good correlation with histological measurements. Moreover, IOUS provides prognostic information prior to surgical treatment since tumor thickness can predict the chance of recognizing metastatic cervical nodes.

ERCC1 protein, mRNA expression and T19007C polymorphism as prognostic markers in head and neck squamous cell carcinoma patients treated with surgery and adjuvant cisplatin-based chemoradiation

Adjuvant cisplatin-based chemoradiation improves survival in HNSCC patients presenting with risk features. ERCC1 (excision repair cross-complementation group 1) is associated with resistance to chemo- and radiation therapy and may have a prognostic value in HNSCC patients. Here we studied ERCC1 expression and the polymorphism T19007C as prognostic markers in these patients. This is a retrospective and translational analysis, where ERCC1 protein expression was evaluated by immunohistochemistry, using an H-score, and mRNA expression was determined by RT-PCR. T 19007C genotypes were detected by PCR-RFLP carried out using DNA template extracted from normal lymph nodes. A high H-score was seen in 32 patients (54%), who presented better 5-year overall survival (5-y OS: 50% vs. 18%, HR 0.43, p=0.026). Fifteen out of 45 patients (33%), with high mRNA expression, presented better 5-year overall survival (OS) (86% vs. 30%, HR 0.26, p=0.052). No OS difference was detected among T 19007C genotypes. High H-score and mRNA expression remained significant as favorable prognostic factors in a multivariate analysis. Collectively, our results suggest that high ERCC1 expression seems to be associated with better OS rates in HNSCC patients submitted to adjuvant cisplatin-based chemoradiation.

Effects of (-)-RO363 at human atrial beta-adrenoceptor subtypes, the human cloned beta(3)-adrenoceptor and rodent intestinal beta(3)-adrenoceptors

1 Chronic treatment of patients with beta-blockers causes atrial inotropic hyperresponsiveness through beta(2)-adrenoceptors, 5-HT4 receptors and H-2-receptors but apparently not through beta(1)-adrenoceptors despite data claiming an increased beta(1)-adrenoceptor density from homogenate binding studies. We have addressed the question of beta(1)-adrenoceptor sensitivity by determining the inotropic potency and intrinsic activity of the beta(1)-adrenoceptor selective partial agonist (-)-RO363 and by carrying out both homogenate binding and quantitative beta-adrenoceptor autoradiography in atria obtained from patients treated or not treated with beta-blockers. In the course of the experiments it became apparent that (-)-RO363 also may cause agonistic effects through the third atrial beta-adrenoceptor. To assess whether (-)-RO363 also caused agonistic effects through beta(3)-adrenoceptors we studied its relaxant effects in rat colon and guinea-pig ileum, as well as receptor binding and adenylyl cyclase stimulation of chinese hamster ovary (CHO) cells expressing human beta(3)-adrenoceptors. 2 beta-Adrenoceptors were labelled with (-)-[I-125]-cyanopindolol. The density of both beta(1)- and beta(2)-adrenoceptors was unchanged in the 2 groups, as assessed with both quantitative receptor autoradiography and homogenate binding. The affinities of (-)-RO363 for beta(1)-adrenoceptors (pK(i) = 8.0-7.7) and beta(2)-adrenoceptors (pK(i) = 6.1-5.8) were not significantly different in the two groups. 3 (-)-RO363 increased atrial force with a pEC(50) of 8.2 (beta-blocker treated) and 8.0 (non-beta-blocker treated) and intrinsic activity with respect to (-)-isoprenaline of 0.80 (beta-blocker treated) and 0.54 (non-beta-blocker treated) (P<0.001) and with respect to Ca2+ (7 mM) of 0.65 (beta-blocker treated) and 0.45 (non-beta-blocker treated) (P<0.01). The effects of (-)-RO363 were resistant to antagonism by the beta(2)-adrenoceptor antagonist, ICI 118,551 (50 nM). The effects of 0.3-10 nM (-)-RO363 were antagonized by 3-10 nM of the beta(1)-adrenoceptor selective antagonist CGP 20712A. The effects of 20-1000 nM (-)-RO363 were partially resistant to antagonism by 30-300 nM CGP 20712A. 4 (-)-RO363 relaxed the rat colon, partially precontracted by 30 mM KCl, with an intrinsic activity of 0.97 compared to (-)-isoprenaline. The concentration-effect curve to (-)-RO363 revealed 2 components, one antagonized by (-)-propranolol (200 nM) with pEC(50)=8.5 and fraction 0.66, the other resistant to (-)-propranolol (200 nM) with pEC(50)=5.6 and fraction 0.34 of maximal relaxation. 5 (-)-RO363 relaxed the longitudinal muscle of guinea-pig ileum, precontracted by 0.5 mu M histamine, with intrinsic activity of 1.0 compared to (-)-isoprenaline and through 2 components, one antagonized by (-)-propranolol (200 nM) with pEC(50)=8.7 and fraction 0.67, the other resistant to (-)-propranolol with pEC(50)=4.9 and fraction 0.33 of maximal relaxation. 6 (-)-RO363 stimulated the adenylyl cyclase of CHO cells expressing human beta(3)-adrenoceptors with pEC(50)=5.5 and intrinsic activity 0.74 with respect to (-)-isoprenaline (pEC(50)=5.9). (-)-RO363 competed for binding with [I-125]cyanopindolol at human beta(3)-adrenoceptors transfected into CHO cells with pK(i)=4.5. (-)-Isoprenaline (pk(i)=5.2) and (-)-CGP 12177A (pK(i)=6.1) also competed for binding at human beta(2)-adrenoceptors. 7 We conclude that under conditions used in this study, (-)-RO363 is a potent partial agonist for human beta(1)- and beta(3)-adrenoceptors and appears also to activate the third human atrial beta-adrenoceptor. (-)-RO363 relaxes mammalian gut through both beta(1)- and beta(3)-adrenoceptors. (-)-RO363, used as a beta(1)-adrenoceptor selective tool, confirms previous findings with (-)-noradrenaline that beta(1)-adrenoceptor mediated atrial effects are only slightly enhanced by chronic treatment of patients with beta-blockers. Chronic treatment with beta(1)-adrenoceptor-selective blockers does not significantly increase the density of human atrial beta(1)- and beta(2)-adrenoceptors.

Molecular adjuvant effects of a conformationally biased agonist elf human C5a anaphylatoxin

A conformationally biased decapeptide agonist of human C5a anaphylatoxin (YSFKPMPLaR) was used as a molecular adjuvant in stimulating Ab responses against peptide epitopes derived from human MUC1 glycoprotein and the human mu and kappa opioid receptors. C57BL6 mice were immunized with the MUC1 epitope (YKQGGFLGL); the C5a agonist (YSFKPMPLaR); YSFKPMPLaR and YKQGGFLGL together, but unconjugated; a C5a-active, MUC1 epitope construct (YKQGGFLGLYSFKPMPLaR); and a C5a-inactive, reversed moiety construct (YSFKPMPLaRYKQGGFLGL). High Ab titers specific for the MUC1 epitope were observed Only in mice immunized with the C5a-active epitope construct. Similar results were obtained in BALB/c mice immunized with the C5a-active, MUC1 epitope construct, Abs from the sera of the C57BL6 mice were predominately of the IgG2a, IgC2b, and IgM isotypes and were reactive against human recombinant MUC1 and MUC1 expressed by the Panc-1 M1F.15 pancreatic cell line, When compared with the corresponding KLH-epitope conjugates in C57BL6 mice, the epitope-C5a agonist constructs produced titers of specific IgG Abs of isotypes distinct from those generated by the keyhole limpet hemocyanin-epitope conjugates, Rabbits immunized with a mu opioid receptor epitope-C5a agonist construct (GDLSDPCGNRTNLGGRDSLYSFKPMPLaR) or a kappa opioid receptor epitope-C5a agonist construct (FPGWAEPDSNGSEDAQLYSFKPMPLaR) generated high titer, epitope-specific Ab responses, Ab titers generated in response to the opioid epitope-C5a agonist constructs were comparable to those generated by the opioid KLH-epitope conjugates, The results of this study are discussed in terms of possible mechanisms by which the conformationally biased C5a agonist serves as a molecular adjuvant.

Evaluation of Maxillary Alveolar Reconstruction Using a Resorbable Collagen Sponge with Recombinant Human Bone Morphogenetic Protein-2 in Cleft Lip and Palate Patients

Introduction: A resorbable collagen matrix with recombinant human bone morphogenetic protein (rhBMP-2) was compared with traditional iliac crest bone graft for the closure of alveolar defects during secondary dental eruption. Methods: Sixteen patients with unilateral cleft lip and palate, aged 8 to 12 years, were selected and randomly assigned to group 1 (rhBMP-2) or group 2 (iliac crest bone graft). Computed tomography was performed to assess both groups preoperatively and at months 6 and 12 postoperatively. Bone height and defect volume were calculated through Osirix Dicom Viewer (Pixmeo, Apple Inc.). Overall morbidity was recorded. Results: Preoperative and follow-up examinations revealed progressive alveolar bone union in all patients. For group 1, final completion of the defect with a 65.0% mean bone height was detected 12 months postoperatively. For group 2, final completion of the defect with an 83.8% mean bone height was detected 6 months postoperatively. Dental eruption routinely occurred in both groups. Clinical complications included significant swelling in three group 1 patients (37.5%) and significant donor-site pain in seven group 2 patients (87.5%). Conclusions: For this select group of patients with immature skeleton, rhBMP-2 therapy resulted in satisfactory bone healing and reduced morbidity compared with traditional iliac crest bone grafting.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Contraction of the abdominal muscles associated with movement of the lower limb

Background and Purpose. Activity of the trunk muscles is essential for maintaining stability of the lumbar spine because of the unstable structure of that portion of the spine. A model involving evaluation of the response of the lumbar multifidus and abdominal muscles to leg movement was developed to evaluate this function. Subjects. To examine this function in healthy persons, 9 male and 6 female subjects (mean age = 20.6 years, SD = 2.3) with no history of low back pain were studied. Methods. Fine-wire and surface electromyography electrodes were used to record the activity of selected trunk muscles and the prime movers for hip flexion, abduction, and extension during hip movements in each of these directions. Results. Trunk muscle activity occurring prior to activity of the prime mover of the limb was associated with hip movement in each direction. The transversus abdominis (TrA) muscle was invariably the first muscle that was active. Although reaction time for the TrA and oblique abdominal muscles was consistent across movement directions, reaction time for the rectus abdominis and multifidus muscles varied with the direction of limb movement. Conclusion and Discussion. Results suggest that the central nervous st stem deals with stabilization of the spine by contraction of the abdominal and multifidus muscles in anticipation of reactive forces produced by limb movement. The TrA and oblique abdominal muscles appear to contribute to a function not related to the direction of these forces.