824 resultados para Carbohydrate Solutions


Relevância:

20.00% 20.00%

Publicador:

Relevância:

20.00% 20.00%

Publicador:

Resumo:

beta-Casein and alpha-casein showed radical-scavenging activities in aqueous solution, whereas bovine serum albumin (BSA), alpha-lactalbumin and P-lactoglobulin showed much weaker antioxidant activity, when assessed by the 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS) radical-scavenging assay. However, beta-casein and alpha-casein showed reduced antioxidant activity after storage at 30 degrees C. An increase in radical- scavenging activity and a fall in fluorescence of the protein component were evident after 6 h, when BSA, beta-lactoglobulin or casein were mixed with EGCG, and excess EGCG was removed, indicating the formation of a complex with this protein on mixing. Storage of all the proteins with EGCG at 30 degrees C caused an increase in the antioxidant activity of the isolated protein component after separation from excess EGCG. This showed that EGCG was reacting with the proteins and that the protein-bound catechin had antioxidant properties. The reaction of EGCG with BSA, casein and beta-lactoglobulin was confirmed by the loss of fluorescence of the protein on storage, and the increase in UV absorbance between 250 and 400 nm. The increase in antioxidant activity of BSA after storage with EGCG was confirmed by the ferric reducing antioxidant potential (FRAP) and the oxygen radical antioxidant capacity (ORAC) assays. (c) 2006 Elsevier Ltd. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The polymeric films have been prepared based on blends of chitosan with two cellulose ethers-hydroxypropylmethylcellulose and methylcellulose by casting from acetic acid solutions. The films were transparent and brittle in a dry state but an immersion of the samples in deionized water for over 24 h leads to their disintegration or partial dissolution. The miscibility of the polymers in the blends has been assessed by infrared spectroscopy, wide-angle X-ray diffraction, scanning electron microscopy and thermal gravimetric analysis. It was shown that although weak hydrogen bonding exists between the polymer functional groups the blends are not fully miscible in a dry state. (c) 2005 Elsevier Ltd. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Amphiphilic chitosan-based polymers (M-w < 20 kDa) self-assemble in aqueous media at low micromolar concentrations to give previously unknown micellar clusters of 100-300 nm in size. Micellar clusters comprise smaller 10-30 nm aggregates, and the nanopolarity/drug incorporation efficiency of their hydrophobic domains can be tailored by varying the degree of lipidic derivatization and molecular weight of the carbohydrate. The extent of drug incorporation by these novel micellar clusters is 1 order of magnitude higher than is seen with triblock copolymers, with molar polymer/drug ratios of 1:48 to 1:67. On intravenous injection, the pharmacodynamic activity of a carbohydrate propofol formulation is increased by 1 order of magnitude when compared to a commercial emulsion formulation, and on topical ocular application of a carbohydrate prednisolone formulation, initial drug aqueous humor levels are similar to those found with a 10-fold dose of prednisolone suspension.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The interactions between hydroxypropylmethylcellulose (HPMC) and poly(acrylic acid) (PAA) as well as poly(methacrylic acid) (PMMA) resulting in formation of hydrophobic interpolymer complexes (IPC) via hydrogen bonding have been studied in aqueous solutions in acidic medium. The formation of IPC of two different compositions (2:1 and 4:1) has been detected for complexes of PAA and HPMC. The critical pH values for complexation of HPMC with PAA and PMAA were determined by the turbidimetric method. It was found that PAA shows the lower complexation ability compared to PMAA due to the more hydrophobic nature of the latter polyacid. The temperature-induced phase separation in HPMC-PAA solution mixtures depends greatly on the components ratio and PAA molecular weight. The complexation ability of hydroxypropylmethylcellulose with respect to poly(acrylic acid) was found to be similar to the complexation ability of methylcellulose, lower than that of hydroxypropylcellulose and higher than that of hydroxyethylcellulose. (c) 2006 Society of Chemical Industry.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper examines optimal solutions of control systems with drift defined on the orthonormal frame bundle of particular Riemannian manifolds of constant curvature. The manifolds considered here are the space forms Euclidean space E-3, the spheres S-3 and the hyperboloids H-3 with the corresponding frame bundles equal to the Euclidean group of motions SE(3), the rotation group SO(4) and the Lorentz group SO(1,3). The optimal controls of these systems are solved explicitly in terms of elliptic functions. In this paper, a geometric interpretation of the extremal solutions is given with particular emphasis to a singularity in the explicit solutions. Using a reduced form of the Casimir functions the geometry of these solutions are illustrated.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A finite-difference scheme based on flux difference splitting is presented for the solution of the two-dimensional shallow-water equations of ideal fluid flow. A linearised problem, analogous to that of Riemann for gasdynamics, is defined and a scheme, based on numerical characteristic decomposition, is presented for obtaining approximate solutions to the linearised problem. The method of upwind differencing is used for the resulting scalar problems, together with a flux limiter for obtaining a second-order scheme which avoids non-physical, spurious oscillations. An extension to the two-dimensional equations with source terms, is included. The scheme is applied to a dam-break problem with cylindrical symmetry.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A one-dimensional shock (bore) reflection problem is discussed for the two-dimensional shallow water equations with cylindrical symmetry. The differential equations for a similarity solution are derived and solved numerically in conjunction with the Rankine-Hugoniot shock relations.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Solutions of a two-dimensional dam break problem are presented for two tailwater/reservoir height ratios. The numerical scheme used is an extension of one previously given by the author [J. Hyd. Res. 26(3), 293–306 (1988)], and is based on numerical characteristic decomposition. Thus approximate solutions are obtained via linearised problems, and the method of upwind differencing is used for the resulting scalar problems, together with a flux limiter for obtaining a second order scheme which avoids non-physical, spurious oscillations.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A one-dimensional shock-reflection test problem in the case of slab, cylindrical or spherical symmetry is discussed for multi-component flows. The differential equations for a similarity solution are derived and then solved numerically in conjunction with the Rankine-Hugoniot shock relations.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: Insulin sensitivity (Si) is improved by weight loss and exercise, but the effects of the replacement of saturated fatty acids (SFAs) with monounsaturated fatty acids (MUFAs) or carbohydrates of high glycemic index (HGI) or low glycemic index (LGI) are uncertain. Objective: We conducted a dietary intervention trial to study these effects in participants at risk of developing metabolic syndrome. Design: We conducted a 5-center, parallel design, randomized controlled trial [RISCK (Reading, Imperial, Surrey, Cambridge, and Kings)]. The primary and secondary outcomes were changes in Si (measured by using an intravenous glucose tolerance test) and cardiovascular risk factors. Measurements were made after 4 wk of a high-SFA and HGI (HS/HGI) diet and after a 24-wk intervention with HS/HGI (reference), high-MUFA and HGI (HM/HGI), HM and LGI (HM/LGI), low-fat and HGI (LF/HGI), and LF and LGI (LF/LGI) diets. Results: We analyzed data for 548 of 720 participants who were randomly assigned to treatment. The median Si was 2.7 × 10−4 mL · μU−1 · min−1 (interquartile range: 2.0, 4.2 × 10−4 mL · μU−1 · min−1), and unadjusted mean percentage changes (95% CIs) after 24 wk treatment (P = 0.13) were as follows: for the HS/HGI group, −4% (−12.7%, 5.3%); for the HM/HGI group, 2.1% (−5.8%, 10.7%); for the HM/LGI group, −3.5% (−10.6%, 4.3%); for the LF/HGI group, −8.6% (−15.4%, −1.1%); and for the LF/LGI group, 9.9% (2.4%, 18.0%). Total cholesterol (TC), LDL cholesterol, and apolipoprotein B concentrations decreased with SFA reduction. Decreases in TC and LDL-cholesterol concentrations were greater with LGI. Fat reduction lowered HDL cholesterol and apolipoprotein A1 and B concentrations. Conclusions: This study did not support the hypothesis that isoenergetic replacement of SFAs with MUFAs or carbohydrates has a favorable effect on Si. Lowering GI enhanced reductions in TC and LDL-cholesterol concentrations in subjects, with tentative evidence of improvements in Si in the LF-treatment group. This trial was registered at clinicaltrials.gov as ISRCTN29111298.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study explores the implications of an organization moving toward service-dominant logic (S-D logic) on the sales function. Driven by its customers’ needs, a service orientation by its nature requires personal interaction and sales personnel are in an ideal position to develop offerings with the customer. However, the development of S-D logic may require sales staff to develop additional skills. Employing a single case study, the study identified that sales personnel are quick to appreciate the advantages of S-D logic for customer satisfaction and six specific skills were highlighted and explored. Further, three propositions were identified: in an organization adopting S-D logic, the sales process needs to elicit needs at both embedded-value and value-in-use levels. In addition, the sales process needs to coproduce not just goods and service attributes but also attributes of the customer’s usage processes. Further, the sales process needs to coproduce not just goods and service attributes but also attributes of the customer’s usage processes.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper represents the last technical contribution of Professor Patrick Parks before his untimely death in February 1995. The remaining authors of the paper, which was subsequently completed, wish to dedicate the article to Patrick. A frequency criterion for the stability of solutions of linear difference equations with periodic coefficients is established. The stability criterion is based on a consideration of the behaviour of a frequency hodograph with respect to the origin of coordinates in the complex plane. The formulation of this criterion does not depend on the order of the difference equation.