949 resultados para thymidine kinase
Resumo:
Osseous metastases account for most of the morbidity and mortality associated with prostate cancer, for which there are currently no effective therapies. In the skeletal metastatic environment, neoplastic prostatic epithelial cells interact in a bidirectional stimulatory manner with osteoblastic stromal cells. Similarly, the presence of osteoblastic cells is essential for the survival and maintenance of intraosseous prostate cancer cells. In this thesis, I have developed novel gene therapy strategies for the treatment of androgen-independent human prostate cancers in experimental animal models. First, Ad-CMV-p53, a recombinant adenovirus (Ad) containing p53 tumor suppressor gene driven by the universal cytomegalovirus promoter, was effective in inhibiting prostate cancer cell growth, and direct intratumoral injections of Ad-CMV-p53 resulted in tumor regression. Second, because prostate cancer cells as well as osteoblastic cells produce osteocalcin (OC), OC promoter mediated tissue/tumor specific toxic gene therapy is developed to interrupt stromal-epithelial communications by targeting both cell types. Ad-OC-TK, a recombinant Ad containing the herpes simplex virus thymidine kinase (TK) gene driven by the OC promoter, was generated to inhibit the growth of osteoblastic osteosarcoma with prodrug acyclovir (ACV). Ad-OC-TK/ACV also inhibited the growth of prostate cancer cells and suppressed the growth of subcutaneous and intraosseous prostate tumor. In order to combine treatment modalities to maximize tumor cell-kill with minimized host toxicities, Ad-OC-TK/ACV was applied in combination with low dose methotrexate to eradicate osteoblastic osteosarcoma. In targeting of micrometastatic disease, intravenous Ad-OC-TK/ACV treatment resulted in significant tumor nodule reduction and prolonged the survival of animals harboring osteosarcoma lung metastases without significant host toxicity. Ad-OC-TK is a rational choice for the treatment of prostate cancer skeletal metastasis because OC is uniformly detected in both primary and metastatic human prostate cancer specimens by immunohistochemistry. Ad-OC-TK/ACV inhibits the growth not only of prostate cancer cells but also of their supporting bone stromal cells. Targeting both prostate cancer epithelium and its supporting stroma may be most efficacious for the treatment of prostate cancer osseous metastases. ^
Resumo:
Microcell-mediated chromosome transfer is a method of gene transfer which allows for the introduction of single or small groups of intact chromosomes into recipient host cells. Microcell transfer was first performed by Fournier and Ruddle using rodent microcells and various recipient cells. Expansion of this technology to include the transfer of normal human genetic material has been hindered because large micronucleate populations from diploid human cells have been unobtainable. This dissertation research describes, however, the methods for production of micronuclei in 40-60% of normal human fibroblasts. Once micronucleate cells were obtained, they were enucleated by centrifugation in the presence of Cytochalasin B; the microcells were then purified and fused to recipient mouse (LMTK('-)) cells using a new fusion protocol employing polyethylene glycol containing phytohemagglutinin. Microcell clones were isolated from the HAT selection system. Alkaline Giemsa staining performed on these hybrids indicated the presence of a single human chromosome in each of seven microcell clones from three separate experiments. That chromosome was further identified by G banding analysis to be human chromosome #17, which codes for thymidine kinase. The time course for production of these hybrids from fusion to karyotypic analysis was 6 weeks. The viability of the transferred human genetic material was assessed by electrophoretic isozyme analysis.^ Subsequent experiments were performed in an attempt to optimize the transfer frequency for the thymidine kinase gene using this system. Results indicated that the frequency could be increased from < 1 x 10('-6) in initial experiments to 2 x 10('-5) in the latest experiment. Analyses were also conducted to determine the number of chromosomes per isolated microcell as well as to investigate the stability of the transferred human chromosome in the mouse genome. ^
Resumo:
Red Blood cell mediated and glass needle mediated microinjection technology was used to introduce macromolecules into mammalian somatic cells. The biological activities of DNA synthesis inducing factor(s) (Chapter 1), mitotic factor(s) (Chapter 2), and DNA coding for ovalbumin and thymidine kinase (Chapter 3) were studied following injection into mammalian somatic cells.^ Chapter 1. A cell undergoing DNA replication (S phase) contains a factor(s) that induces DNA synthesis prematurely in a G(,1) nucleus when an S phase cell is fused to a G(,1) cell. An assay for the active factor(s) was developed in which a mixture of s phase extract loaded red blood cells (RBC) and synchronous G(,1) HeLa cells was centrifuged onto Concanavalin A (Con A) treated coverslips and fused by PEG. This technique is called "Centrifusion". The synchronous G(,1) HeLa cells injected with S phase extract initiated DNA synthesis earlier than the control G(,1) cells mock injected with RBC loaded with buffer.^ Chapter 2. It has been demonstrated that fusion between a mitotic and an interphase cell usually leads to breakdown of the interphase nucleus, followed by condensation of the interphase chromatin into discrete chromosomes, a process termed premature chromosome condensation. I wanted to develop an assay for the mitotic factor(s) that induces premature chromosome condensation. Experiments were performed utilizing glass needle mediated microinjection of HeLa cell mitotic extract into interphase somatic mammalian cells in an attempt to induce premature chromosome condensation. However, I was not able to induce premature chromosome condensation in the interphase cells, probably because of an inability to introduce sufficient mitotic factor(s) into the cells.^ Chapter 3. A recombinant plasmid containing the chicken ovalbumin gene and three copies of the Herpes thymidine Kinase gene (pOV12-TK) was introduced into mouse LMTK('-) cell nuclei using glass needle mediated gene transfer resulting in LMTK('+) clones that were selected for in HAT medium. Restriction enzyme analysis of the high molecular weight DNA from 6 HAT medium survivor cell clones revealed the presence of one or at best only a few copies of the 12kb ovalbumin gene per mouse genome. Further analysis showed the ovalbumin DNA was not rearranged and was associated with high molecular weight mouse cell DNA. Each of the analyzed cell clones produced ovalbumin demonstrating that the biological activity of the microinjected ovalbumin was retained. ^
Resumo:
Colorectal cancer is the number two cancer killer in the United States. Although primary colorectal cancer can be resected by surgery, patients often die from metastatic disease. Liver is the most common site of metastasis for colorectal cancer. It is difficult to selectively kill metastatic colon cancer cells without damaging normal liver functions. Thus it becomes a high priority to develop a selective targeting system for the treatment of colorectal cancer liver metastasis. ^ In the current study, a gene therapy strategy that allows a therapeutic gene to selectively destroy metastatic colon cancer cells without affecting normal liver cells is developed. The APC gene is frequently mutated in colorectal cancers. These mutations activate β-catenin responsive promoters. An optimized β-catenin responsive promoter, containing TCF consensus binding sites, was engineered for this study. This TCF promoter was found to express preferentially in APC mutated/β-catenin activated colorectal cancers while maintaining a low expression level in cell lines of liver origin. A recombinant adenoviral vector AdTCF-TK, in which the TCF promoter controls expression of the herpes simplex virus thymidine kinase gene, selectively destroyed colorectal cancer cells in vitro. AdTCF-TK virus and ganciclovir treatment also inhibited the growth of solid tumour derived from the colon cancer cell line DLD-1 in nude mice. In a control experiment, the growth inhibition effect of the same virus was attenuated in a liver cancer cell line. ^ In the present study, a novel method was developed to target therapeutic gene expression to colon cancer cells at reduced liver toxicity to the patients. The same gene therapy design may also be applied to treat tumours carrying mutations in the β-catenin gene, which is a central component of the APC signal transduction pathway. In summary, the principle for a rational design of a cancer specific treatment approach is demonstrated in this study. In the future, mutations in cancer patients will be more easily identified. Using the same principle developed in this study, specific regimen can be designed to treat these patients based on the specific genetic changes found in the tumour. ^
Resumo:
The neu oncogene encodes a growth factor receptor-like protein, p185, with an intrinsic tyrosine kinase activity. A single point mutation, an A to T transversion resulting in an amino acid substitution from valine to glutamic acid, in the transmembrane domain of the rat neu gene was found to be responsible for the transforming and tumorigenic phenotype of the cells that carry it. In contrast, the human proto-neu oncogene is frequently amplified in tumors and cell lines derived from tumors and the human neu gene overexpression/amplification in breast and ovarian cancers is known to correlate with poor patient prognosis. Examples of the human neu gene overexpression in the absence of gene amplification have been observed, which may suggest the significant role of the transcriptional and/or post-transcriptional control of the neu gene in the oncogenic process. However, little is known about the transcriptional mechanisms which regulate the neu gene expression. In this study, three examples are presented to demonstrate the positive and negative control of the neu gene expression.^ First, by using band shift assays and methylation interference analyses, I have identified a specific protein-binding sequence, AAGATAAAACC ($-$466 to $-$456), that binds a specific trans-acting factor termed RVF (for EcoRV factor on the neu promoter). The RVF-binding site is required for maximum transcriptional activity of the rat neu promoter. This same sequence is also found in the corresponding regions of both human and mouse neu promoters. Furthermore, this sequence can enhance the CAT activity driven by a minimum promoter of the thymidine kinase gene in an orientation-independent manner, and thus it behaves as an enhancer. In addition, Southwestern (DNA-protein) blot analysis using the RVF-binding site as a probe points to a 60-kDa polypeptide as a potential candidate for RVF.^ Second, it has been reported that the E3 region of adenovirus 5 induces down-regulation of epidermal growth factor (EGF) receptor through endocytosis. I found that the human neu gene product, p185, (an EGF receptor-related protein) is also down-regulated by adenovirus 5, but via a different mechanism. I demonstrate that the adenovirus E1a gene is responsible for the repression of the human neu gene at the transcriptional level.^ Third, a differential expression of the neu gene has been found in two cell model systems: between the mouse fibroblast Swiss-Webster 3T3 (SW3T3) and its variant NR-6 cells; and between the mouse liver tumor cell line, Hep1-a, and the mouse pancreas tumor cell line, 266-6. Both NR-6 and 266-6 cell lines are not able to express the neu gene product, p185. I demonstrate that, in both cases, the transcriptional repression of the neu gene may account for the lack of the p185 expression in these two cell lines. ^
Resumo:
Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^
Resumo:
To investigate the regulation of the human fatty acid synthase gene by the thyroid hormone triiodothyronine, various constructs of the human fatty acid synthase promoter and the luciferase reporter gene were transfected in combination with plasmids expressing the thyroid hormone and the retinoid X receptors in HepG2 cells. The reporter gene was activated 25-fold by the thyroid hormone in the presence of the thyroid hormone receptor. When both the thyroid hormone and the retinoid X receptors were expressed in HepG2 cells, there was about a 100-fold increase in reporter gene expression. 5′-Deletion analysis disclosed two thyroid hormone response elements, TRE1 (nucleotides −870 to −650) and TRE2 (nucleotides −272 to −40), in the human fatty acid synthase promoter. The presence of thyroid hormone response elements in these two regions of the promoter was confirmed by cloning various fragments of these two regions in the minimal thymidine kinase promoter−luciferase reporter gene plasmid construct and determining reporter gene expression. The results of this cloning procedure and those of electrophoretic mobility shift assays indicated that the sequence GGGTTAcgtcCGGTCA (nucleotides −716 to −731) represents TRE1 and that the sequence GGGTCC (nucleotides −117 to −112) represents TRE2. The sequence of TRE1 is very similar to the consensus sequence of the thyroid hormone response element, whereas the sequence of TRE2 contains only a half-site of the thyroid hormone response element consensus motif because it lacks the direct repeat. The sequences on either side of TRE2 seem to influence its response to the thyroid hormone and retinoid X receptors.
Resumo:
The tumor necrosis factor-α (TNF-α) promoter was used to explore the molecular mechanisms of estradiol (E2)-dependent repression of gene transcription. E2 inhibited basal activity and abolished TNF-α activation of the TNF-α promoter. The E2-inhibitory element was mapped to the −125 to −82 region of the TNF-α promoter, known as the TNF-responsive element (TNF-RE). An AP-1-like site in the TNF-RE is essential for repression activity. Estrogen receptor (ER) β is more potent than ERα at repressing the −1044 TNF-α promoter and the TNF-RE upstream of the herpes simplex virus thymidine kinase promoter, but weaker at activating transcription through an estrogen response element. The activation function-2 (AF-2) surface in the ligand-binding domain is required for repression, because anti-estrogens and AF-2 mutations impair repression. The requirement of the AF-2 surface for repression is probably due to its capacity to recruit p160 coactivators or related coregulators, because overexpressing the coactivator glucocorticoid receptor interacting protein-1 enhances repression, whereas a glucocorticoid receptor interacting protein-1 mutant unable to interact with the AF-2 surface is ineffective. Furthermore, receptor interacting protein 140 prevents repression by ERβ, probably by interacting with the AF-2 surface and blocking the binding of endogenous coactivators. These studies demonstrate that E2-mediated repression requires the AF-2 surface and the participation of coactivators or other coregulatory proteins.
Resumo:
Twenty-four base pairs of the human antioxidant response element (hARE) are required for high basal transcription of the NAD(P)H:quinone oxidoreductase1 (NQO1) gene and its induction in response to xenobiotics and antioxidants. hARE is a unique cis-element that contains one perfect and one imperfect AP1 element arranged as inverse repeats separated by 3 bp, followed by a “GC” box. We report here that Jun, Fos, Fra, and Nrf nuclear transcription factors bind to the hARE. Overexpression of cDNA derived combinations of the nuclear proteins Jun and Fos or Jun and Fra1 repressed hARE-mediated chloramphenicol acetyltransferase (CAT) gene expression in transfected human hepatoblastoma (Hep-G2) cells. Further experiments suggested that this repression was due to overexpression of c-Fos and Fra1, but not due to Jun proteins. The Jun (c-Jun, Jun-B, and Jun-D) proteins in all the possible combinations were more or less ineffective in repression or upregulation of hARE-mediated gene expression. Interestingly, overexpression of Nrf1 and Nrf2 individually in Hep-G2 and monkey kidney (COS1) cells significantly increased CAT gene expression from reporter plasmid hARE-thymidine kinase-CAT in transfected cells that were inducible by β-naphthoflavone and tert-butyl hydroquinone. These results indicated that hARE-mediated expression of the NQO1 gene and its induction by xenobiotics and antioxidants are mediated by Nrf1 and Nrf2. The hARE-mediated basal expression, however, is repressed by overexpression of c-Fos and Fra1.
Resumo:
We are developing quantitative assays to repeatedly and noninvasively image expression of reporter genes in living animals, using positron emission tomography (PET). We synthesized positron-emitting 8-[18F]fluoroganciclovir (FGCV) and demonstrated that this compound is a substrate for the herpes simplex virus 1 thymidine kinase enzyme (HSV1-TK). Using positron-emitting FGCV as a PET reporter probe, we imaged adenovirus-directed hepatic expression of the HSV1-tk reporter gene in living mice. There is a significant positive correlation between the percent injected dose of FGCV retained per gram of liver and the levels of hepatic HSV1-tk reporter gene expression (r2 > 0.80). Over a similar range of HSV1-tk expression in vivo, the percent injected dose retained per gram of liver was 0–23% for ganciclovir and 0–3% for FGCV. Repeated, noninvasive, and quantitative imaging of PET reporter gene expression should be a valuable tool for studies of human gene therapy, of organ/cell transplantation, and of both environmental and behavioral modulation of gene expression in transgenic mice.
Resumo:
The 5′-untranslated region of hepatitis C virus (HCV) is highly conserved, folds into a complex secondary structure, and functions as an internal ribosome entry site (IRES) to initiate translation of HCV proteins. We have developed a selection system based on a randomized hairpin ribozyme gene library to identify cellular factors involved in HCV IRES function. A retroviral vector ribozyme library with randomized target recognition sequences was introduced into HeLa cells, stably expressing a bicistronic construct encoding the hygromycin B phosphotransferase gene and the herpes simplex virus thymidine kinase gene (HSV-tk). Translation of the HSV-tk gene was mediated by the HCV IRES. Cells expressing ribozymes that inhibit HCV IRES-mediated translation of HSV-tk were selected via their resistance to both ganciclovir and hygromycin B. Two ribozymes reproducibly conferred the ganciclovir-resistant phenotype and were shown to inhibit IRES-mediated translation of HCV core protein but did not inhibit cap-dependent protein translation or cell growth. The functional targets of these ribozymes were identified as the gamma subunits of human eukaryotic initiation factors 2B (eIF2Bγ) and 2 (eIF2γ), respectively. The involvement of eIF2Bγ and eIF2γ in HCV IRES-mediated translation was further validated by ribozymes directed against additional sites within the mRNAs of these genes. In addition to leading to the identification of cellular IRES cofactors, ribozymes obtained from this cellular selection system could be directly used to specifically inhibit HCV viral translation, thereby facilitating the development of new antiviral strategies for HCV infection.
Resumo:
Estrogen receptor (ER) and thyroid hormone receptors (TRs) are ligand-dependent nuclear transcription factors that can bind to an identical half-site, AGGTCA, of their cognate hormone response elements. By in vitro transfection analysis in CV-1 cells, we show that estrogen induction of chloramphenicol acetyltransferase (CAT) activity in a construct containing a CAT reporter gene under the control of a minimal thymidine kinase (tk) promoter and a copy of the consensus ER response element was attenuated by cotransfection of TR alpha 1 plus triiodothyronine treatment. This inhibitory effect of TR was ligand-dependent and isoform-specific. Neither TR beta 1 nor TR beta 2 cotransfection inhibited estrogen-induced CAT activity, although both TR alpha and TR beta can bind to a consensus ER response element. Furthermore, cotransfection of a mutated TR alpha 1 that lacks binding to the AGGTCA sequence also inhibited the estrogen effect. Thus, the repression of estrogen action by liganded TR alpha 1 may involve protein-protein interactions although competition of ER and TR at the DNA level cannot be excluded. A similar inhibitory effect of liganded TR alpha 1 on estrogen induction of CAT activity was observed in a construct containing the preproenkephalin (PPE) promoter. A study in hypophysectomized female rats demonstrated that the estrogen-induced increase in PPE mRNA levels in the ventromedial hypothalamus was diminished by coadministration of triiodothyronine. These results suggest that ER and TR may interact to modulate estrogen-sensitive gene expression, such as for PPE, in the hypothalamus.
Resumo:
Recombinant adenoviral mediated delivery of suicide and cytokine genes has been investigated as a treatment for hepatic metastases of colon carcinoma in mice. Liver tumors were established by intrahepatic implantation of a poorly immunogenic colon carcinoma cell line (MCA-26), which is syngeneic in BALB/c mice. Intratumoral transfer of the herpes simplex virus type 1 thymidine kinase (HSV-tk) and the murine interleukin (mIL)-2 genes resulted in substantial hepatic tumor regression, induced an effective systemic antitumoral immunity in the host and prolonged the median survival time of the treated animals from 22 to 35 days. The antitumoral immunity declined gradually, which led to tumor recurrence over time. A recombinant adenovirus expressing the mIL-12 gene was constructed and tested in the MCA-26 tumor model. Intratumoral administration of this cytokine vector alone increased significantly survival time of the animals with 25% of the treated animals still living over 70 days. These data indicate that local expression of IL-12 may also be an attractive treatment strategy for metastatic colon carcinoma.
Resumo:
The recent discovery of long term AIDS nonprogressors who harbor nef-attenuated HIV suggests that a naturally occurring live vaccine for AIDS may already exist. Animal models have shown that a live vaccine for AIDS, attenuated in nef, is the best candidate vaccine. There are considerable risks, real and perceived, with the use of live HIV vaccines. We have introduced a conditional lethal genetic element into HIV-1 and simian immunodeficiency virus (SIV) molecular clones deleted in nef. The antiviral strategy we employed targets both virus replication and the survival of the infected cell. The suicide gene, herpes simplex virus thymidine kinase (tk), was expressed and maintained in HIV over long periods of time. Herpes simplex virus tk confers sensitivity to the antiviral activity of acyclic nucleosides such as ganciclovir (GCV). HIV-tk and SIV-tk replication were sensitive to GCV at subtoxic concentrations, and virus-infected cells were eliminated from tumor cell lines as well as primary cell cultures. We found the HIV-tk virus to be remarkably stable even after being cultured in media containing a low concentration of GCV and then challenged with the higher dose and that while GCV resistant escape mutants did arise, a significant fraction of the virus remained sensitive to GCV.
Resumo:
So324 is a 2',3'-dideoxy-2',3'-didehydrothymidine-5'-monophosphate (d4T-MP) prodrug containing at the phosphate moiety a phenyl group and the methylester of alanine linked to the phosphate through a phosphoramidate linkage. So324 has anti-HIV activity in human CEM, MT4, and monocyte/macrophage cells that is superior to that of d4T. In contrast to d4T, So324 is also able to inhibit HIV replication in thymidine kinase-deficient CEM cells. After uptake of So324 by intact human lymphocytes, d4T-MP is released and subsequently converted intracellularly to d4T-TP. In addition, accumulation of substantial amounts of a novel d4T derivative has been found. This d4T metabolite has been characterized as alaninyl d4T-MP. The latter metabolite accumulates at approximately 13- to 200-fold higher levels than d4T-TP depending the experimental conditions. Alaninyl d4T-MP should be considered as an intra- and/or extracellular depot form of d4T and/or d4T-MP. These findings may explain the superior anti-retroviral activity of So324 over d4T in cell culture.