954 resultados para semi-quantitative RT-PCR


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Reverse transcribed RNAs coding for YnKn, YnSKn, SKn, and KS dehydrin types in drought-stressed white clover (Trifolium repens) were identified and characterized. The nucleotide analyses revealed the complex nature of dehydrin-coding sequences, often featured with alternative start and stop codons within the open reading frames, which could be a prerequisite for high variability among the transcripts originating from a single gene. For some dehydrin sequences, the existence of natural antisense transcripts was predicted. The differential distribution of dehydrin homologues in roots and leaves from a single white clover stolon under normal and drought conditions was evaluated by semi-quantitative RT-PCR and immunoblots with antibodies against the conserved K-, Y- and S-segments. The data suggest that different dehydrin classes have distinct roles in the drought stress response and vegetative development, demonstrating some specific characteristic features. Substantial levels of YSK-type proteins with different molecular weights were immunodetected in the non-stressed developing leaves. The acidic SK2 and KS dehydrin transcripts exhibited some developmental gradient in leaves. A strong increase of YK transcripts was documented in the fully expanded leaves and roots of drought-stressed individuals. The immunodetected drought-induced signals imply that Y- and K-segment containing dehydrins could be the major inducible Late Embryogenesis Abundant class 2 proteins (LEA 2) that accumulate predominantly under drought.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Malaria remains a serious public health challenge in the tropical world, with 584,000 deaths globally in 2013, of which 90% occurred in Africa, and mostly in pregnant women and children under the age of five. Anopheles gambiae (An. gambiae) is the principal malaria vector in Africa, where vector control measures involve the use of insecticides in the forms of long-lasting insecticide-treated nets (LLINs) and indoor residual spraying (IRS). The development of insecticides resistance mitigates these approaches. Glutathione (GSH) is widely distributed among all living organisms, and is associated with detoxification pathways, especially the Glutathione S-transferases (GSTs). Its direct involvement and relevance in insecticide resistance in An. gambiae has not been determined. Thus, this work examines the contribution of GSH, its biosynthetic genes (GCLM, GCLC) and their possible transcriptional regulator Nrf2 in insecticide resistance in An. gambiae sampled from agricultural setting (areas of intensive agriculture) and residential setting (domestic area). Bioinformatics analysis, W.H.O. adult susceptibility bioassays and molecular techniques were employed to investigate. Total RNA was first isolated from the adults An. gambiae mosquitoes raised from agricultural and residential field-caught larvae which had been either challenged or unchallenged with insecticides. Semi-quantitative RT-PCR using gel image densitometry was used to determine the expression levels of GCLM, GCLC genes and Nrf2. Bioinformatics’ results established the presence of putative AGAP010259 (AhR) and AGAP005300 (Nf2e1) transcription factor binding sites in An. gambiae GCLC and GCLM promoters in silico. An. gambiae s.l. studied here were highly resistant to DDT and permethrin but less resistant to bendiocarb. Both knockdown resistance (kdr) mutation variants L1014S and L1014F that confers resistance to pyrethroid insecticides were identified in both An. coluzzii and An. arabiensis sampled from northern Nigeria. The L1014F was much associated with An. coluzzii. A significant positive correlation (P=0.04) between the frequency of the L1014F point mutation and resistance to DDT and permethrin was observed. However, a weak or non-significant correlation (P=0.772) between the frequency of the L1014S point mutation and resistance was also found. L1014S and L1014F mutations co-occurred in both agricultural and residential settings with high frequencies. However, the frequencies of the two mutations were greater in the agricultural settings than in the residential settings. The levels of total, reduced and oxidized GSH were significantly higher in mosquitoes from agricultural sites than those from residential sites. Increased oxidized GSH levels appears to correlate with higher DDT resistance. The expression levels of GCLM, GCLC and Nrf2 were also significantly up-regulated in adults An. gambiae raised from agricultural and residential field-caught larvae when challenged with insecticide. However, there was higher constitutive expression of GCLM, GCLC and Nrf2 in mosquitoes from agricultural setting. The increased expression levels of these genes and also GSH levels in this population suggest their roles in the response and adaptation of An. gambiae to insecticide challenges. There exists the feasibility of using GSH status in An. gambiae to monitor adaptation and resistance to insecticides.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Plant microRNAs (miRNAs) are a class of endogenous small RNAs that are essential for plant development and survival. They arise from larger precursor RNAs with a characteristic hairpin structure and regulate gene activity by targeting mRNA transcripts for cleavage or translational repression. Efficient and reliable detection and quantification of miRNA expression has become an essential step in understanding their specific roles. The expression levels of miRNAs can vary dramatically between samples and they often escape detection by conventional technologies such as cloning, northern hybridization and microarray analysis. The stem-loop RT-PCR method described here is designed to detect and quantify mature miRNAs in a fast, specific, accurate and reliable manner. First, a miRNA-specific stem-loop RT primer is hybridized to the miRNA and then reverse transcribed. Next, the RT product is amplified and monitored in real time using a miRNA-specific forward primer and the universal reverse primer. This method enables miRNA expression profiling from as little as 10 pg of total RNA and is suitable for high-throughput miRNA expression analysis.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Despite reports confirming cell-cycle dependent gene expression and a number of studies describing specific circumstances in which β-actin is also regulated, the mRNA for β-actin remains a widely used housekeeping gene internal control. Utilizing differential reverse transcriptase-polymerase chain reaction (RT-PCR), we report here the dose-dependent inhibition of β-actin by matrigel. This was detected by comparison to the very moderate inhibition of the target gene, membrane type-1 matrix metalloproteinase (MT1-MMP), with results independently confirmed by similar findings on MT1-MMP expression using competitive RT-PCR. Furthermore, RT-PCR of the housekeeping gene 18 Svedberg Units (S) rRNA demonstrated excellent consistency, reproducibility and non-regulation by a matrigel treatment. We conclude that β-actin is highly regulated by matrigel and therefore unsuitable as an internal control in this treatment. Hence, these findings suggest that researchers have a responsibility to ensure that the housekeeping gene of choice is not regulated in their specific application, as such regulation may dramatically affect the accuracy of their results. This study reinforces the necessity for minimally regulated housekeeping genes such as 18S rRNA, and the superiority of competitive templates as internal controls for quantitative applications of RT-PCR.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

PURPOSE: To determine whether continuous monitoring of SYBR Green I fluorescence provides a reliable and flexible method of quantitative RT-PCR. Our aims were (i) to test whether SYBR Green I analysis could quantify a wide range of known VEGF template concentrations, (ii) to apply this method in an experimental model, and (iii) to determine whether 20 existing primer pairs could be used to quantify their cognate mRNAs.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Enterovirus 71 (EV71) is one of the main causative agents of hand, foot and mouth disease (HFMD) in young children. Infections caused by EV71 could lead to many complications, ranging from brainstem encephalitis to pulmonary oedema, resulting in high mortality. Thus, rapid detection of the virus is required to enable measures to be implemented in preventing widespread transmission. Based on primers and probes targeting at the VP1 region, a real-time reverse-transcriptase polymerase chain reaction (RT-PCR) hybridization probe assay was developed for specific detection of EV71 from clinical specimens. Quantitative analysis showed that the assay was able to detect as low as 5 EV71 viral copies and EV71 was detected from 46 of the 55 clinical specimens obtained from pediatric patients suffering from HFMD during the period from 2000 to 2003 in Singapore. This study showed that the single tube real-time RT-PCR assay developed in this study can be applied as a rapid and sensitive method for specific detection of EV71 directly from clinical specimens. (c) 2005 Elsevier Ltd. All rights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Introduction The ability to screen blood of early stage operable breast cancer patients for circulating tumour cells is of potential importance for identifying patients at risk of developing distant relapse. We present the results of a study of the efficacy of the immunobead RT-PCR method in identifying patients with circulating tumour cells. Results Immunomagnetic enrichment of circulating tumour cells followed by RT-PCR (immunobead RT-PCR) with a panel of five epithelial specific markers (ELF3, EPHB4, EGFR, MGB1 and TACSTD1) was used to screen for circulating tumour cells in the peripheral blood of 56 breast cancer patients. Twenty patients were positive for two or more RT-PCR markers, including seven patients who were node negative by conventional techniques. Significant increases in the frequency of marker positivity was seen in lymph node positive patients, in patients with high grade tumours and in patients with lymphovascular invasion. A strong trend towards improved disease free survival was seen for marker negative patients although it did not reach significance (p = 0.08). Conclusion Multi-marker immunobead RT-PCR analysis of peripheral blood is a robust assay that is capable of detecting circulating tumour cells in early stage breast cancer patients.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Utilising archival human breast cancer biopsy material we examined the stromal/epithelial interactions of several matrix metalloproteinases (MMPs) using in situ-RT-PCR (IS-RT-PCR). In breast cancer, the stromal/epithelial interactions that occur, and the site of production of these proteases, are central to understanding their role in invasive and metastatic processes. We examined MT1-MMP (MMP-14, membrane type-1-MMP), MMP-1 (interstitial collagenase) and MMP-3 (stromelysin-1) for their localisation profile in progressive breast cancer biopsy material (poorly differentiated invasive breast carcinoma (PDIBC), invasive breast carcinomas (IBC) and lymph node metastases (LNM)). Expression of MT1-MMP, MMP-1 and MMP-3 was observed in both the tumour epithelial and surrounding stromal cells in most tissue sections examined. MT1-MMP expression was predominantly localised to the tumour component in the pre-invasive lesions. MMP-1 gene expression was relatively well distributed between both tissue compartments, while MMP-3 demonstrated highest expression levels in the stromal tissue surrounding the epithelial tumour cells. The results demonstrate the ability to distinguish compartmental gene expression profiles using IS-RT-PCR. Further, we suggest a role for MT1-MMP in early tumour progression, expression of MMP-1 during metastasis and focal expression pattern of MMP-3 in areas of expansion. These expression profiles may provide markers for early breast cancer diagnoses and present potential therapeutic targets.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Background Members of the matrix metalloproteinase (MMP) family of proteases are required for the degradation of the basement membrane and extracellular matrix in both normal and pathological conditions. In vitro, MT1-MMP (MMP-14, membrane type-1-MMP) expression is higher in more invasive human breast cancer (HBC) cell lines, whilst in vivo its expression has been associated with the stroma surrounding breast tumours. MMP-1 (interstitial collagenase) has been associated with MDA-MB-231 invasion in vitro, while MMP-3 (stromelysin-1) has been localised around invasive cells of breast tumours in vivo. As MMPs are not stored intracellularly, the ability to localise their expression to their cells of origin is difficult. Methods We utilised the unique in situ-reverse transcription-polymerase chain reaction (IS-RT-PCR) methodology to localise the in vitro and in vivo gene expression of MT1-MMP, MMP-1 and MMP-3 in human breast cancer. In vitro, MMP induction was examined in the MDA-MB-231 and MCF-7 HBC cell lines following exposure to Concanavalin A (Con A). In vivo, we examined their expression in archival paraffin embedded xenografts derived from a range of HBC cell lines of varied invasive and metastatic potential. Mouse xenografts are heterogenous, containing neoplastic human parenchyma with mouse stroma and vasculature and provide a reproducible in vivo model system correlated to the human disease state. Results In vitro, exposure to Con A increased MT1-MMP gene expression in MDA-MB-231 cells and decreased MT1-MMP gene expression in MCF-7 cells. MMP-1 and MMP-3 gene expression remained unchanged in both cell lines. In vivo, stromal cells recruited into each xenograft demonstrated differences in localised levels of MMP gene expression. Specifically, MDA-MB-231, MDA-MB-435 and Hs578T HBC cell lines are able to influence MMP gene expression in the surrounding stroma. Conclusion We have demonstrated the applicability and sensitivity of IS-RT-PCR for the examination of MMP gene expression both in vitro and in vivo. Induction of MMP gene expression in both the epithelial tumour cells and surrounding stromal cells is associated with increased metastatic potential. Our data demonstrate the contribution of the stroma to epithelial MMP gene expression, and highlight the complexity of the role of MMPs in the stromal-epithelial interactions within breast carcinoma.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The in situ-reverse transcription-polymerase chain reaction (IS-RT-PCR) is a method that allows the direct localisation of gene expression. The method utilises the dual buffer mediated activity of the enzyme rTth DNA polymerase enabling both reverse transcription and DNA amplification. Labelled nucleoside triphosphates allow the site of expression to be labelled, rather than the PCR primers themselves, giving a more accurate localisation of transcript expression and decreased background than standard in situ hybridisation (ISH) assays. The MDA-MB-231 human breast carcinoma (HBC) cell line was assayed via the IS-RT-PCR technique, using primers encoding MT-MMP (membrane-type matrix metalloproteinase) and human β-actin. Our results clearly indicate baseline expression of MT-MMP in the relatively invasive MDA-MB-231 cell line at a signal intensity similar to the housekeeping gene β-actin, and results following induction with Concanavalin A (Con A) are consistent with our previous results obtained via Northern blotting.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

MicroRNAs (miRNAs) are a class of small non-coding RNAs with a critical role in development and environmental responses. Efficient and reliable detection of miRNAs is an essential step towards understanding their roles in specific cells and tissues. However, gel-based assays currently used to detect miRNAs are very limited in terms of throughput, sensitivity and specificity. Here we provide protocols for detection and quantification of miRNAs by RT-PCR. We describe an end-point and real-time looped RT-PCR procedure and demonstrate detection of miRNAs from as little as 20 pg of plant tissue total RNA and from total RNA isolated from as little as 0.1 l of phloem sap. In addition, we have developed an alternative real-time PCR assay that can further improve specificity when detecting low abundant miRNAs. Using this assay, we have demonstrated that miRNAs are differentially expressed in the phloem sap and the surrounding vascular tissue. This method enables fast, sensitive and specific miRNA expression profiling and is suitable for facilitation of high-throughput detection and quantification of miRNA expression.