Co-administration of plasmid-encoded granulocyte-macrophage colony-stimulating factor increases human immunodeficiency virus-1 DNA vaccine-induced polyfunctional CD4+ T-cell responses

T-cell based vaccines against human immunodeficiency virus (HIV) generate specific responses that may limit both transmission and disease progression by controlling viral load. Broad, polyfunctional, and cytotoxic CD4+T-cell responses have been associated with control of simian immunodeficiency virus/HIV-1 replication, supporting the inclusion of CD4+ T-cell epitopes in vaccine formulations. Plasmid-encoded granulocyte-macrophage colony-stimulating factor (pGM-CSF) co-administration has been shown to induce potent CD4+ T-cell responses and to promote accelerated priming and increased migration of antigen-specific CD4+ T-cells. However, no study has shown whether co-immunisation with pGM-CSF enhances the number of vaccine-induced polyfunctional CD4+ T-cells. Our group has previously developed a DNA vaccine encoding conserved, multiple human leukocyte antigen (HLA)-DR binding HIV-1 subtype B peptides, which elicited broad, polyfunctional and long-lived CD4+ T-cell responses. Here, we show that pGM-CSF co-immunisation improved both magnitude and quality of vaccine-induced T-cell responses, particularly by increasing proliferating CD4+ T-cells that produce simultaneously interferon-γ, tumour necrosis factor-α and interleukin-2. Thus, we believe that the use of pGM-CSF may be helpful for vaccine strategies focused on the activation of anti-HIV CD4+ T-cell immunity.

Granulocyte-macrophage colony-stimulating factor elicits bone marrow-derived cells that promote efficient colonic mucosal healing.

BACKGROUND: Granulocyte-macrophage colony-stimulating factor (GM-CSF) therapy is effective in treating some Crohn's disease (CD) patients and protects mice from colitis induced by dextran sulfate sodium (DSS) administration. However, its mechanisms of action remain elusive. We hypothesized that GM-CSF affects intestinal mucosal repair. METHODS: DSS colitic mice were treated with daily pegylated GM-CSF or saline and clinical, histological, and inflammatory parameters were kinetically evaluated. Further, the role of bone marrow-derived cells in the impact of GM-CSF therapy on DSS colitis was addressed using cell transfers. RESULTS: GM-CSF therapy reduced clinical signs of colitis and the release of inflammatory mediators. GM-CSF therapy improved mucosal repair, with faster ulcer reepithelialization, accelerated hyperproliferative response of epithelial cells in ulcer-adjacent crypts, and lower colonoscopic ulceration scores in GM-CSF-administered mice relative to untreated mice. We observed that GM-CSF-induced promotion of mucosal repair is timely associated with a reduction in neutrophil numbers and increased accumulation of CD11b(+) monocytic cells in colon tissues. Importantly, transfer of splenic GM-CSF-induced CD11b(+) myeloid cells into DSS-exposed mice improved colitis, and lethally irradiated GM-CSF receptor-deficient mice reconstituted with wildtype bone marrow cells were protected from DSS-induced colitis upon GM-CSF therapy. Lastly, GM-CSF-induced CD11b(+) myeloid cells were shown to promote in vitro wound repair. CONCLUSIONS: Our study shows that GM-CSF-dependent stimulation of bone marrow-derived cells during DSS-induced colitis accelerates colonic tissue repair. These data provide a putative mechanism for the observed beneficial effects of GM-CSF therapy in Crohn's disease.

The roles of granulocyte-macrophage colony-stimulating factor and interleukin 3 in stromal cell-mediated hemopoiesis in vivo.

Adherent cells from murine long-term marrow cultures (LTMC) were examined for presence of mRNA for granulocyte-macrophage colony-stimulating factor (GM-CSF) and interleukin 3 (Il-3). Six hours after medium replacement, GM-CSF mRNA was detected but was no longer detectable 24 h after feeding; Il-3 mRNA was not detected at any time. Neutralizing antibodies against these factors had no effect on hemopoiesis. Exogenous Il-3 increased cell production, notably mature erythroid progenitors, whereas GM-CSF had little long-term effect even at high concentrations. Furthermore, GM-CSF appeared to be specifically removed from the medium, whereas virtually all of the Il-3 could be recovered under identical incubation conditions. These results show that Il-3 is not required for maintaining long-term hemopoiesis in vitro, whereas the precise role of GM-CSF in this system remains unclear.

Granulocyte macrophage colony stimulating factor improves mucosal repair in a mouse model of acute colitis (P278)

Background and Aims: Granulocyte-macrophage colonystimulating factor (GM-CSF), a cytokine modulating the number and function of innate immune cells, has been shown to provide symptomatic benefit in some patients with Crohn's disease (CD). Since, it becomes widely appreciated that a timely and spatially regulated action of innate immune cells is critical for tissue regeneration, we tested whether GM-CSF therapy may favours intestinal mucosal repair in the acute mouse model of dextran sulfate sodium (DSS)-induced colitis. Methods: Mice treated with GM-CSF or saline were exposed for 7 days to DSS to induce colitis. On day 5, 7 and 10, mice were subjected to colonoscopy or sacrificed for evaluation of inflammatory reaction and mucosal healing. Results: GM-CSF therapy prevented body weight loss, diarrhea, dampened inflammatory reactions and ameliorated mucosal damages. Mucosal repair improvement in GM-CSF-treated mice was observed from day 7 on both by colonoscopy (ulceration score 1.2}0.3 (GM-CSF-treated) vs 3.1}0.5 (untreated), p = 0.01) and histological analysis (percentage of reepithelialized ulcers 55%}4% (GM-CSF-treated) vs 18%}13% (untreated), p = 0.01). GM-CSF therapy can still improve the colitis when hematopoietic, but not non-hematopoietic cells, are responsive to GM-CSF, as shown in WT→GM-CSFRKO chimeras. Lastly, we observed that GM-CSF-induced promotion of wound healing is associated with a modification of the cellular composition of DSS-induced colonic inflammatory infiltrate, characterized by the reduction of neutrophil numbers and early accumulation of CD11b+Gr1lo myeloid cells. Conclusion: Our study shows that GM-CSF therapy accelerates the complex program leading to tissue repair during acute colitis and suggests that GM-CSF promotion of mucosal repair might contribute to the symptomatic benefits of GM-CSF therapy observed in some CD patients.

Granulocyte-macrophage colony-stimulating factor does not increase the potency or efficacy of a foot-and-mouth disease virus subunit vaccine

Foot-and-mouth disease (FMD) is one of the most feared diseases of livestock worldwide. Vaccination has been a very effective weapon in controlling the disease, however a number of concerns with the current vaccine including the inability of approved diagnostic tests to reliably distinguish vaccinated from infected animals and the need for high containment facilities for vaccine production, have limited its use during outbreaks in countries previously free of the disease. A number of FMD vaccine candidates have been tested and a replication-defective human adenovirus type 5 (Ad5) vector containing the FMDV capsid (P1-2A) and 3C protease coding regions has been shown to completely protect pigs against challenge with the homologous virus (FMDV A12 and A24). An Ad5-P1-2A+3C vaccine for FMDV O1 Campos (Ad5-O1C), however, only induced a low FMDV-specific neutralizing antibody response in swine potency tests. Granulocyte-macrophage colony-stimulating factor (GM-CSF) has been successfully used to stimulate the immune response in vaccine formulations against a number of diseases, including HIV, hepatitis C and B. To attempt to improve the FMDV-specific immune response induced by Ad5-O1C, we inoculated swine with Ad5-O1C and an Ad5 vector containing the gene for porcine GM-CSF (pGM-CSF). However, in the conditions used in this trial, pGM-CSF did not improve the immune response to Ad5-O1C and adversely affected the level of protection of swine challenged with homologous FMDV.

Granulocyte macrophage colony-stimulating factor enhances the modulatory effect of cytokines on monocyte-derived multinucleated giant cell formation and fungicidal activity against Paracoccidioides brasiliensis

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

GM-CSF (granulocyte-macrophage colony-stimulating factor): Modulation der durch UV-B-Strahlung induzierten Hautkarzinogenese

UV-B-Strahlung, die durch die fortschreitende Zerstörung der Ozonschicht zunimmt, ist hauptsächlich für das Entstehen von Basaliomen und Plattenepithelkarzinomen verantwort-lich, an denen jedes Jahr etwa 2-3 Millionen Menschen weltweit erkranken. UV-B indu-zierte Hautkarzinogenese ist ein komplexer Prozess, bei dem vor allem die mutagenen und immunsuppressiven Wirkungen der UV-B-Strahlung von Bedeutung sind. Die Rolle von GM-CSF in der Hautkarzinogenese ist dabei widersprüchlich. Aus diesem Grund wurde die Funktion von GM-CSF in vivo in der UV-B induzierten Hautkarzinogenese mittels zwei bereits etablierter Mauslinien untersucht: Erstens transgene Mäuse, die einen GM-CSF Antagonisten unter der Kontrolle des Keratin-10-Promotors in den suprabasalen Schichten der Epidermis exprimieren und zweitens solche, die unter dem Keratin-5-Promotor murines GM-CSF in der Basalschicht der Epidermis überexprimieren. Eine Gruppe von Tieren wurde chronisch, die andere akut bestrahlt. Die konstitutionelle Verfassung der Tiere mit erhöhter GM-CSF-Aktivität in der Haut war nach chronischer UV-B-Bestrahlung insgesamt sehr schlecht. Sie wiesen deshalb eine stark erhöhte Mortali-tät auf. Dies ist sowohl auf die hohe Inzidenz als auch dem frühen Auftreten der benignen und malignen Läsionen zurückzuführen. Eine verminderte GM-CSF Aktivität verzögerte dagegen die Karzinomentwicklung und erhöhte die Überlebensrate leicht. GM-CSF wirkt auf verschiedenen Ebenen tumorpromovierend: Erstens erhöht eine gesteigerte Mastzell-anzahl in der Haut der GM-CSF überexprimierenden Tiere per se die Suszeptibilität für Hautkarzinogenese. Zweitens stimuliert GM-CSF die Keratinozytenproliferation. Dadurch kommt es nach UV-B-Bestrahlung zu einer prolongierten epidermalen Hyperproliferation, die zur endogenen Tumorpromotion beiträgt, indem sie die Bildung von Neoplasien unter-stützt. Der Antagonist verzögert dagegen den Proliferationsbeginn, die Keratinozyten blei-ben demzufolge länger in der G1-Phase und der durch UV-B verursachte DNA-Schaden kann effizienter repariert werden. Drittens kann GM-CSF die LCs nicht als APCs aktivie-ren und eine Antitumorimmunität induzieren, da UV-B-Strahlung zur Apoptose von LCs bzw. zu deren Migration in Richtung Lymphknoten führt. Zusätzlich entwickeln GM-CSF überexprimierende Tiere in ihrer Haut nach UV-B-Bestrahlung ein Millieu von antago-nistisch wirkenden Zytokinen, wie TNF-a, TGF-b1 und IL-12p40 und GM-CSF, die proinflammatorische Prozesse und somit die Karzinomentwicklung begünstigen. Der Anta-gonist hemmt nach UV-B-Bestrahlung die Ausschüttung sowohl von immunsuppressiven Zytokinen, wie etwa TNF-a, als auch solchen, die die Th2-Entwicklung unterstützen, wie etwa IL-10 und IL-4. Dies wirkt sich negativ auf die Karzinomentwicklung aus.

The human granulocyte-macrophage colony- stimulating factor gene is autonomously regulated in vivo by an inducible tissue-specific enhancer

The granulocyte-macrophage colony-stimulating factor (GM-CSF) gene is part of a cytokine gene cluster and is directly linked to a conserved upstream inducible enhancer. Here we examined the in vitro and in vivo functions of the human GM-CSF enhancer and found that it was required for the correctly regulated expression of the GM-CSF gene. An inducible DNase I-hypersensitive site appeared within the enhancer in cell types such as T cells, myeloid cells, and endothelial cells that express GM-CSF, but not in nonexpressing cells. In a panel of transfected cells the human GM-CSF enhancer was activated in a tissue-specific manner in parallel with the endogenous gene. The in vivo function of the enhancer was examined in a transgenic mouse model that also addressed the issue of whether the GM-CSF locus was correctly regulated in isolation from other segments of the cytokine gene cluster. After correction for copy number the mean level of human GM-CSF expression in splenocytes from 11 lines of transgenic mice containing a 10.5-kb human GM-CSF transgene was indistinguishable from mouse GM-CSF expression (99% ± 56% SD). In contrast, a 9.8-kb transgene lacking just the enhancer had a significantly reduced (P = 0.004) and more variable level of activity (29% ± 89% SD). From these studies we conclude that the GM-CSF enhancer is required for the correct copy number-dependent expression of the human GM-CSF gene and that the GM-CSF gene is regulated independently from DNA elements associated with the closely linked IL-3 gene or other members of the cytokine gene cluster.

Two Distinct Signaling Pathways Downstream of Janus Kinase 2 Play Redundant Roles for Antiapoptotic Activity of Granulocyte-Macrophage Colony-stimulating Factor

Human granulocyte-macrophage colony-stimulating factor (hGM-CSF) induces proliferation and sustains the viability of the mouse interleukin-3-dependent cell line BA/F3 expressing the hGM-CSF receptor. Analysis of the antiapoptosis activity of GM-CSF receptor βc mutants showed that box1 but not the C-terminal region containing tyrosine residues is essential for GM-CSF-dependent antiapoptotic activity. Because βc mutants, which activate Janus kinase 2 but neither signal transducer and activator of transcription 5 nor the MAPK cascade sustain antiapoptosis activity, involvement of Janus kinase 2, excluding the above molecules, in antiapoptosis activity seems likely. GM-CSF activates phosphoinositide-3-OH kinase as well as Akt, and activation of both was suppressed by addition of wortmannin. Interestingly, wortmannin did not affect GM-CSF-dependent antiapoptosis, thus indicating that the phosphoinositide-3-OH kinase pathway is not essential for cell surivival. Analysis using the tyrosine kinase inhibitor genistein and a MAPK/extracellular signal-regulated kinase (ERK) kinase 1 inhibitor, PD98059, indicates that activation of either the genistein-sensitive signaling pathway or the PD98059-sensitive signaling pathway from βc may be sufficient to suppress apoptosis. Wild-type and a βc mutant lacking tyrosine residues can induce expression of c-myc and bcl-xL genes; however, drug sensitivities for activation of these genes differ from those for antiapoptosis activity of GM-CSF, which means that these gene products may be involved yet are inadequate to promote cell survival.

Vaccination with syngeneic, lymphoma-derived immunoglobulin idiotype combined with granulocyte/macrophage colony-stimulating factor primes mice for a protective T-cell response.

The idiotype of the Ig expressed by a B-cell malignancy (Id) can serve as a unique tumor-specific antigen and as a model for cancer vaccine development. In murine models of Id vaccination, formulation of syngeneic Id with carrier proteins or adjuvants induces an anti-idiotypic antibody response. However, inducing a potent cell-mediated response to this weak antigen instead would be highly desirable. In the 38C13 lymphoma model, we observed that low doses of free granulocyte/macrophage colony-stimulating factor (GM-CSF) 10,000 units i.p. or locally s.c. daily for 4 days significantly enhanced protective antitumor immunity induced by s.c. Id-keyhole limpet hemocyanin (KLH) immunization. This effect was critically dependent upon effector CD4+ and CD8+ T cells and was not associated with any increased anti-idiotypic antibody production. Lymphocytes from spleens and draining lymph nodes of mice primed with Id-KLH plus GM-CSF, but not with Id-KLH alone, demonstrated significant proliferation to Id in vitro without any biased production of interferon gamma or interleukin 4 protein or mRNA. As a further demonstration of potency, 50% of mice immunized with Id-KLH plus GM-CSF on the same day as challenge with a large s.c. tumor inoculum remained tumor-free at day 80, compared with 17% for Id-KLH alone, when immunization was combined with cyclophosphamide. Taken together, these results demonstrate that GM-CSF can significantly enhance the immunogenicity of a defined self-antigen and that this effect is mediated exclusively by activating the T-cell arm of the immune response.

Rel-deficient T cells exhibit defects in production of interleukin 3 and granulocyte-macrophage colony-stimulating factor.

The c-rel protooncogene encodes a subunit of the NF-kappa B-like family of transcription factors. Mice lacking Rel are defective in mitogenic activation of B and T lymphocytes and display impaired humoral immunity. In an attempt to identify changes in gene expression that accompany the T-cell stimulation defects associated with the loss of Rel, we have examined the expression of cell surface activation markers and cytokine production in mitogen-stimulated Rel-/- T cells. The expression of cell surface markers including the interleukin 2 receptor alpha (IL-2R alpha) chain (CD25), CD69 and L-selectin (CD62) is normal in mitogen-activated Rel-/- T cells, but cytokine production is impaired. In Rel-/- splenic T cell cultures stimulated with phorbol 12-myristate 13-acetate and ionomycin, the levels of IL-3, IL-5, granulocyte- macrophage colony-stimulating factor (GM-CSF), tumor necrosis factor alpha (TNF-alpha), and gamma interferon (IFN-gamma) were only 2- to 3-fold lower compared with normal T cells. In contrast, anti-CD3 and anti-CD28 stimulated Rel-/- T cells, which fail to proliferate, make little or no detectable cytokines. Exogenous IL-2, which restitutes the proliferative response of the anti-CD3- and anti-CD28-treated Rel-/- T cells, restores production of IL-5, TNF-alpha, and IFN-gamma, but not IL-3 and GM-CSF expression to approximately normal levels. In contrast to mitogen-activated Rel-/- T cells, lipopolysaccharide-stimulated Rel-/- macrophages produce higher than normal levels of GM-CSF. These findings establish that Rel can function as an activator or repressor of gene expression and is required by T lymphocytes for production of IL-3 and GM-CSF.

Apoptosis of hemopoietic cells by the human granulocyte-macrophage colony-stimulating factor mutant E21R.

Human granulocyte-macrophage colony-stimulating factor (GM-CSF) binds to a high-affinity heterodimeric receptor composed of a specific alpha chain and a common beta chain (beta(c)), which is shared with the receptors for interleukins 3 and 5. Hemopoietic cell survival requires GM-CSF binding this high-affinity receptor. We have recently developed the GM-CSF mutant E21R, which selectively binds to the alpha chain and behaves as a competitive GM-CSF antagonist. We have now examined the role of E21R on the survival of hemopoietic cells and found that E21R causes apoptosis (programmed cell death) of normal and malignant cells directly in the absence of GM-CSF. The direct apoptotic effect of E21R occurred in a dose- and time-dependent manner. Apoptosis by E21R was dependent on cells expressing the high-affinity GM-CSF receptor and could be blocked by GM-CSF. Significantly, apoptosis of the cells occurred even in the presence of the survival factors granulocyte CSF and stem cell factor but was prevented by engagement of beta(c) with interleukin 3. The initiation of apoptosis required phosphorylation, transcriptional activity, and protein synthesis. These findings support a model whereby binding of E21R to the alpha chain leads to apoptosis, while beta(c) plays an important role in cell survival. This model may be applicable to other multimeric cytokine receptors and offers a novel approach for the treatment of human leukemia.

Hematopoietic and lung abnormalities in mice with a null mutation of the common beta subunit of the receptors for granulocyte-macrophage colony-stimulating factor and interleukins 3 and 5.

Gene targeting was used to create mice with a null mutation of the gene encoding the common beta subunit (beta C) of the granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin 3 (IL-3; multi-CSF), and interleukin 5 (IL-5) receptor complexes (beta C-/- mice). High-affinity binding of GM-CSF was abolished in beta C-/- bone marrow cells, while cells from heterozygous animals (beta C+/- mice) showed an intermediate number of high-affinity receptors. Binding of IL-3 was unaffected, confirming that the IL-3-specific beta chain remained intact. Eosinophil numbers in peripheral blood and bone marrow of beta C-/- animals were reduced, while other hematological parameters were normal. In clonal cultures of beta C-/- bone marrow cells, even high concentrations of GM-CSF and IL-5 failed to stimulate colony formation, but the cells exhibited normal quantitative responsiveness to stimulation by IL-3 and other growth factors. beta C-/- mice exhibited normal development and survived to young adult life, although they developed pulmonary peribronchovascular lymphoid infiltrates and areas resembling alveolar proteinosis. There was no detectable difference in the systemic clearance and distribution of GM-CSF between beta C-/- and wild-type littermates. The data establish that beta C is normally limiting for high-affinity binding of GM-CSF and demonstrate that systemic clearance of GM-CSF is not mediated via such high-affinity receptor complexes.

Identification of a viability domain in the granulocyte/macrophage colony-stimulating factor receptor beta-chain involving tyrosine-750.

The granulocyte/macrophage colony-stimulating factor (GM-CSF) receptor (GMR) is a heterodimeric receptor expressed by myeloid lineage cells. In this study we have investigated domains of the GMR beta-chain (GMR beta) involved in maintaining cellular viability. Using a series of nested GMR beta deletion mutants, we demonstrate that there are at least two domains of GMR beta that contribute to viability signals. Deletion of amino acid residues 626-763 causes a viability defect that can be rescued with fetal calf serum (FCS). Deletion of residues 518-626, in contrast, causes a further decrement in viability that can be only partially compensated by the addition of FCS. GMR beta truncated proximal to amino acid 517 will not support long-term growth under any conditions. Site-directed mutagenesis of tyrosine-750 (Y750), which is contained within the distal viability domain, to phenylalanine eliminates all demonstrable tyrosine phosphorylation of GMR beta. Cell lines transfected with mutant GMR beta (Y750-->F) have a viability disadvantage when compared to cell lines containing wild-type GMR that is partially rescued by the addition of FCS. We studied signal transduction in mutant cell lines in an effort to identify pathways that might participate in the viability signal. Although tyrosine phosphorylation of JAK2, SHPTP2, and Vav is intact in Y750-->F mutant cell lines, Shc tyrosine phosphorylation is reduced. This suggests a potential role for Y750 and potentially Shc in a GM-CSF-induced signaling pathway that helps maintain cellular viability.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.