944 resultados para multiple-locus variable-number tandem repeat analysis
Resumo:
Global Network for the Molecular Surveillance of Tuberculosis 2010: A. Miranda (Tuberculosis Laboratory of the National Institute of Health, Porto, Portugal)
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
Association studies have revealed expression quantitative trait loci (eQTLs) for a large number of genes. However, the causative variants that regulate gene expression levels are generally unknown. We hypothesized that copy-number variation of sequence repeats contribute to the expression variation of some genes. Our laboratory has previously identified that the rare expansion of a repeat c.-174CGGGGCGGGGCG in the promoter region of the CSTB gene causes a silencing of the gene, resulting in progressive myoclonus epilepsy. Here, we genotyped the repeat length and quantified CSTB expression by quantitative real-time polymerase chain reaction in 173 lymphoblastoid cell lines (LCLs) and fibroblast samples from the GenCord collection. The majority of alleles contain either two or three copies of this repeat. Independent analysis revealed that the c.-174CGGGGCGGGGCG repeat length is strongly associated with CSTB expression (P = 3.14 × 10(-11)) in LCLs only. Examination of both genotyped and imputed single-nucleotide polymorphisms (SNPs) within 2 Mb of CSTB revealed that the dodecamer repeat represents the strongest cis-eQTL for CSTB in LCLs. We conclude that the common two or three copy variation is likely the causative cis-eQTL for CSTB expression variation. More broadly, we propose that polymorphic tandem repeats may represent the causative variation of a fraction of cis-eQTLs in the genome.
Resumo:
Mycoplasma hyopneumoniae est l’agent causal de la pneumonie enzootique. On le retrouve dans plusieurs élevages de porcs à travers le monde. Même si ce micro-organisme est présent dans plusieurs troupeaux canadiens, peu d’informations sont présentement disponibles sur les isolats québécois. Un total de 160 poumons de porcs possédant des lésions de pneumonie ont été récupérés à l’abattoir, mis en culture et testés par PCR pour M. hyopneumoniae et Mycoplasma hyorhinis. D’autres pathogènes bactériens communs du porc et les virus du syndrome reproducteur et respiratoire porcin (VSRRP), de l’influenza et le circovirus porcin de type 2 (CVP2) ont été également testés. Quatre-vingt-dix pourcent des échantillons étaient positifs pour M. hyopneumoniae et 5.6% l’étaient seulement pour M. hyorhinis. Dans ces échantillons positifs pour M. hyopneumoniae, la concentration de ce mycoplasme variait de 1.17 x 105 à 3.37 x 109 génomes/mL. Vingt-cinq poumons positifs en culture ou par PCR en temps réel pour M. hyopneumoniae ont été sélectionnés, parmi ceux-ci 10 étaient en coinfection avec Pasteurella multocida, 12 avec Streptococcus suis, 9 avec CVP2 et 2 avec le VSRRP. Les analyses des nombres variables de répétitions en tandem à de multiples loci (MLVA) et PCR-polymorphisme de longueur de fragments de restriction (PCR-RFLP) de M. hyopneumoniae ont démontré une forte diversité des isolats de terrain. Par contre, il semble y avoir plus d’homogénéité à l’intérieur d’un même élevage. L’analyse MLVA a également démontré que près de la moitié des isolats possédaient moins de 55% d’homologie avec les souches vaccinales et de référence utilisées dans la présente étude. L’absence d’amplification du locus 1 de M. hyopneumoniae en MLVA a été significativement associée à une baisse de la concentration de bactérie et de la sévérité des lésions. Pour tous les isolats de M. hyopneumoniae, des concentrations minimales inhibitrices (CMI) de faibles à intermédiaires ont été obtenues envers tous les antimicrobiens testés. Les isolats possédant des CMI intermédiaires envers les tétracyclines, les macrolides et les lincosamides ont été testés pour la présence des gènes de résistance tetM, ermB et pour des mutations ponctuelles dans les gènes des protéines L4, L22 et de l’ARNr 23S. Aucun de ces gènes n’a été détecté mais la mutation ponctuelle G2057A a été identifiée. Cette mutation est responsable de la résistance intrinsèque de M. hyopneumoniae face aux macrolides à 14 carbones. Ces résultats indiquent qu’il ne semble pas y avoir de résistance acquise aux antimicrobiens parmi ces isolats. En conclusion, cette recherche a permis d’obtenir de nouvelles données scientifiques sur les isolats québécois de M. hyopneumoniae.
Resumo:
Background: Multi-drug resistance and severe/ complicated cases are the emerging phenotypes of vivax malaria, which may deteriorate current anti-malarial control measures. The emergence of these phenotypes could be associated with either of the two Plasmodium vivax lineages. The two lineages had been categorized as Old World and New World, based on geographical sub-division and genetic and phenotypical markers. This study revisited the lineage hypothesis of P. vivax by typing the distribution of lineages among global isolates and evaluated their genetic relatedness using a panel of new mini-satellite markers. Methods: 18S SSU rRNA S-type gene was amplified from 420 Plasmodium vivax field isolates collected from different geographical regions of India, Thailand and Colombia as well as four strains each of P. vivax originating from Nicaragua, Panama, Thailand (Pak Chang), and Vietnam (ONG). A mini-satellite marker panel was then developed to understand the population genetic parameters and tested on a sample subset of both lineages. Results: 18S SSU rRNA S-type gene typing revealed the distribution of both lineages (Old World and New World) in all geographical regions. However, distribution of Plasmodium vivax lineages was highly variable in every geographical region. The lack of geographical sub-division between lineages suggests that both lineages are globally distributed. Ten mini-satellites were scanned from the P. vivax genome sequence; these tandem repeats were located in eight of the chromosomes. Mini-satellites revealed substantial allelic diversity (7-21, AE = 14.6 +/- 2.0) and heterozygosity (He = 0.697-0.924, AE = 0.857 +/- 0.033) per locus. Mini-satellite comparison between the two lineages revealed high but similar pattern of genetic diversity, allele frequency, and high degree of allele sharing. A Neighbour-Joining phylogenetic tree derived from genetic distance data obtained from ten mini-satellites also placed both lineages together in every cluster. Conclusions: The global lineage distribution, lack of genetic distance, similar pattern of genetic diversity, and allele sharing strongly suggested that both lineages are a single species and thus new emerging phenotypes associated with vivax malaria could not be clearly classified as belonging to a particular lineage on basis of their geographical origin.
Resumo:
A class of tandemly repeated DNA sequences (TR-1) of 350-bp unit length was isolated from the knob DNA of chromosome 9 of Zea mays L. Comparative fluorescence in situ hybridization revealed that TR-1 elements are also present in cytologically detectable knobs on other maize chromosomes in different proportions relative to the previously described 180-bp repeats. At least one knob on chromosome 4 is composed predominantly of the TR-1 repeat. In addition, several small clusters of the TR-1 and 180-bp repeats have been found in different chromosomes, some not located in obvious knob heterochromatin. Variation in restriction fragment fingerprints and copy number of the TR-1 elements was found among maize lines and among maize chromosomes. TR-1 tandem arrays up to 70 kilobases in length can be interspersed with stretches of 180-bp tandem repeat arrays. DNA sequence analysis and restriction mapping of one particular stretch of tandemly arranged TR-1 units indicate that these elements may be organized in the form of fold-back DNA segments. The TR-1 repeat shares two short segments of homology with the 180-bp repeat. The longest of these segments (31 bp; 64% identity) corresponds to the conserved region among 180-bp repeats. The polymorphism and complex structure of knob DNA suggest that, similar to the fold-back DNA-containing giant transposons in Drosophila, maize knob DNA may have some properties of transposable elements.
Resumo:
The purpose of this research was to demonstrate the applicability of reduced-size STR (Miniplex) primer sets to challenging samples and to provide the forensic community with new information regarding the analysis of degraded and inhibited DNA. The Miniplex primer sets were validated in accordance with guidelines set forth by the Scientific Working Group on DNA Analysis Methods (SWGDAM) in order to demonstrate the scientific validity of the kits. The Miniplex sets were also used in the analysis of DNA extracted from human skeletal remains and telogen hair. In addition, a method for evaluating the mechanism of PCR inhibition was developed using qPCR. The Miniplexes were demonstrated to be a robust and sensitive tool for the analysis of DNA with as low as 100 pg of template DNA. They also proved to be better than commercial kits in the analysis of DNA from human skeletal remains, with 64% of samples tested producing full profiles, compared to 16% for a commercial kit. The Miniplexes also produced amplification of nuclear DNA from human telogen hairs, with partial profiles obtained from as low as 60 pg of template DNA. These data suggest smaller PCR amplicons may provide a useful alternative to mitochondrial DNA for forensic analysis of degraded DNA from human skeletal remains, telogen hairs, and other challenging samples. In the evaluation of inhibition by qPCR, the effect of amplicon length and primer melting temperature was evaluated in order to determine the binding mechanisms of different PCR inhibitors. Several mechanisms were indicated by the inhibitors tested, including binding of the polymerase, binding to the DNA, and effects on the processivity of the polymerase during primer extension. The data obtained from qPCR illustrated a method by which the type of inhibitor could be inferred in forensic samples, and some methods of reducing inhibition for specific inhibitors were demonstrated. An understanding of the mechanism of the inhibitors found in forensic samples will allow analysts to select the proper methods for inhibition removal or the type of analysis that can be performed, and will increase the information that can be obtained from inhibited samples.
Resumo:
Brucellosis is endemic in most parts of Egypt, where it is caused mainly by Brucella melitensis biovar 3, and affects cattle and small ruminants in spite of ongoing efforts devoted to its control. Knowledge of the predominant Brucella species/strains circulating in a region is a prerequisite of a brucellosis control strategy. For this reason a study aiming at the evaluation of the phenotypic and genetic heterogeneity of a panel of 17 Brucella spp. isolates recovered from domestic ruminants (cattle, buffalo, sheep, and goat) from four governorates during a period of five years (2002-2007) was carried out using microbiological tests and molecular biology techniques (PCR, MLVA-15, and sequencing). Thirteen strains were identified as B. melitensis biovar 3 while all phenotypic and genetic techniques classified the remaining isolates as B. abortus (n = 2) and B. suis biovar 1 (n = 2). MLVA-15 yielded a high discriminatory power (h = 0.801), indicating a high genetic diversity among the B. melitensis strains circulating among domestic ruminants in Egypt. This is the first report of the isolation of B. suis from cattle in Egypt which, coupled with the finding of B. abortus, suggests a potential role of livestock as reservoirs of several zoonotic Brucella species in the region.
Resumo:
Concurrent deletion at 1p/19q is a common signature of oligodendrogliomas, and it may, be identified in low-grade tumours (grade II) suggesting it represents an early event in the development of these brain neoplasms. Additional non-random changes primarily involve CDKN2A, PTEN and EGFR. Identification of all of these genetic changes has become an additional parameter in the evaluation of the clinical patients` prognosis, including good response to conventional chemotherapy. Multiple ligation-dependent probe amplification (MLPA) analysis is a new methodology that allows an easy identification of the oligodendrogliomas` abnormalities in a single step. No need of the respective constitutional DNA from each patient is another advantage of this method. We used MLPA kits P088 and P105 to determine the molecular characteristics of a series of 40 oligodendrogliomas. Deletions at I p and 19q were identified in 45% and 65% of cases, respectively. Alterations of EGFR, CDKN2A, ERBB2, PTEN and TP53 were also identified in variable frequencies among 7% to 35% of tumours. These findings demonstrate that MLPA is a reliable technique to the detection of molecular genetic changes in oligodendrogliomas.
Resumo:
Leptospirosis is an emerging infectious disease that has been identified as both a human and animal health problem worldwide. Regular outbreaks associated with specific risk factors have been reported in Argentina. However, there are no available data concerning the genetic population level for this pathogen. Therefore, the aim of this work was to describe the genetic diversity of Leptospira interrogans through the application of two molecular typing strategies: variable number of tandem repeats (VNTR) and multilocus sequence typing (MLST). For this purpose, seven reference strains and 18 non-epidemiologically related isolates from diverse hosts and Argentinean regions were analysed. Among them, nine genotypes and seven sequence types (STs), including three unreported STs, were described using VNTR and MLST, respectively. eBURST analysis demonstrated that ST37 was the most frequent and founder genotype of a clonal complex (CCs) containing STN1 and STN3, suggesting the importance of studying the serovars belonging to this CC in Argentina. The data from maximum parsimony analysis, which combined both techniques, achieved intra-serovar discrimination, surmounted microscopic agglutination test discrepancies and increased the discriminatory power of each technique applied separately. This study is the first to combine both strategies for L. interrogans typing to generate a more comprehensive molecular genotyping of isolates from Argentina in a global context.
Resumo:
Systems that can distinguish epidemiologically-related Mycobacterium tuberculosis strains from unrelated ones are extremely valuable. Molecular biology techniques have allowed a great deal of information to be acquired about the infectious disease tuberculosis (TB) that was very hard or impossible to obtain by conventional epidemiology. A typing method based on bacterial DNA genome differences, known as RFLP (restriction fragment length polymorphism), is widely used to discriminate strains in the epidemiologic study of TB. However, RFLP is laborious and there is a tendency to replace it by other methods. Thus, other DNA sequences have been employed as epidemiological markers, as in Spoligotyping, a fast technique based on PCR followed by differential hybridization of amplified products. The polymorphism observed among different isolates is probably the product of strain-dependent recombination. MIRU (mycobacterial interspersed repetitive unit) typing is a reproducible and fast assay, involving the generation of genotypes based on the study of 12 loci containing VNTRs (variable-number tandem repeats) in strains of the M. tuberculosis complex. It compares strains from different geographic areas and allows the movement of individual lineages to be tracked, as in RFLP. This approach enables a greater number of isolates to be analyzed, leading to the identification of a larger number of foci of transmission within the population and thus to improved ways of slowing the progress of the disease.
Resumo:
The identification of Leptospira clinical isolates through genotyping and serotyping, besides the recognition of its reservoirs, are important tools for understanding the epidemiology of leptospirosis, and they are also keys for identifying new species and serovars. Fourteen clinical isolates from animals were characterized by means of single enzyme amplified length polymorphism, variable number of tandem repeat analysis, pulsed field gel electrophoresis, and serotyping. All isolates were identified as Leptospira interrogans, serovar Canicola. Infections by this serovar occur in urban regions, where dogs represent the main maintenance hosts, whereas bovine and swine may act as reservoirs of serovar Canicola in rural areas. Both urban and rural aspects of leptospirosis, and the role of domestic animals as maintenance hosts, cannot be neglected in developing and developed countries.
Resumo:
The worldwide threat of tuberculosis to human health emphasizes the need to develop novel approaches to a global epidemiological surveillance. The current standard for Mycobacterium tuberculosis typing based on IS6110 restriction fragment length polymorphism (RFLP) suffers from the difficulty of comparing data between independent laboratories. Here, we propose a high-resolution typing method based on variable number tandem repeats (VNTRs) of genetic elements named mycobacterial interspersed repetitive units (MIRUs) in 12 human minisatellite-like regions of the M. tuberculosis genome. MIRU-VNTR profiles of 72 different M. tuberculosis isolates were established by PCR analysis of all 12 loci. From 2 to 8 MIRU-VNTR alleles were identified in the 12 regions in these strains, which corresponds to a potential of over 16 million different combinations, yielding a resolution power close to that of IS6110-RFLP. All epidemiologically related isolates tested were perfectly clustered by MIRU-VNTR typing, indicating that the stability of these MIRU-VNTRs is adequate to track outbreak episodes. The correlation between genetic relationships inferred from MIRU-VNTR and IS6110-RFLP typing was highly significant. Compared with IS6110-RFLP, high-resolution MIRU-VNTR typing has the considerable advantages of being fast, appropriate for all M. tuberculosis isolates, including strains that have a few IS6110 copies, and permitting easy and rapid comparison of results from independent laboratories. This typing method opens the way to the construction of digital global databases for molecular epidemiology studies of M. tuberculosis.
Resumo:
Group B streptococci (GBS) are the most common cause of neonatal sepsis, pneumonia, and meningitis. The alpha C protein is a surface-associated antigen; the gene (bca) for this protein contains a series of tandem repeats (each encoding 82 aa) that are identical at the nucleotide level and express a protective epitope. We previously reported that GBS isolates from two of 14 human maternal and neonatal pairs differed in the number of repeats contained in their alpha C protein; in both pairs, the alpha C protein of the neonatal isolate was smaller in molecular size. We now demonstrate by PCR that the neonatal isolates contain fewer tandem repeats. Maternal isolates were susceptible to opsonophagocytic killing in the presence of alpha C protein-specific antiserum, whereas the discrepant neonatal isolates proliferated. An animal model was developed to further study this phenomenon. Adult mice passively immunized with antiserum to the alpha C protein were challenged with an alpha C protein-expressing strain of GBS. Splenic isolates of GBS from these mice showed a high frequency of mutation in bca--most commonly a decrease in repeat number. Isolates from non-immune mice were not altered. Spontaneous deletions in the repeat region were observed at a much lower frequency (6 x 10(-4)); thus, deletions in that region are selected for under specific antibody pressure and appear to lower the organism's susceptibility to killing by antibody specific to the alpha C protein. This mechanism of antigenic variation may provide a means whereby GBS evade host immunity.
Resumo:
The paper presents a spreadsheet-based multiple account framework for cost-benefit analysis which incorporates all the usual concerns of cost-benefit analysts such as shadow-pricing to account for market failure. distribution of net benefits. sensitivity and risk analysis, cost of public funds, and environmental effects. The approach is generalizable to a wide range of projects and situations and offers a number of advantages to both analysts and decision-makers, including transparency, a check on internal consistency, and a detailed summary of project net benefits disaggregated by stakeholder group. Of particular importance is the ease with which this framework allows for a project to be evaluated from alternative decision-making perspectives and under alternative policy scenarios where the trade-offs among the project's stakeholders can readily be identified and quantified. (C) 2004 Elsevier Ltd. All rights reserved.