Rel-deficient T cells exhibit defects in production of interleukin 3 and granulocyte-macrophage colony-stimulating factor.

The c-rel protooncogene encodes a subunit of the NF-kappa B-like family of transcription factors. Mice lacking Rel are defective in mitogenic activation of B and T lymphocytes and display impaired humoral immunity. In an attempt to identify changes in gene expression that accompany the T-cell stimulation defects associated with the loss of Rel, we have examined the expression of cell surface activation markers and cytokine production in mitogen-stimulated Rel-/- T cells. The expression of cell surface markers including the interleukin 2 receptor alpha (IL-2R alpha) chain (CD25), CD69 and L-selectin (CD62) is normal in mitogen-activated Rel-/- T cells, but cytokine production is impaired. In Rel-/- splenic T cell cultures stimulated with phorbol 12-myristate 13-acetate and ionomycin, the levels of IL-3, IL-5, granulocyte- macrophage colony-stimulating factor (GM-CSF), tumor necrosis factor alpha (TNF-alpha), and gamma interferon (IFN-gamma) were only 2- to 3-fold lower compared with normal T cells. In contrast, anti-CD3 and anti-CD28 stimulated Rel-/- T cells, which fail to proliferate, make little or no detectable cytokines. Exogenous IL-2, which restitutes the proliferative response of the anti-CD3- and anti-CD28-treated Rel-/- T cells, restores production of IL-5, TNF-alpha, and IFN-gamma, but not IL-3 and GM-CSF expression to approximately normal levels. In contrast to mitogen-activated Rel-/- T cells, lipopolysaccharide-stimulated Rel-/- macrophages produce higher than normal levels of GM-CSF. These findings establish that Rel can function as an activator or repressor of gene expression and is required by T lymphocytes for production of IL-3 and GM-CSF.

Apoptosis of hemopoietic cells by the human granulocyte-macrophage colony-stimulating factor mutant E21R.

Human granulocyte-macrophage colony-stimulating factor (GM-CSF) binds to a high-affinity heterodimeric receptor composed of a specific alpha chain and a common beta chain (beta(c)), which is shared with the receptors for interleukins 3 and 5. Hemopoietic cell survival requires GM-CSF binding this high-affinity receptor. We have recently developed the GM-CSF mutant E21R, which selectively binds to the alpha chain and behaves as a competitive GM-CSF antagonist. We have now examined the role of E21R on the survival of hemopoietic cells and found that E21R causes apoptosis (programmed cell death) of normal and malignant cells directly in the absence of GM-CSF. The direct apoptotic effect of E21R occurred in a dose- and time-dependent manner. Apoptosis by E21R was dependent on cells expressing the high-affinity GM-CSF receptor and could be blocked by GM-CSF. Significantly, apoptosis of the cells occurred even in the presence of the survival factors granulocyte CSF and stem cell factor but was prevented by engagement of beta(c) with interleukin 3. The initiation of apoptosis required phosphorylation, transcriptional activity, and protein synthesis. These findings support a model whereby binding of E21R to the alpha chain leads to apoptosis, while beta(c) plays an important role in cell survival. This model may be applicable to other multimeric cytokine receptors and offers a novel approach for the treatment of human leukemia.

Constitutive production of granulocyte/macrophage colony-stimulating factor by hypodense mononuclear eosinophils developed in vitro from hybrid eosinophil/basophil granulocytes.

We recently described the development in vitro of cells with granules characteristic of eosinophils and basophils (hybrid granulocytes) from normal human cord blood mononuclear cells cultured for 14 days with recombinant human (rh) interleukin (IL)-3, rhIL-5, and a soluble basement membrane, Matrigel. Hybrid granulocytes constitutively produced granulocyte/macrophage colony-stimulating factor (GM-CSF) and rapidly developed into eosinophils after the exogenous cytokines and Matrigel were removed. To characterize the developmental progression of hybrid granulocytes, cells were maintained for an additional 14 days in medium containing rhIL-3, rhIL-5, and Matrigel. After 28 days, 73% +/- 1% (mean +/- SEM; n = 6) of the nonadherent cells were mononuclear eosinophils, 13% +/- 3% were eosinophils with two or more nuclear lobes, 13% +/- 4% were hybrid granulocytes, and 0.2% +/- 0.1% were basophils. More than 90% of the mononuclear eosinophils were hypodense as determined by centrifugation through metrizamide gradients. After an additional 5 days of culture in medium without exogenous cytokines, 65% +/- 3% (n = 5) of the 28-day cells excluded trypan blue. In contrast, 2% +/- 1% of freshly isolated peripheral blood eosinophils survived 5 days of culture without exogenous cytokines (n = 5). Fifty percent conditioned medium from in vitro derived 28-day mononuclear eosinophils and 14-day hybrid granulocytes maintained the survival of 60% +/- 7% and 77% +/- 7%, respectively, of freshly isolated peripheral blood eosinophils for 72 h, compared with 20% +/- 8% survival in medium alone (n = 3). The eosinophil viability-sustaining activity of 50% mononuclear eosinophil-conditioned medium was neutralized with a GM-CSF antibody. A total of 88% of the 28-day cells exhibited immunochemical staining for GM-CSF. Thus, during eosinophilopoiesis, both hybrid eosinophil/basophil intermediates and immature mononuclear eosinophils exhibit autocrine regulation of viability due to constitutive production of GM-CSF.

Hematopoietic and lung abnormalities in mice with a null mutation of the common beta subunit of the receptors for granulocyte-macrophage colony-stimulating factor and interleukins 3 and 5.

Gene targeting was used to create mice with a null mutation of the gene encoding the common beta subunit (beta C) of the granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin 3 (IL-3; multi-CSF), and interleukin 5 (IL-5) receptor complexes (beta C-/- mice). High-affinity binding of GM-CSF was abolished in beta C-/- bone marrow cells, while cells from heterozygous animals (beta C+/- mice) showed an intermediate number of high-affinity receptors. Binding of IL-3 was unaffected, confirming that the IL-3-specific beta chain remained intact. Eosinophil numbers in peripheral blood and bone marrow of beta C-/- animals were reduced, while other hematological parameters were normal. In clonal cultures of beta C-/- bone marrow cells, even high concentrations of GM-CSF and IL-5 failed to stimulate colony formation, but the cells exhibited normal quantitative responsiveness to stimulation by IL-3 and other growth factors. beta C-/- mice exhibited normal development and survived to young adult life, although they developed pulmonary peribronchovascular lymphoid infiltrates and areas resembling alveolar proteinosis. There was no detectable difference in the systemic clearance and distribution of GM-CSF between beta C-/- and wild-type littermates. The data establish that beta C is normally limiting for high-affinity binding of GM-CSF and demonstrate that systemic clearance of GM-CSF is not mediated via such high-affinity receptor complexes.

Identification of a viability domain in the granulocyte/macrophage colony-stimulating factor receptor beta-chain involving tyrosine-750.

The granulocyte/macrophage colony-stimulating factor (GM-CSF) receptor (GMR) is a heterodimeric receptor expressed by myeloid lineage cells. In this study we have investigated domains of the GMR beta-chain (GMR beta) involved in maintaining cellular viability. Using a series of nested GMR beta deletion mutants, we demonstrate that there are at least two domains of GMR beta that contribute to viability signals. Deletion of amino acid residues 626-763 causes a viability defect that can be rescued with fetal calf serum (FCS). Deletion of residues 518-626, in contrast, causes a further decrement in viability that can be only partially compensated by the addition of FCS. GMR beta truncated proximal to amino acid 517 will not support long-term growth under any conditions. Site-directed mutagenesis of tyrosine-750 (Y750), which is contained within the distal viability domain, to phenylalanine eliminates all demonstrable tyrosine phosphorylation of GMR beta. Cell lines transfected with mutant GMR beta (Y750-->F) have a viability disadvantage when compared to cell lines containing wild-type GMR that is partially rescued by the addition of FCS. We studied signal transduction in mutant cell lines in an effort to identify pathways that might participate in the viability signal. Although tyrosine phosphorylation of JAK2, SHPTP2, and Vav is intact in Y750-->F mutant cell lines, Shc tyrosine phosphorylation is reduced. This suggests a potential role for Y750 and potentially Shc in a GM-CSF-induced signaling pathway that helps maintain cellular viability.

Decreased atherosclerosis in mice deficient in both macrophage colony-stimulating factor (op) and apolipoprotein E.

To develop a murine model system to test the role of monocyte-derived macrophage in atherosclerosis, the osteopetrotic (op) mutation in the macrophage colony-stimulating factor gene was bred onto the apolipoprotein E (apoE)-deficient background. The doubly mutant (op/apoE-deficient) mice fed a low-fat chow diet had significantly smaller proximal aortic lesions at an earlier stage of progression than their apoE-deficient control littermates. These lesions in the doubly mutant mice were composed of macrophage foam cells. The op/apoE-deficient mice also had decreased body weights, decreased blood monocyte differentials, and increased mean cholesterol levels of approximately 1300 mg/dl. Statistical analysis determined that atherosclerosis lesion area was significantly affected by the op genotype and gender. The confounding variables of body weight, plasma cholesterol, and monocyte differential, which were all affected by op genotype, had no significant additional effect on lesion area once they were adjusted for the effects of op genotype and gender. Unexpectedly, there was a significant inverse correlation between plasma cholesterol and lesion area, implying that each may be the result of a common effect of macrophage colony-stimulating factor levels. The data support the hypothesis that macrophage colony-stimulating factor and its effects on macrophage development and function play a key role in atherogenesis.

Stimulation of human monocytes with macrophage colony-stimulating factor induces a Grb2-mediated association of the focal adhesion kinase pp125FAK and dynamin.

Macrophage colony-stimulating factor (M-CSF) is required for the growth and differentiation of mononuclear phagocytes. In the present studies using human monocytes, we show that M-CSF induces interaction of the Grb2 adaptor protein with the focal adhesion kinase pp125FAK. The results demonstrate that tyrosine-phosphorylated pp125FAK directly interacts with the SH2 domain of Grb2. The findings indicate that a pYENV site at Tyr-925 in pp125FAK is responsible for this interaction. We also demonstrate that the Grb2-FAK complex associates with the GTPase dynamin. Dynamin interacts with the SH3 domains of Grb2 and exhibits M-CSF-dependent tyrosine phosphorylation in association with pp125FAK. These findings suggest that M-CSF-induced signaling involves independent Grb2-mediated pathways, one leading to Ras activation and another involving pp125FAK and a GTPase implicated in receptor internalization.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

A macrophage colony-stimulating factor receptor-green fluorescent protein transgene is expressed throughout the mononuclear phagocyte system of the mouse

The c-fms gene encodes the receptor for macrophage colony-stimulating factor (CSF-1). The gene is expressed selectively in the macrophage and trophoblast cell lineages. Previous studies have indicated that sequences in intron 2 control transcript elongation in tissue-specific and regulated expression of c-fms. In humans, an alternative promoter was implicated in expression of the gene in trophoblasts. We show that in mice, c-fms transcripts in trophoblasts initiate from multiple points within the 2-kilobase (kb) region flanking the first coding exon. A reporter gene construct containing 3.5 kb of 5' flanking sequence and the down-stream intron 2 directed expression of enhanced green fluorescent protein (EGFP) to both trophoblasts and macrophages. EGFP was detected in trophoblasts from the earliest stage of implantation examined at embryonic day 7.5. During embryonic development, EGFP highlighted the large numbers of c-fms-positive macrophages, including those that originate from the yolk sac. In adult mice, EGFP location Was consistent with known F4/80-positive macrophage populations, including Langerhans cells of the skin, and permitted convenient sorting of isolated tissue macrophages from disaggregated tissue. Expression of EGFP in transgenic mice was dependent on intron 2 as no lines with detectable EGFP expression were obtained where either all of intron 2 or a conserved enhancer element FIRE (the Fms intronic regulatory element) was removed. We have therefore defined the elements required to generate myeloid- and trophoblast-specific transgenes as well as a model system for the study of mononuclear phagocyte development and function. (C) 2003 by The American Society of Hematology.

Lysosomal Disorders Drive Susceptibility to Tuberculosis by Compromising Macrophage Migration.

A zebrafish genetic screen for determinants of susceptibility to Mycobacterium marinum identified a hypersusceptible mutant deficient in lysosomal cysteine cathepsins that manifests hallmarks of human lysosomal storage diseases. Under homeostatic conditions, mutant macrophages accumulate undigested lysosomal material, which disrupts endocytic recycling and impairs their migration to, and thus engulfment of, dying cells. This causes a buildup of unengulfed cell debris. During mycobacterial infection, macrophages with lysosomal storage cannot migrate toward infected macrophages undergoing apoptosis in the tuberculous granuloma. The unengulfed apoptotic macrophages undergo secondary necrosis, causing granuloma breakdown and increased mycobacterial growth. Macrophage lysosomal storage similarly impairs migration to newly infecting mycobacteria. This phenotype is recapitulated in human smokers, who are at increased risk for tuberculosis. A majority of their alveolar macrophages exhibit lysosomal accumulations of tobacco smoke particulates and do not migrate to Mycobacterium tuberculosis. The incapacitation of highly microbicidal first-responding macrophages may contribute to smokers' susceptibility to tuberculosis.

Secretome and degradome profiling shows that Kallikrein-related peptidases 4, 5, 6, and 7 induce TGFβ-1 signaling in ovarian cancer cells

Kallikrein-related peptidases, in particular KLK4, 5, 6 and 7 (4-7), often have elevated expression levels in ovarian cancer. In OV-MZ-6 ovarian cancer cells, combined expression of KLK4-7 reduces cell adhesion and increases cell invasion and resistance to paclitaxel. The present work investigates how KLK4-7 shape the secreted proteome ("secretome") and proteolytic profile ("degradome") of ovarian cancer cells. The secretome comparison consistently identified >900 proteins in three replicate analyses. Expression of KLK4-7 predominantly affected the abundance of proteins involved in cell-cell communication. Among others, this includes increased levels of transforming growth factor β-1 (TGFβ-1). KLK4-7 co-transfected OV-MZ-6 cells share prominent features of elevated TGFβ-1 signaling, including increased abundance of neural cell adhesion molecule L1 (L1CAM). Augmented levels of TGFβ-1 and L1CAM upon expression of KLK4-7 were corroborated in vivo by an ovarian cancer xenograft model. The degradomic analysis showed that KLK4-7 expression mostly affected cleavage sites C-terminal to arginine, corresponding to the preference of kallikreins 4, 5 and 6. Putative kallikrein substrates include chemokines, such as growth differentiation factor 15 (GDF 15) and macrophage migration inhibitory factor (MIF). Proteolytic maturation of TGFβ-1 was also elevated. KLK4-7 have a pronounced, yet non-degrading impact on the secreted proteome, with a strong association between these proteases and TGFβ-1 signaling in tumor biology. © 2013 Federation of European Biochemical Societies.

Impact de l’expression de l’isoforme p35 de la chaîne invariante humaine chez des souris déficientes en CD74 endogène

La chaîne invariante (Ii ; CD74) est une protéine membranaire de type II qui joue un rôle majeur dans la présentation antigénique. Dans le réticulum endoplasmique (RE), Ii favorise l’assemblage du CMH II et prévient la liaison indésirable de polypeptides. Grâce à son motif di-leucine, la chaîne invariante cible le CMH II dans les endosomes. Une fois dans ces compartiments acides, Ii est dégradé, permettant la liaison de peptides de forte affinité qui seront ensuite présentés aux cellules T CD4+. Chez les souris déficientes en Ii murin (mIi), le CMH II présente une conformation non compacte typique des molécules vides ou liées faiblement à un peptide. Le transport du CMH II est aberrant ce qui conduit à une réduction de son expression en surface ainsi qu’à un défaut de présentation antigénique. De plus, Ii diversifie le répertoire de peptides et assure la sélection thymique des cellules T CD4+. Enfin, il a un rôle dans la maturation des cellules B et les souris déficientes en Ii présentent des nombres réduits de cellules B matures folliculaires (FO). L’isoforme mineure humaine p35 (Iip35) n’existe pas chez la souris et possède une extension cytoplasmique de 16 acides aminés contenant un motif R-x-R de rétention dans le RE. La sortie du RE est conditionnelle à la liaison du CMH II qui permet de masquer le motif de rétention. Iip35 agit comme dominant et impose la rétention aux autres isoformes d’Ii. Cependant, le rôle physiologique du motif R-x-R et, plus globalement, celui d’Iip35, demeurent nébuleux. Pour mieux cerner la fonction d’Iip35, nous avons généré des souris transgéniques (Tg) exprimant l’isoforme humaine Iip35 et avons analysé la conformation et le trafic du CMH II, la sélection thymique et la maturation des cellules B ainsi que la présentation antigénique. Nos résultats ont démontré qu’Iip35 favorise l’assemblage du CMH II dans le RE. Il induit également une conformation compacte du CMH II et augmente l’expression du CMH II en surface. De plus, Iip35 cible le CMH II dans les endosomes où un peptide de forte affinité se lie dans la niche peptidique. Par ailleurs, Iip35 diversifie le répertoire de peptides et rétablit totalement la sélection des cellules T CD4+ ainsi que le niveau d’expression du TCR de ces dernières. Iip35 restaure également la présentation antigénique de l’ovalbumine dont la présentation requiert l’expression d’Ii. Par contre, Iip35 rétablit la présentation des superantigènes mais à un niveau moindre que celui des souris sauvages. Ensuite, Iip35 permet le rétablissement de la sélection des cellules iNKT démontrant qu’il assiste la présentation des lipides par les molécules CD1d. Enfin, les résultats ont démontré qu’Iip35 restaure le développement des cellules B matures folliculaires (FO) mais pas celui des cellules B de la zone marginale. Ceci suggère qu’Iip35 est capable d’induire le développement des cellules FO sans stimulation préalable par le MIF (macrophage migration inhibitory factor). Ainsi, l’ensemble de ces résultats démontre qu’Iip35 est fonctionnel et assure la majorité des fonctions d’Ii. Cependant, Iip35 ne remplace pas mIi endogène concernant la maturation des cellules B MZ suggérant qu’il pourrait avoir un rôle de régulateur.