996 resultados para interleukin 5


Relevância:

60.00% 60.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Background: Between 1961-1971 vitamin D deficiency was recognized as a public health issue in the UK, because of the lack of effective sunlight and the population mix [1, 2]. In recent years, health care professionals have cited evidence suggesting a re-emergence of the vitamin D deficiency linked to a number of health consequences as a concern [3-6]. Evidence from observational studies has linked low vitamin D status with impairment in glucose homeostasis and immune dysfunction [7-9]. However, interventional studies, particularly those focused on paediatric populations, have been limited and inconsistent. There is a need for detailed studies, to clarify the therapeutic benefits of vitamin D in these important clinical areas. Objective: The aims of this PhD thesis were two-fold. Firstly, to perform preliminary work assessing the association between vitamin D deficiency and bone status, glucose homeostasis and immune function, and to explore any changes in these parameters following short term vitamin D3 replacement therapy. Secondly, to assess the effectiveness of an electronic surveillance system (ScotPSU) as a tool to determine the current incidence of hospital-based presentation of childhood vitamin D deficiency in Scotland. Methods: Active surveillance was performed for a period of two years as a part of an electronic web-based surveillance programme performed by the Scottish Paediatric Surveillance Unit (ScotPSU). The validity of the system was assessed by identifying cases with profound vitamin D deficiency (in Glasgow and Edinburgh) from the regional laboratory. All clinical details were checked against those identified using the surveillance system. Thirty-seven children aged 3 months to 10 years, who had been diagnosed with vitamin D deficiency, were recruited for the bone, glucose and immunity studies over a period of 24 months. Twenty-five samples were analysed for the glucose and bone studies; of these, 18 samples were further analysed for immune study. Treatment consisted of six weeks taking 5000 IU units cholecalciferol orally once a day. At baseline and after completion of treatment, 25 hydroxyvitamin D (25(OH)D), parathyroid hormone (PTH), alkaline phosphatase (ALP), collagen type 1 cross-linked C-telopeptide (CTX), osteocalcin (OCN), calcium, phosphate, insulin, glucose, homeostasis model assessment index, estimated insulin resistance (HOMA IR), glycated hemoglobin (HbA1c), sex hormone binding globulin (SHBG), lipids profiles, T helper 1 (Th1) cytokines (interleukin-2 ( IL-2), tumor necrosis factors-alpha (TNF-α), interferon-gamma (INF-γ)), T helper 2 (Th2) cytokines (interleukin-4 (IL-4), interleukin-5 (IL-5), interleukin-6 (IL-6)), T helper 17 (Th17) cytokine (interleukin-17 (IL-17)), Regulatory T (Treg) cytokine (interleukin-10 (IL-10)) and chemokines/cytokines, linked with Th1/Th2 subset balance and/or differentiation (interleukin-8 (IL-8), interleukin-12 (IL-12), eosinophil chemotactic protein ( EOTAXIN), macrophage inflammatory proteins-1beta (MIP-1β), interferon-gamma-induced protein-10 (IP-10), regulated on activation, normal T cell expressed and secreted (RANTES), monocyte chemoattractant protein-1(MCP-1)) were measured. Leukoocyte subset analysis was performed for T cells, B cells and T regulatory cells and a luminex assay was used to measure the cytokiens. Results: Between September 2009 and August 2011, 163 cases of vitamin D deficiency were brought to the attention of the ScotPSU, and the majority of cases (n = 82) were reported in Glasgow. The cross-validation checking in Glasgow and Edinburgh over a one-year period revealed only 3 (11%) cases of clearly symptomatic vitamin D deficiency, which had been missed by the ScotPSU survey in Glasgow. While 16 (67%) symptomatic cases had failed to be reported through the ScotPSU survey in Edinburgh. For the 23 children who are included in bone and glucose studies, 22 (96%) children had basal serum 25(OH)D in the deficiency range (< 50 nmol/l) and one (4%) child had serum 25(OH)D in the insufficiency range (51-75 nmol/l). Following vitamin D3 treatment, 2 (9%) children had final serum 25(OH)D lower than 50 nmol/l, 6 (26%) children had final serum 25(OH)D between >50-75 nmol/l, 12 (52%) children reached a final serum 25(OH)D >75-150 nmol/l and finally 3 (13%) exceeded the normal reference range with a final 25(OH)D >150 nmol/l. Markers for remodelling ALP and PTH had significantly decreased (p = 0.001 and <0.0001 for ALP and PTH respectively). In 17 patients for whom insulin and HOMA IR data were available and enrolled in glucose study, significant improvements in insulin resistance (p = 0.04) with a trend toward a reduction in serum insulin (p = 0.05) was observed. Of those 14 children who had their cytokines profile data analysed and enrolled in the immunity study, insulin and HOMA IR data were missed in one child. A significant increase in the main Th2 secreted cytokine IL-4 (p = 0.001) and a tendency for significant increases in other Th2 secreted cytokines IL-5 (p = 0.05) and IL-6 (p = 0.05) was observed following vitamin D3 supplementation. Conclusion: An electronic surveillance system can provide data for studying the epidemiology of vitamin D deficiency. However, it may underestimate the number of positive cases. Improving vitamin D status in vitamin D deficient otherwise healthy children significantly improved their vitamin D deficient status, and was associated with an improvement in bone profile, improvements in insulin resistance and an alteration in main Th2 secreting cytokines.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The high affinity receptor for human granulocyte-macrophage colony-stimulating factor (GM-CSF) consists of a cytokine-specific alpha-subunit (hGMR alpha) and a common signal-transducing beta-subunit (hpc) that is shared with the interleukin-3 and -5 receptors, We have previously identified a constitutively active extracellular point mutant of hpc, I374N, that can confer factor independence on murine FDC-P1 cells but not BAF-B03 or CTLL-2 cells (Jenkins, B. J., D'Andrea, R. J., and Gonda, T. J. (1995) EMBO J. 14, 4276-4287), This restricted activity suggested the involvement of cell type-specific signaling molecules in the activation of this mutant. We report here that one such molecule is the mouse GMR alpha (mGMR alpha) subunit, since introduction of mGMR alpha, but not hGMR alpha, into BAF-B03 or CTLL-2 cells expressing the I374N mutant conferred factor independence, Experiments utilizing mouse/human chimeric GMR alpha subunits indicated that the species specificity lies in the extracellular domain of GMRa. Importantly, the requirement for mGMR alpha correlated with the ability of I374N (but not wild-type hpc) to constitutively associate with mGMRa. Expression of I374N in human factor-dependent UT7 cells also led to factor-independent proliferation, with concomitant up-regulation of hGMR alpha surface expression. Taken together, these findings suggest a critical role for association with GMR alpha in the constitutive activity of I374N.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

This study examines the role of Th1 (interferon-gamma [IFN-gamma]) and Th2 (interleukin-4 [IL-4] and IL-10) cytokines, an intercellular adhesion molecule (ICAM-1), and a chemokine receptor (CCR5) in the pathogenesis of periapical lesions at different stages of development in knockout mice. For lesion induction, the first molar was opened and inoculated with 4 bacterial strains and left open to the oral environment. After 21 and 42 days, the IFN-gamma, IL-10, ICAM-1, and CCR5 knockout animals presented periapical lesions larger than those of wild-type animals. There was no statistically significant difference between periapical lesions induced in IL-4 knockout and wild-type animals during the periods evaluated. Our findings suggest an important role for IFN-gamma, IL-10, ICAM-1, and CCR5 in the pathogenesis of experimentally induced pulp infection and bone destruction as endogenous suppressor of periapical lesion development, whereas IL-4 appears to present a nonsignificant effect on periapical lesion modulation.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Differential activation of CD4+ T-cell precursors in vivo leads to the development of effectors with unique patterns of lymphokine secretion. To investigate whether the differential pattern of lymphokine secretion is influenced by factors associated with either the display and/or recognition of the ligand, we have used a set of ligands with various class II binding affinities but unchanged T-cell specificity. The ligand that exhibited approximately 10,000-fold higher binding to I-Au considerably increased the frequency of interferon gamma-producing but not interleukin (IL) 4- or IL-5-secreting cells in vivo. Using an established ligand-specific, CD4+ T-cell clone secreting only IL-4, we also demonstrated that stimulation with the highest affinity ligand resulted in interferon gamma production in vitro. In contrast, ligands that demonstrated relatively lower class II binding induced only IL-4 secretion. These data suggest that the major histocompatibility complex binding affinity of antigenic determinants, leading to differential interactions at the T cell-antigen-presenting cell interface, can be crucial for the differential development of cytokine patterns in T cells.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

To explore the possible involvement of STAT factors ("signal transducers and activators of transcription") in the interleukin 2 receptor (IL-2R) signaling cascade, murine HT-2 cells expressing chimeric receptors composed of the extracellular domain of the erythropoietin receptor fused to the cytoplasmic domains of the IL-2R beta or -gamma c chains were prepared. Erythropoietin or IL-2 activation of these cells resulted in rapid nuclear expression of a DNA-binding activity that reacted with select STAT response elements. Based on reactivity with specific anti-STAT antibodies, this DNA-binding activity was identified as a murine homologue of STAT-5. Induction of nuclear expression of this STAT-5-like factor was blocked by the addition of herbimycin A, a tyrosine kinase inhibitor, but not by rapamycin, an immunophilin-binding antagonist of IL-2-induced proliferation. The IL-2R beta chain appeared critical for IL-2-induced activation of STAT-5, since a mutant beta chain lacking all cytoplasmic tyrosine residues was incapable of inducing this DNA binding. In contrast, a gamma c mutant lacking all of its cytoplasmic tyrosine residues proved fully competent for the induction of STAT-5. Physical binding of STAT-5 to functionally important tyrosine residues within IL-2R beta was supported by the finding that phosphorylated, but not nonphosphorylated, peptides corresponding to sequences spanning Y392 and Y510 of the IL-2R beta tail specifically inhibited STAT-5 DNA binding.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Interleukin-22 (IL-22) is a class 2 cytokine whose primary structure is similar to that of interleukin 10 (IL-10) and interferon-gamma (IFN-gamma). IL-22 induction during acute phase immune response indicates its involvement in mechanisms of inflammation. Structurally different from IL-10 and a number of other members of IL-10 family, which form intertwined inseparable V-shaped dimers of two identical polypeptide chains, a single polypeptide chain of IL-22 folds on itself in a relatively globular structure. Here we present evidence, based on native gel electrophoresis, glutaraldehyde cross-linking, dynamic light scattering, and small angle x-ray scattering experiments, that human IL-22 forms dimers and tetramers in solution under protein concentrations assessable by these experiments. Unexpectedly, low-resolution molecular shape of IL-22 dimers is strikingly similar to that of IL-10 and other intertwined cytokine dimeric forms. Furthermore, we determine an ab initio molecular shape of the IL-22/IL-22R1 complex which reveals the V-shaped IL-22 dimer interacting with two cognate IL-22R1 molecules. Based on this collective evidence, we argue that dimerization might be a common mechanism of all class 2 cytokines for the molecular recognition with their respective membrane receptor. We also speculate that the IL-22 tetramer formation could represent a way to store the cytokine in nonactive form at high concentrations that could be readily converted into functionally active monomers and dimers upon interaction with the cognate cellular receptors.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Malnutrition modifies resistance to infection by impairing a number of physiological processes including hematopoesis and the immune response. In this study, we examined the production of Interleukin-4 (IL-4) and IL-10 in response to lipopolysaccharide (LPS) and also evaluated the cellularity of the blood, bone marrow, and spleen in a mouse model of protein-energy malnutrition. Two-month-old male Swiss mice were subjected to protein-energy malnutrition (PEM) with a low-protein diet (4%) as compared to the control diet (20%). When the experimental group lost approximately 20% of their original body weight, the animals from both groups received 1.25 mu g of LPS intravenously. The Cells ill the blood, bone marrow, and spleen were counted, and circulating levels of IL-4 and IL-10 were evaluated in animals stimulated with LPS. Cells from the spleen, bone marrow, and peritoneal cavity of non-inoculated animals were collected for Culture to evaluate the production of IL-4 and IL-10 after stimulating these cells with 1.25 mu g of LPS in vitro. Malnourished animals presented leucopenia and a severe reduction in bone marrow, spleen, and peritoneal cavity cellularity before and after Stimulus with LPS. The circulating levels of IL-10 were increased in malnourished animals inoculated with LPS when compared to control animals, although the levels of IL-4 did not differ. In cells cultured with LPS, we observed high levels of IL-10 in the bone marrow cells of malnourished animals. These findings suggest that malnourished mice present a deficient immune response to LPS. These alterations may be partly responsible for the immunodeficiency observed in these malnourished mice.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The aim of this study was to investigate the role of interleukin 12 (IL-12) during Strongyloides venezuelensis infection. IL-12(-/-) and wildtype C57BL/6 mice were subcutaneously infected with 1500 larvae of S. venezuelensis. On days 7, 14, and 21 post-infection, we determined eosinophil and mononuclear cell numbers in the blood and broncoalveolar lavage fluid (BALF), Th2 cytokine secretion in the lung parenchyma, and serum antibody levels. The numbers of eggs in the feces and worm parasites in the duodena were also quantified. The eosinophil and mononuclear cell counts and the concentrations of IL-3, IL-5, IL-10, IL-13, and IgG1 and IgE antibodies increased significantly in infected IL-12(-/-) and wild-type mice as compared with uninfected controls. However, the number of eosinophils and mononuclear cells in the blood and BALF and the Th2 cytokine levels in the lungs of infected IL-12-/- mice were greater than in infected wild-type C57BL/6 mice. In addition, serum IgE and IgG1 levels were also significantly enhanced in the infected mice lacking IL-12. Meanwhile, parasite burden and fecal egg counts were significantly decreased in infected IL-12-/- mice. Together, our results showed that the absence of IL-12 upregulates the Th2 immune response, which is important for control of S. venezuelensis infection. (C) 2009 Elsevier Masson SAS. All rights reserved.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Cysteine residues 86 and 91 of the beta subunit of the human interleukin (hIL)-3 receptor (h beta c) participate in disulfide-linked receptor subunit heterodimerization. This linkage is essential for receptor tyrosine phosphorylation, since the Cys-86 --> Ala (Mc4) and Cys-91 --> Ala (Mc5) mutations abolished both events. Here, we used these mutants to examine whether disulfide-linked receptor dimerization affects the biological and biochemical activities of the IL-3 receptor. Murine T cells expressing hIL-3R alpha and Mc4 or Mc5 did not proliferate in hIL-3, whereas cells expressing wild-type h beta c exhibited rapid proliferation. However, a small subpopulation of cells expressing each mutant could be selected for growth in IL-3, and these proliferated similarly to cells expressing wild-type h beta c, despite failing to undergo IL-3-stimulated h beta e tyrosine phosphorylation. The Mc4 and Mc5 mutations substantially reduced, but did not abrogate, IL-3-mediated anti-apoptotic activity in the unselected populations. Moreover, the mutations abolished IL-3-induced JAK2, STAT, and AKT activation in the unselected cells, whereas activation of these molecules in IL-3-selected cells was normal. In contrast, Mc4 and Mc5 showed a limited effect on activation of Erk1 and -2 in unselected cells. These data suggest that whereas disulfide-mediated cross-linking and h beta c tyrosine phosphorylation are normally important for receptor activation, alternative mechanisms can bypass these requirements.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

We have shown previously that nitric oxide (NO) controls platelet endothelial cell adhesion molecule (PECAM-1) expression on both neutrophils and endothelial cells under physiological conditions. Here, the molecular mechanism by which NO regulates lipopolysaccharide (LPS)-induced endothelial PECAM-1 expression and the role of interleukin (IL)-10 on this control was investigated. For this purpose, N-(G)-nitro-L-arginine methyl ester (L-NAME; 20 mg/kg/day for 14 days dissolved in drinking water) was used to inhibit both constitutive (cNOS) and inducible nitric oxide (iNOS) synthase activities in LPS-stimulated Wistar rats (5 mg/kg, intraperitoneally). This treatment resulted in reduced levels of serum NO. Under this condition, circulating levels of IL-10 was enhanced, secreted mainly by circulating lymphocytes, dependent on transcriptional activation, and endothelial PECAM-1 expression was reduced independently on reduced gene synthesis. The connection between NO, IL-10 and PECAM-1 expression was examined by incubating LPS-stimulated (1 mu g/ml) cultured endothelial cells obtained from naive rats with supernatant of LPS-stimulated lymphocytes, which were obtained from blood of control or L-NAME-treated rats. Supernatant of LPS-stimulated lymphocytes obtained from L-NAME-treated rats, which contained higher levels of IL-10, reduced LPS-induced PECAM-1 expression by endothelial cells, and this reduction was reversed by adding the anti-IL-10 monoclonal antibody. Therefore, an association between NO, IL-10 and PECAM-1 was found and may represent a novel mechanism by which NO controls endothelial cell functions.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Background Basophils and mast cells are the main target cells in chronic idiopathic urticaria (CIU). Besides the basopenia, intrinsic defects of the anti-IgE cross-linking signalling pathway of basophils have been described in CIU. Objectives We sought to investigate the profile of expression of activation markers on basophils of patients with CIU and to explore the effect of interleukin (IL)-3 priming upon anti-IgE cross-linking stimuli through expression of activation markers and basophil histamine releasability. Methods Evaluation of the surface expression of Fc epsilon RI alpha, CD63, CD203c and CD123 on whole blood basophils of patients with CIU undergoing autologous serum skin test (ASST) was performed by flow cytometry. The effect of pretreatment with IL-3 in the anti-IgE response was analysed by the expression of basophil activation markers and histamine release using enzyme-linked immunosorbent assay. Results Blood basophils of patients with CIU were reduced in number and displayed increased surface expression of Fc epsilon RI alpha, which was positively correlated with the IgE serum levels. Upregulation of expression of both surface markers CD203c and CD63 was verified on basophils of patients with CIU, regardless of ASST response. High expression of IL-3 receptor on basophils was detected only in ASST+ patients with CIU. Pretreatment with IL-3 upregulated CD203c expression concomitantly with the excreting function of blood basophils and induced a quick hyper-responsiveness to anti-IgE cross-linking on basophils of patients with CIU compared with healthy controls. Conclusions Basophils of patients with CIU showed an activated profile, possibly due to an in vivo priming. Functionally, basophils have high responsiveness to IL-3 stimulation, thereby suggesting that defects in the signal transduction pathway after IgE cross-linking stimuli are recoverable in subjects with chronic urticaria.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Interleukin (IL)-1 alpha and beta are important modulators of many functions of corneal epithelial and stromal cells that occur following injury to the cornea, including the influx of bone marrow-derived inflammatory cells into the stroma attracted by chemokines released from the stroma and epithelium. In this study, we examined the effect of topical soluble IL-1 receptor antagonist on bone marrow-derived cell influx following corneal epithelial scrape injury in a mouse model. C57BL/6 mice underwent corneal epithelial scrape followed by application of IL-1 receptor antagonist (Amgen, Thousand Oaks, CA) at a concentration of 20 mg/ml or vehicle for 24 h prior to immunocytochemical detection of marker CD11b-positive cells into the stroma. In two experiments, topical IL-1 receptor antagonist had a marked effect in blocking cell influx. For example, in experiment 1, topical IL-1 receptor antagonist markedly reduced detectible CD11b-positive cells into the corneal stroma at 24 It after epithelial injury compared with the vehicle control (3.5 +/- 0.5 (standard error of the mean) cells/400x field and 13.9 +/- 1.2 cells/400x field, respectively, p < 0.01). A second experiment with a different observer performing cell counting had the same result. Thus, the data demonstrate conclusively that topical IL-1 receptor antagonist markedly down-regulates CD-11b-positive monocytic cell appearance in the corneal stroma. Topical IL-1 receptor antagonist could be an effective adjuvant for clinical treatment of corneal conditions in which unwanted inflammation has a role in the pathophysiology of the disorder. (c) 2008 Elsevier Ltd. All rights reserved.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Interleukin (IL)-18 has been regarded as a Th1 type cytokine involved in many fungal and parasitic infections. Since there have been no studies, as of yet, evaluating the role of this cytokine in paracoccidioidomycosis (PCM), we assessed the function of IL-18 by using an experimental PCM model. Our results showed that IL-18 knockout (IL-18-/-) BALB/c were more resistant to Paracoccidioides brasiliensis than their littermate controls (WT). In fact, mortality rate was higher in WT mice and in the first month of infection, the number of colony forming units of the etiologic agent recovered from the lungs was greater in WT mice. In histopathological analyses, well-formed granulomas were seen in both WT and IL-18-/- mice. However, substantial differences were observed at the second month of infection when epithelioid cells predominated in the lesions of IL-18-/- mice, which could infer that IL-18 postpones pulmonary healing. The levels of IL-10 were significantly higher in IL-18 sufficient mice at early stages of infection and therefore account for the delayed fungal clearance observed in WT mice. TNF- augmented later in the infection of WT mice, seemingly to compensate high levels of IL-10. Our results demonstrated that IL-18 has a critical role in protecting BALB/c mice against disseminated PCM.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Aims: To evaluate the C-reactive protein (CRP) and interleukin-6 (IL-6) as diagnostic tools for early onset infection in preterm infants with early respiratory distress (RD). Methods: CRP and IL-6 were quantified at identification of RD and 24 h after in 186 newborns. Effects of maternal hypertension, mode of delivery, Apgar score, birth weight, gestational age, mechanical ventilation, being small for gestational age (SGA), and the presence of infection were analyzed. Results: Forty-four infants were classified as infected, 42 as possibly infected, and 100 as uninfected. Serum levels of IL-6 (0 h), CRP (0 h), and CRP (24 h), but not IL-6 (24 h) were significantly higher in infected infants compared to the remaining groups. The best test for identification of infection was the combination of IL-6 (0 h) 36 pg/dL and/or CRP (24 h) 0.6 mg/dL, which yielded 93% sensitivity and 37% specificity. The presence of infection and vaginal delivery independently increased IL-6 (0 h), CRP (0 h) and CRP (24 h) levels. Being SGA also increased the CRP (24 h) levels. IL-6 (24 h) was independently increased by mechanical ventilation. Conclusions: The combination of IL-6 (0 h) and/or CRP (24 h) is helpful for excluding early onset infection in preterm infants with RD but the poor specificity limits its potential benefit as a diagnostic tool.