928 resultados para Thymidine Kinase -- genetics
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
We describe a vaccinialike virus, Aragatuba virus, associated with a cowpoxlike outbreak in a dairy herd and a related case of human infection. Diagnosis was based on virus growth characteristics, electron microscopy, and molecular biology techniques. Molecular characterization of the virus was done by using polymerase chain reaction amplification, cloning, an DNA sequencing of conserved orthopoxvirus genes such as the vaccinia growth factor (VGF), thymidine kinase (TK), and hemagglutinin. We used VGF-homologous and TK gene nucleoticle sequences to construct a phylogenetic tree for comparison with other poxviruses. Gene sequences showed 99% homology with vaccinia virus genes and were clustered together with the isolated virus in the phylogenetic tree. Aragatuba virus is very similar to Cantagalo virus, showing the same signature deletion in the gene. Aragatuba virus could be a novel vaccinialike virus or could represent the spread of Cantagalo virus.
Resumo:
We describe a vaccinialike virus, Araçatuba virus, associated with a cowpoxlike outbreak in a dairy herd and a related case of human infection. Diagnosis was based on virus growth characteristics, electron microscopy, and molecular biology techniques. Molecular characterization of the virus was done by using polymerase chain reaction amplification, cloning, and DNA sequencing of conserved orthopoxvirus genes such as the vaccinia growth factor (VGF), thymidine kinase (TK), and hemagglutinin. We used VGF-homologous and TK gene nucleotide sequences to construct a phylogenetic tree for comparison with other poxviruses. Gene sequences showed 99% homology with vaccinia virus genes and were clustered together with the isolated virus in the phylogenetic tree. Araçatuba virus is very similar to Cantagalo virus, showing the same signature deletion in the gene. Araçatuba virus could be a novel vaccinialike virus or could represent the spread of Cantagalo virus.
Resumo:
Um Cytotoxizität und Gentoxizität nukleosidischer Antiherpes-Virustatika zu untersuchen, wurden stabile CHO-Klone etabliert, die Thymidinkinase (TK) des Herpes simplex-Virus Typ 1 (HSV-TK) oder des Varicella zoster-Virus (VZV-TK) exprimieren. In HSV-TK-exprimierenden Zellen wurde das Purinanalogon Ganciclovir (GCV) effizient in die genomische DNA eingebaut, worauf in den nächsten Replikationsrunden DNA-Strangbrüche und Aberrationen entstehen und Apoptose ausgelöst wird. GCV-induzierte Apoptose wird hauptsächlich über den mitochondrialen Weg vermittelt, wobei das anti-apoptotische Protein Bcl-2 im Mittelpunkt steht. Nach GCV-Behandlung konnte eine Caspase-9-vermittelte post-translationale Spaltung von Bcl-2 nachgewiesen werden. Das 23 kDa-großes Bcl-2-Fragment wirkt im Gegensatz zum intakten Bcl-2-Protein pro-apoptotisch und verstärkt die Cytochrom C-Freisetzung und damit die Aktivierung der Caspase-9, die Bcl-2 spaltet, was zu einem positiven 'Amplifikationsloop' des mitochondrialen apoptotischen Weges führt. In weiteren Experimenten wurde gezeigt, daß in die DNA inkorporiertes GCV durch Basenexzisionsreparatur repariert wird, wobei die DNA-Polymerase ß eine entscheidende Rolle spielt. Diese Reparatur führte zu einer signifikanten Reduktion der Apoptose und Klastogenität und damit zur Resistenzsteigerung gegenüber GCV. In VZV-TK-exprimierenden Zellen wurde gezeigt, daß Brivudin (BVDU), gleichermaßen Apoptose und Nekrose induzierte. Für die BVDU-induzierte Cytotoxizität konnte die Hemmung der Thymidylatsynthetase als Ursache identifiziert werden. Im Gegensatz zur GCV-induzierten Apoptose war für die BVDU-induzierte Apoptose der Rezeptor (Fas/CD95/APO-1)-vermittelte Weg von vorrangiger Bedeutung.
Resumo:
Entscheidend für die Sauerstoffversorgung im ischämischen Gewebe ist die Bildung von Blutgefäßen. Dieser Vorgang findet im erwachsenen Organismus in Form von Arteriogenese, Angiogenese und Vaskulogenese statt. Die Entdeckung, dass endotheliale Progenitorzellen (EPC) aus dem Knochenmark mobilisiert werden können, um sich im Ischämiegebiet an der Bildung neuer Kapillaren zu beteiligen, eröffnet einen vollkommen neuen therapeutischen Ansatz. In der hier vorliegenden Arbeit konnte in drei unterschiedlichen Tiermodellen, dem Matrigelmodell, dem Hinterlaufischämiemodell und dem Infarktmodell der Nacktmaus gezeigt werden, dass eine Zelltherapie mit EPC die Neovaskularisation steigert und zu einer myokardialen Funktionsverbesserung beiträgt. Der entscheidende Beitrag der Arbeit liegt jedoch in der Erforschung des Zeitraums der Wirkung der Stammzelltherapie. In allen drei Tiermodellen konnte durch ein spezifisches Abtöten der mit der viralen Thymidinkinase (TK) transduzierten EPC der positive Effekt auf die Neovaskularisation gestoppt werden. Im Herzinfarktmodell der Nacktmaus kam es sogar zu einer signifikanten Verschlechterung der Herzfunktion sowie zu einer Vergrößerung des Infarktareals. Dieser Effekt war durch Apoptose der Zellen in der dritten und vierten Woche nach Infarkt und Zellinfusion zu beobachten. Somit besitzen EPC nicht nur eine Rolle in der initialen Freisetzung von Zytokinen, sondern tragen auch langfristig zur Aufrechterhaltung des zelltherapeutischen Effektes bei. Ob hierfür allein der Mechanismus der Differenzierung verantwortlich ist, bleibt in weiteren Untersuchungen abzuklären. Denkbar wäre auch eine Beeinflussung des Remodeling über parakrine Langzeiteffekte. Im zweiten Teil der Doktorarbeit wurde versucht, das eingeschränkte zelltherapeutische Potential von Progenitorzellen von Patienten mit „Koronarer Herzkrankheit“ (KHK) und ischämischer Kardiomyopathie mit Hilfe zweier eNOSTranskriptionsverstärker, „eNOS-enhancer“, zu verbessern. Im Matrigelmodell der Maus konnten wir eine Verbesserung des Neovaskularisationspotentials von Knochenmarkszellen (BMC) von Patienten nach Präinkubation mit dem eNOS-enhancer nachweisen. Auch im Myokardinfarktmodell der Maus konnten eine Verbesserung der Herzfunktion und eine Reduktion der Infarktgröße beobachtet werden. Beim direkten Vergleich der beiden eNOS-enhancer konnte kein Unterschied gefunden werden. Zusammenfassend leistet die hier vorliegende Arbeit einen wichtigen Beitrag zum Verständnis für die Bedeutung von Progenitorzellen im Rahmen der Stammzelltherapie nach Myokardinfarkt. Ferner wurde die Möglichkeit aufgezeigt, durch gezielte Beeinflussung der Progenitorzellen ihr therapeutisches Potential signifikant zu steigern.
Resumo:
Cowpox virus, which has been used to protect humans against smallpox but may cause severe disease in immunocompromised persons, has reemerged in humans, domestic cats, and other animal species in Europe. Orthopoxvirus (OPV) DNA was detected in tissues (lung, kidney, spleen) in 24 (9%) of 263 free-ranging Eurasian lynx (Lynx lynx) from Sweden. Thymidine kinase gene amplicon sequences (339 bp) from 21 lynx were all identical to those from cowpox virus isolated from a person in Norway and phylogenetically closer to monkeypox virus than to vaccinia virus and isolates from 2 persons with cowpox virus in Sweden. Prevalence was higher among animals from regions with dense, rather than rural, human populations. Lynx are probably exposed to OPV through predation on small mammal reservoir species. We conclude that OPV is widely distributed in Sweden and may represent a threat to humans. Further studies are needed to verify whether this lynx OPV is cowpox virus.
Resumo:
Treatment of central nervous system (CNS) diseases is limited by the blood-brain barrier (BBB), a selective vascular interface restricting passage of most molecules from blood into brain. Specific transport systems have evolved allowing circulating polar molecules to cross the BBB and gain access to the brain parenchyma. However, to date, few ligands exploiting such systems have proven clinically viable in the setting of CNS diseases. We reasoned that combinatorial phage-display screenings in vivo would yield peptides capable of crossing the BBB and allow for the development of ligand-directed targeting strategies of the brain. Here we show the identification of a peptide mediating systemic targeting to the normal brain and to an orthotopic human glioma model. We demonstrate that this peptide functionally mimics iron through an allosteric mechanism and that a non-canonical association of (i) transferrin, (ii) the iron-mimic ligand motif, and (iii) transferrin receptor mediates binding and transport of particles across the BBB. We also show that in orthotopic human glioma xenografts, a combination of transferrin receptor over-expression plus extended vascular permeability and ligand retention result in remarkable brain tumor targeting. Moreover, such tumor targeting attributes enables Herpes simplex virus thymidine kinase-mediated gene therapy of intracranial tumors for molecular genetic imaging and suicide gene delivery with ganciclovir. Finally, we expand our data by analyzing a large panel of primary CNS tumors through comprehensive tissue microarrays. Together, our approach and results provide a translational avenue for the detection and treatment of brain tumors.
Resumo:
Osseous metastases account for most of the morbidity and mortality associated with prostate cancer, for which there are currently no effective therapies. In the skeletal metastatic environment, neoplastic prostatic epithelial cells interact in a bidirectional stimulatory manner with osteoblastic stromal cells. Similarly, the presence of osteoblastic cells is essential for the survival and maintenance of intraosseous prostate cancer cells. In this thesis, I have developed novel gene therapy strategies for the treatment of androgen-independent human prostate cancers in experimental animal models. First, Ad-CMV-p53, a recombinant adenovirus (Ad) containing p53 tumor suppressor gene driven by the universal cytomegalovirus promoter, was effective in inhibiting prostate cancer cell growth, and direct intratumoral injections of Ad-CMV-p53 resulted in tumor regression. Second, because prostate cancer cells as well as osteoblastic cells produce osteocalcin (OC), OC promoter mediated tissue/tumor specific toxic gene therapy is developed to interrupt stromal-epithelial communications by targeting both cell types. Ad-OC-TK, a recombinant Ad containing the herpes simplex virus thymidine kinase (TK) gene driven by the OC promoter, was generated to inhibit the growth of osteoblastic osteosarcoma with prodrug acyclovir (ACV). Ad-OC-TK/ACV also inhibited the growth of prostate cancer cells and suppressed the growth of subcutaneous and intraosseous prostate tumor. In order to combine treatment modalities to maximize tumor cell-kill with minimized host toxicities, Ad-OC-TK/ACV was applied in combination with low dose methotrexate to eradicate osteoblastic osteosarcoma. In targeting of micrometastatic disease, intravenous Ad-OC-TK/ACV treatment resulted in significant tumor nodule reduction and prolonged the survival of animals harboring osteosarcoma lung metastases without significant host toxicity. Ad-OC-TK is a rational choice for the treatment of prostate cancer skeletal metastasis because OC is uniformly detected in both primary and metastatic human prostate cancer specimens by immunohistochemistry. Ad-OC-TK/ACV inhibits the growth not only of prostate cancer cells but also of their supporting bone stromal cells. Targeting both prostate cancer epithelium and its supporting stroma may be most efficacious for the treatment of prostate cancer osseous metastases. ^
Resumo:
Red Blood cell mediated and glass needle mediated microinjection technology was used to introduce macromolecules into mammalian somatic cells. The biological activities of DNA synthesis inducing factor(s) (Chapter 1), mitotic factor(s) (Chapter 2), and DNA coding for ovalbumin and thymidine kinase (Chapter 3) were studied following injection into mammalian somatic cells.^ Chapter 1. A cell undergoing DNA replication (S phase) contains a factor(s) that induces DNA synthesis prematurely in a G(,1) nucleus when an S phase cell is fused to a G(,1) cell. An assay for the active factor(s) was developed in which a mixture of s phase extract loaded red blood cells (RBC) and synchronous G(,1) HeLa cells was centrifuged onto Concanavalin A (Con A) treated coverslips and fused by PEG. This technique is called "Centrifusion". The synchronous G(,1) HeLa cells injected with S phase extract initiated DNA synthesis earlier than the control G(,1) cells mock injected with RBC loaded with buffer.^ Chapter 2. It has been demonstrated that fusion between a mitotic and an interphase cell usually leads to breakdown of the interphase nucleus, followed by condensation of the interphase chromatin into discrete chromosomes, a process termed premature chromosome condensation. I wanted to develop an assay for the mitotic factor(s) that induces premature chromosome condensation. Experiments were performed utilizing glass needle mediated microinjection of HeLa cell mitotic extract into interphase somatic mammalian cells in an attempt to induce premature chromosome condensation. However, I was not able to induce premature chromosome condensation in the interphase cells, probably because of an inability to introduce sufficient mitotic factor(s) into the cells.^ Chapter 3. A recombinant plasmid containing the chicken ovalbumin gene and three copies of the Herpes thymidine Kinase gene (pOV12-TK) was introduced into mouse LMTK('-) cell nuclei using glass needle mediated gene transfer resulting in LMTK('+) clones that were selected for in HAT medium. Restriction enzyme analysis of the high molecular weight DNA from 6 HAT medium survivor cell clones revealed the presence of one or at best only a few copies of the 12kb ovalbumin gene per mouse genome. Further analysis showed the ovalbumin DNA was not rearranged and was associated with high molecular weight mouse cell DNA. Each of the analyzed cell clones produced ovalbumin demonstrating that the biological activity of the microinjected ovalbumin was retained. ^
Resumo:
Colorectal cancer is the number two cancer killer in the United States. Although primary colorectal cancer can be resected by surgery, patients often die from metastatic disease. Liver is the most common site of metastasis for colorectal cancer. It is difficult to selectively kill metastatic colon cancer cells without damaging normal liver functions. Thus it becomes a high priority to develop a selective targeting system for the treatment of colorectal cancer liver metastasis. ^ In the current study, a gene therapy strategy that allows a therapeutic gene to selectively destroy metastatic colon cancer cells without affecting normal liver cells is developed. The APC gene is frequently mutated in colorectal cancers. These mutations activate β-catenin responsive promoters. An optimized β-catenin responsive promoter, containing TCF consensus binding sites, was engineered for this study. This TCF promoter was found to express preferentially in APC mutated/β-catenin activated colorectal cancers while maintaining a low expression level in cell lines of liver origin. A recombinant adenoviral vector AdTCF-TK, in which the TCF promoter controls expression of the herpes simplex virus thymidine kinase gene, selectively destroyed colorectal cancer cells in vitro. AdTCF-TK virus and ganciclovir treatment also inhibited the growth of solid tumour derived from the colon cancer cell line DLD-1 in nude mice. In a control experiment, the growth inhibition effect of the same virus was attenuated in a liver cancer cell line. ^ In the present study, a novel method was developed to target therapeutic gene expression to colon cancer cells at reduced liver toxicity to the patients. The same gene therapy design may also be applied to treat tumours carrying mutations in the β-catenin gene, which is a central component of the APC signal transduction pathway. In summary, the principle for a rational design of a cancer specific treatment approach is demonstrated in this study. In the future, mutations in cancer patients will be more easily identified. Using the same principle developed in this study, specific regimen can be designed to treat these patients based on the specific genetic changes found in the tumour. ^
Resumo:
The neu oncogene encodes a growth factor receptor-like protein, p185, with an intrinsic tyrosine kinase activity. A single point mutation, an A to T transversion resulting in an amino acid substitution from valine to glutamic acid, in the transmembrane domain of the rat neu gene was found to be responsible for the transforming and tumorigenic phenotype of the cells that carry it. In contrast, the human proto-neu oncogene is frequently amplified in tumors and cell lines derived from tumors and the human neu gene overexpression/amplification in breast and ovarian cancers is known to correlate with poor patient prognosis. Examples of the human neu gene overexpression in the absence of gene amplification have been observed, which may suggest the significant role of the transcriptional and/or post-transcriptional control of the neu gene in the oncogenic process. However, little is known about the transcriptional mechanisms which regulate the neu gene expression. In this study, three examples are presented to demonstrate the positive and negative control of the neu gene expression.^ First, by using band shift assays and methylation interference analyses, I have identified a specific protein-binding sequence, AAGATAAAACC ($-$466 to $-$456), that binds a specific trans-acting factor termed RVF (for EcoRV factor on the neu promoter). The RVF-binding site is required for maximum transcriptional activity of the rat neu promoter. This same sequence is also found in the corresponding regions of both human and mouse neu promoters. Furthermore, this sequence can enhance the CAT activity driven by a minimum promoter of the thymidine kinase gene in an orientation-independent manner, and thus it behaves as an enhancer. In addition, Southwestern (DNA-protein) blot analysis using the RVF-binding site as a probe points to a 60-kDa polypeptide as a potential candidate for RVF.^ Second, it has been reported that the E3 region of adenovirus 5 induces down-regulation of epidermal growth factor (EGF) receptor through endocytosis. I found that the human neu gene product, p185, (an EGF receptor-related protein) is also down-regulated by adenovirus 5, but via a different mechanism. I demonstrate that the adenovirus E1a gene is responsible for the repression of the human neu gene at the transcriptional level.^ Third, a differential expression of the neu gene has been found in two cell model systems: between the mouse fibroblast Swiss-Webster 3T3 (SW3T3) and its variant NR-6 cells; and between the mouse liver tumor cell line, Hep1-a, and the mouse pancreas tumor cell line, 266-6. Both NR-6 and 266-6 cell lines are not able to express the neu gene product, p185. I demonstrate that, in both cases, the transcriptional repression of the neu gene may account for the lack of the p185 expression in these two cell lines. ^
Resumo:
Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^
Resumo:
To investigate the regulation of the human fatty acid synthase gene by the thyroid hormone triiodothyronine, various constructs of the human fatty acid synthase promoter and the luciferase reporter gene were transfected in combination with plasmids expressing the thyroid hormone and the retinoid X receptors in HepG2 cells. The reporter gene was activated 25-fold by the thyroid hormone in the presence of the thyroid hormone receptor. When both the thyroid hormone and the retinoid X receptors were expressed in HepG2 cells, there was about a 100-fold increase in reporter gene expression. 5′-Deletion analysis disclosed two thyroid hormone response elements, TRE1 (nucleotides −870 to −650) and TRE2 (nucleotides −272 to −40), in the human fatty acid synthase promoter. The presence of thyroid hormone response elements in these two regions of the promoter was confirmed by cloning various fragments of these two regions in the minimal thymidine kinase promoter−luciferase reporter gene plasmid construct and determining reporter gene expression. The results of this cloning procedure and those of electrophoretic mobility shift assays indicated that the sequence GGGTTAcgtcCGGTCA (nucleotides −716 to −731) represents TRE1 and that the sequence GGGTCC (nucleotides −117 to −112) represents TRE2. The sequence of TRE1 is very similar to the consensus sequence of the thyroid hormone response element, whereas the sequence of TRE2 contains only a half-site of the thyroid hormone response element consensus motif because it lacks the direct repeat. The sequences on either side of TRE2 seem to influence its response to the thyroid hormone and retinoid X receptors.
Resumo:
The tumor necrosis factor-α (TNF-α) promoter was used to explore the molecular mechanisms of estradiol (E2)-dependent repression of gene transcription. E2 inhibited basal activity and abolished TNF-α activation of the TNF-α promoter. The E2-inhibitory element was mapped to the −125 to −82 region of the TNF-α promoter, known as the TNF-responsive element (TNF-RE). An AP-1-like site in the TNF-RE is essential for repression activity. Estrogen receptor (ER) β is more potent than ERα at repressing the −1044 TNF-α promoter and the TNF-RE upstream of the herpes simplex virus thymidine kinase promoter, but weaker at activating transcription through an estrogen response element. The activation function-2 (AF-2) surface in the ligand-binding domain is required for repression, because anti-estrogens and AF-2 mutations impair repression. The requirement of the AF-2 surface for repression is probably due to its capacity to recruit p160 coactivators or related coregulators, because overexpressing the coactivator glucocorticoid receptor interacting protein-1 enhances repression, whereas a glucocorticoid receptor interacting protein-1 mutant unable to interact with the AF-2 surface is ineffective. Furthermore, receptor interacting protein 140 prevents repression by ERβ, probably by interacting with the AF-2 surface and blocking the binding of endogenous coactivators. These studies demonstrate that E2-mediated repression requires the AF-2 surface and the participation of coactivators or other coregulatory proteins.
Resumo:
Twenty-four base pairs of the human antioxidant response element (hARE) are required for high basal transcription of the NAD(P)H:quinone oxidoreductase1 (NQO1) gene and its induction in response to xenobiotics and antioxidants. hARE is a unique cis-element that contains one perfect and one imperfect AP1 element arranged as inverse repeats separated by 3 bp, followed by a “GC” box. We report here that Jun, Fos, Fra, and Nrf nuclear transcription factors bind to the hARE. Overexpression of cDNA derived combinations of the nuclear proteins Jun and Fos or Jun and Fra1 repressed hARE-mediated chloramphenicol acetyltransferase (CAT) gene expression in transfected human hepatoblastoma (Hep-G2) cells. Further experiments suggested that this repression was due to overexpression of c-Fos and Fra1, but not due to Jun proteins. The Jun (c-Jun, Jun-B, and Jun-D) proteins in all the possible combinations were more or less ineffective in repression or upregulation of hARE-mediated gene expression. Interestingly, overexpression of Nrf1 and Nrf2 individually in Hep-G2 and monkey kidney (COS1) cells significantly increased CAT gene expression from reporter plasmid hARE-thymidine kinase-CAT in transfected cells that were inducible by β-naphthoflavone and tert-butyl hydroquinone. These results indicated that hARE-mediated expression of the NQO1 gene and its induction by xenobiotics and antioxidants are mediated by Nrf1 and Nrf2. The hARE-mediated basal expression, however, is repressed by overexpression of c-Fos and Fra1.