S100A1 deficiency results in prolonged ventricular repolarization in response to sympathetic activation.

S100A1 is a Ca(2+)-binding protein and predominantly expressed in the heart. We have generated a mouse line of S100A1 deficiency by gene trap mutagenesis to investigate the impact of S100A1 ablation on heart function. Electrocardiogram recordings revealed that after beta-adrenergic stimulation S100A1-deficient mice had prolonged QT, QTc and ST intervals and intraventricular conduction disturbances reminiscent of 2 : 1 bundle branch block. In order to identify genes affected by the loss of S100A1, we profiled the mutant and wild type cardiac transcriptomes by gene array analysis. The expression of several genes functioning to the electrical activity of the heart were found to be significantly altered. Although the default prediction would be that mRNA and protein levels are highly correlated, comprehensive immunoblot analyses of salient up- or down-regulated candidate genes of any cellular network revealed no significant changes on protein level. Taken together, we found that S100A1 deficiency results in cardiac repolarization delay and alternating ventricular conduction defects in response to sympathetic activation accompanied by a significantly different transcriptional regulation.

No major impact of skin aging on the response of skin blood flow to a submaximal local thermal stimulus.

OBJECTIVE: This study was undertaken to investigate how aging affects dermal microvascular reactivity in skin areas differentially exposed to sunlight, and therefore to different degrees of photoaging. METHODS: We assessed, in young (18-30 years, n = 13) and aged males (≥60 years, n = 13), the thigh, forearm, and forehead's skin vasodilatory response to local heating (LTH) with a LDI. In each subject and at each location, local Tskin was brought from 34°C (baseline) to 39 or 41°C for 30 minutes, to effect submaximal vasodilation, with maximal vasodilation then elicited by further heating to 44°C. RESULTS: The CVCs evaluated at baseline and after maximal vasodilation (CVCmax ) were higher in the forehead than in the two other anatomical locations. On all locations, CVCmax decreased with age but less markedly in the forehead compared to the two other locations. When expressed in % of CVCmax , the plateau increase of CVCs in response to submaximal temperatures (39 and 41°C) did not vary with age, and minimally so with location. CONCLUSION: Skin aging, whether intrinsic or combined with photoaging, reduces the maximal vasodilatory capacity of the dermal microcirculation, but not its reactivity to local heating.

Correlation between symptoms of the irritable bowel syndrome and the response to the food extract skin prick test

The relationship between the irritable bowel syndrome (IBS) and food intolerance is not clear. We studied the cutaneous response to food antigens in 43 volunteers who were students and employees of the Faculty of Medicine of Universidade Federal Fluminense. Subjects were divided into 3 groups after evaluation for Roma II criteria for functional disease of the gastrointestinal tract: group I, 14 volunteers with IBS; group II, 15 volunteers with functional dyspepsia; group III, 14 volunteers without habitual gastrointestinal symptoms. The subjects were submitted to the skin prick test with 9 food antigen extracts, for a total of 387 skin tests (9 per volunteer). Of the 126 tests applied to group I, 24 (19.4%) were positive (a 3-mm wider papule than the negative control) and of the 135 tests applied to group II, 3 (2.3%) were positive. Of the 126 tests applied to group III, 6 (4%) were positive. The number of positive responses obtained in group I (IBS) differed significantly from the other 2 groups (P < 0.01). None of the volunteers with IBS reported intolerance to any isolated food. The higher reactivity to food antigens in group I compared to groups II and III suggests that intestinal permeability may be increased in patients with IBS.

Normal skin and hypertrophic scar fibroblasts differentially regulate collagen and fibronectin expression as well as mitochondrial membrane potential in response to basic fibroblast growth factor

Basic fibroblast growth factor (bFGF) regulates skin wound healing; however, the underlying mechanism remains to be defined. In the present study, we determined the effects of bFGF on the regulation of cell growth as well as collagen and fibronectin expression in fibroblasts from normal human skin and from hypertrophic scars. We then explored the involvement of mitochondria in mediating bFGF-inducedeffects on the fibroblasts. We isolated and cultivated normal and hypertrophic scar fibroblasts from tissue biopsies of patients who underwent plastic surgery for repairing hypertrophic scars. The fibroblasts were then treated with different concentrations of bFGF (ranging from 0.1 to 1000 ng/mL). The growth of hypertrophic scar fibroblasts became slower with selective inhibition of type I collagen production after exposure to bFGF. However, type III collagen expression was affected in both normal and hypertrophic scar fibroblasts. Moreover, fibronectin expression in the normal fibroblasts was up-regulated after bFGF treatment. bFGF (1000 ng/mL) also induced mitochondrial depolarization in hypertrophic scar fibroblasts (P < 0.01). The cellular ATP level decreased in hypertrophic scar fibroblasts (P < 0.05), while it increased in the normal fibroblasts following treatment with bFGF (P < 0.01). These data suggest that bFGF has differential effects and mechanisms on fibroblasts of the normal skin and hypertrophic scars, indicating that bFGF may play a role in the early phase of skin wound healing and post-burn scar formation.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Characterization of the mechanisms underlying the inflammatory response to Polistes lanio lanio (paper wasp) venom in mouse dorsal skin

Stings by Polistes wasps can cause life-threatening allergic reactions, pain and inflammation. We examined the changes in microvascular permeability and neutrophil influx caused by the venom of Polistes lanio a paper wasp found in southeastern Brazil. The intradermal injection of wasp venom caused long-lasting paw oedema and dose-dependently increased microvascular permeability in mouse dorsal skin. SR140333, an NK(1) receptor antagonist, markedly inhibited the response, but the NK(2) receptor antagonist SR48968 was ineffective. The oedema was reduced in capsaicin-treated rats, indicating a direct activation of sensory fibres. Dialysis of the venom partially reduced the oedema and the remaining response was further inhibited by SR140333. Mass spectrometric analysis of the venom revealed two peptides (QPPTPPEHRFPGLM and ASEPTALGLPRIFPGLM) with sequence similarities to the C-terminal region of tachykinin-like peptides found in Phoneutria nigniventer spider venom and vertebrates. Wasp venom failed to release histamine from mast cells in vitro and spectrofluorometric assay of the venom revealed a negligible content of histamine in the usual dose of P.l. lanio venom (1 nmol of histamine/7 mu g of venom)that was removed by dialysis. The histamine H(1) receptor antagonist pyrilamine, but not bradykinin B(1) or B(2) receptor antagonists, inhibited venom-induced oedema. In conclusion, P. l. lanio venom induces potent oedema and increases vascular permeability in mice, primarily through activation of tachykinin NK(1) receptors by substance P released from sensory C fibres, which in turn releases histamine from dermal mast cells. This is the first description of a neurovascular mechanism for P. l. lanio venom-mediated inflammation. The extent to which the two tachykinin-like peptides identified here contribute to this neurogenic inflammatory response remains to be elucidated. (c) 2008 Elsevier Ltd. All rights reserved.

Maximal inflammatory response benefits syngeneic skin graft acceptance

Objective: We investigated the influence of acute inflammation in skin isograft acceptance. Methods: Two mouse lines selected for maximal (AIR(MAX)) or minimal inflammatory response (AIR(MIN)) were transplanted with syngeneic skin. Cellular infiltrates and cytokine production were measured 1, 3, 7 or 14 days post-transplantation. The percentage of CD4(+) CD25(+) Foxp3(+) cells in the lymph nodes was also evaluated. Results: Grafts were totally accepted in 100% of AIR(MAX) and in 26% of AIR(MIN) mice. In the latter, partial acceptance was observed in 74% of the animals. Emigrated cells were basically PMN and were enhanced in AIR(MAX) transplants. IL-10 production by graft infiltrating cells showed no interline differences. IFN-gamma was increased in AIR(MIN) grafts at day 14 and lower percentages of CD4(+)CD25(+)Foxp3(+) cells in the lymph nodes were observed in these mice. Conclusions: Our data suggest that differences in graft acceptance might be due to a lack of appropriate regulation of the inflammatory response in AIR(MIN) mice compromising the self/non-self recognition.

Differential response related to genotoxicity between eggplant (Solanum melanogena) skin aqueous extract and its main purified anthocyanin (delphinidin) in vivo

Anthocyanins are the largest group of water-soluble pigments in the plant kingdom. A number of studies have demonstrated that anthocyanins present antioxidant capacity and show inhibitory effects on the growth of some cancer cells. Thus, the goal of this study was to evaluate both the antimutagenicity/antigenotoxicity and mutagenicity/genotoxicity of aqueous extract obtained from the Solanum melanogena, a possible novel source of anthocyanin, and its main purified anthocyanin extract (delphinidin), using the single cell (comet) assay and micronucleus test. Pretreatment with higher doses of the purified anthocyanin (10 and 20 mg/kg b.w.) led to a statistically significant reduction (p < 0.05) in the frequency of micronuclei in polychromatic erythrocytes induced by cyclophosphamide. The pattern of reduction ranged from 48% to 57% independent of concentration. No apparent: genotoxicity and mutagenicity was found for either the anthocyanin or delphinidin extracts. Taken together, these results suggest that mice pre-treated with specific compounds present in anthocyanins (delphinidin) displayed a lower incidence of mutations induced by cyclophosphamide. This finding emphasizes the potential of natural colorants to prevent mutations and also the applicability of genotoxic evaluation for improving health. Furthermore, the results presented here could be an additional argument to support the use of anthocyanins in the diet. (c) 2006 Published by Elsevier Ltd.

The sympathetic adrenomedullary system, but not the hypothalamic-pituitary-adrenal axis, participates in aorta adaptive response to stress: nitric oxide involvement

Stress induced a decrease in the reactivity of the aorta to noradrenaline (NA), as a consequence of an endothelial nitric oxide (NO) system hyperactivity. The main characteristic of the stress response is activation of the hypothalamic-pituitary-adrenal (HPA) axis and sympathetic adrenomedullary (SA) system. The participation of the HPA axis and SA system in the decreased reactivity to NA in the aorta of rats exposed to 4-h immobilization was investigated. Concentration-response relationships for NA were obtained in the aorta, with and without endothelium, isolated from normal and stressed rats, following these procedures: (1) in the absence and presence of L-NAME; (2) after adrenalectomy (ADX) or not, in the absence or presence of L-NAME; (3) ADX rats treated or not with corticosterone; (4) ADX associated with stress; and (5) treated or not with reserpine. The reactivity of aorta without endothelium was unaffected by the procedures. The reactivity of aorta with endothelium was decreased by either stress or ADX. This effect was reversed by both L-NAME and corticosterone. ADX did not potentiate the decrease in the aorta reactivity induced by stress. Reserpine did not change the reactivity of aorta with endothelium from normal rats, but prevented the decrease in reactivity induced by stress. It is concluded that the HPA axis participates in endothelium-dependent modulation of aorta reactivity in normal conditions and that thr SA system participates in hyperactivity of the endothelial NO-system induced by stress, which is responsible for the decreased aorta reactivity to NA. (C) 2000 Elsevier B.V. B.V. All rights reserved.

Hunger suppresses the onset and the freezing component of the antipredator response to conspecific skin extract in pintado catfish

Although the skin of an injured conspecific releases alarm substance in some fish species, it has been shown that such damage induces feeding behaviour rather than an alarm reaction under conditions of food scarcity. We studied chemical communication associated with this paradox in a Brazilian catfish, the pintado (Pseudoplatystoma coruscans). In preliminary tests pintado were confirmed to demonstrate an alarm reaction to conspecific skin extract. In the experiment we investigated whether skin extract of pintado induces either alarm response (panic or alert component) or feeding in hungry conspecifics. Fish feed-deprived for eight days and fed control fish were exposed to either conspecific skin extract or distilled water (as a control). Alarm reaction was restricted to the skin extract treatment and occurred in the fish irrespective of their hunger state, but the components of this response were significantly affected by hungry. Fed fish showed a complete alarm reaction (dashing and freezing behaviours). Feed-deprived fish exhibited only part of this biphasic response, the dashing component. We conclude that chemicals from injured fish elicit an alarm reaction, which is partially inhibited by feeding motivation.

Contribution of retrotrapezoid/parafacial respiratory region to the expiratory-sympathetic coupling in response to peripheral chemoreflex in rats

Central mechanisms of coupling between respiratory and sympathetic systems are essential for the entrainment between the enhanced respiratory drive and sympathoexcitation in response to hypoxia. However, the brainstem nuclei and neuronal network involved in these respiratory-sympathetic interactions remain unclear. Here, we evaluated whether the increase in expiratory activity and expiratory-modulated sympathoexcitation produced by the peripheral chemoreflex activation involves the retrotrapezoid nucleus/parafacial respiratory region (RTN/pFRG). Using decerebrated arterially perfused in situ rat preparations (60–80 g), we recorded the activities of thoracic sympathetic (tSN), phrenic (PN), and abdominal nerves (AbN) as well as the extracellular activity of RTN/pFRG expiratory neurons, and reflex responses to chemoreflex activation were evaluated before and after inactivation of the RTN/pFRG region with muscimol (1 mM). In the RTN/pFRG, we identified late-expiratory (late-E) neurons (n = 5) that were silent at resting but fired coincidently with the emergence of late-E bursts in AbN after peripheral chemoreceptor activation. Bilateral muscimol microinjections into the RTN/pFRG region (n = 6) significantly reduced basal PN frequency, mean AbN activity, and the amplitude of respiratory modulation of tSN (P < 0.05). With respect to peripheral chemoreflex responses, muscimol microinjections in the RTN/pFRG enhanced the PN inspiratory response, abolished the evoked late-E activity of AbN, but did not alter either the magnitude or pattern of the tSN reflex response. These findings indicate that the RTN/pFRG region is critically involved in the processing of the active expiratory response but not of the expiratory-modulated sympathetic response to peripheral chemoreflex activation of rat in situ preparations.

Transforming growth factor beta and apoptosis in leprosy skin lesions: possible relationship with the control of the tissue immune response in the Mycobacterium leprae infection

The course of leprosy depends of the host immune response which ranges from the lepromatous pole (LL) to the tuberculoid pole (TT). A comparative study was conducted in 60 patients with the LL and TT The results showed a mean expression of TGF-beta of 339 +/- 99.4 cells/field for TT and of 519.2 +/- 68.2 cells/field for LL. Frequency of apoptosis was 6.3 +/- 1.8 in TT and 14.0 +/- 6.1 in LL. A correlation (p = 0.0251) between TGF-beta and caspase-3 in the LL was found. This finding indicates a role of TGF-beta and apoptosis in the immune response in leprosy. (C) 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Contribution of the retrotrapezoid nucleus/parafacial respiratory region to the expiratory-sympathetic coupling in response to peripheral chemoreflex in rats

Moraes DJ, Dias MB, Cavalcanti-Kwiatkoski R, Machado BH, Zoccal DB. Contribution of retrotrapezoid nucleus/parafacial respiratory region to the expiratory-sympathetic coupling in response to peripheral chemoreflex in rats. J Neurophysiol 108: 882-890, 2012. First published May 16, 2012; doi:10.1152/jn.00193.2012.-Central mechanisms of coupling between respiratory and sympathetic systems are essential for the entrainment between the enhanced respiratory drive and sympathoexcitation in response to hypoxia. However, the brainstem nuclei and neuronal network involved in these respiratory-sympathetic interactions remain unclear. Here, we evaluated whether the increase in expiratory activity and expiratory-modulated sympathoexcitation produced by the peripheral chemoreflex activation involves the retrotrapezoid nucleus/parafacial respiratory region (RTN/pFRG). Using decerebrated arterially perfused in situ rat preparations (60-80 g), we recorded the activities of thoracic sympathetic (tSN), phrenic (PN), and abdominal nerves (AbN) as well as the extracellular activity of RTN/pFRG expiratory neurons, and reflex responses to chemoreflex activation were evaluated before and after inactivation of the RTN/pFRG region with muscimol (1 mM). In the RTN/pFRG, we identified late-expiratory (late-E) neurons (n = 5) that were silent at resting but fired coincidently with the emergence of late-E bursts in AbN after peripheral chemoreceptor activation. Bilateral muscimol microinjections into the RTN/pFRG region (n = 6) significantly reduced basal PN frequency, mean AbN activity, and the amplitude of respiratory modulation of tSN (P < 0.05). With respect to peripheral chemoreflex responses, muscimol microinjections in the RTN/pFRG enhanced the PN inspiratory response, abolished the evoked late-E activity of AbN, but did not alter either the magnitude or pattern of the tSN reflex response. These findings indicate that the RTN/pFRG region is critically involved in the processing of the active expiratory response but not of the expiratory-modulated sympathetic response to peripheral chemoreflex activation of rat in situ preparations.

Adipose tissue-derived mesenchymal stem cells increase skin allograft survival and inhibit Th-17 immune response

Adipose tissue-derived mesenchymal stem cells (ADSC) exhibit immunosuppressive capabilities both in vitro and in vivo. Their use for therapy in the transplant field is attractive as they could render the use of immunosuppressive drugs unnecessary. The aim of this study was to investigate the effect of ADSC therapy on prolonging skin allograft survival. Animals that were treated with a single injection of donor allogeneic ADSC one day after transplantation showed an increase in donor skin graft survival by approximately one week. This improvement was associated with preserved histological morphology, an expansion of CD4(+) regulatory T cells (Treg) in draining lymph nodes, as well as heightened IL-10 expression and down-regulated IL-17 expression. In vitro, ADSC inhibit naïve CD4(+) T cell proliferation and constrain Th-1 and Th-17 polarization. In summary, infusion of ADSC one day post-transplantation dramatically increases skin allograft survival by inhibiting the Th-17 pathogenic immune response and enhancing the protective Treg immune response. Finally, these data suggest that ADSC therapy will open new opportunities for promoting drug-free allograft survival in clinical transplantation.