Shock Train/Boundary-Layer Interaction in Rectangular Scramjet Isolators

Numerous studies of the dual-mode scramjet isolator, a critical component in preventing inlet unstart and/or vehicle loss by containing a collection of flow disturbances called a shock train, have been performed since the dual-mode propulsion cycle was introduced in the 1960s. Low momentum corner flow and other three-dimensional effects inherent to rectangular isolators have, however, been largely ignored in experimental studies of the boundary layer separation driven isolator shock train dynamics. Furthermore, the use of two dimensional diagnostic techniques in past works, be it single-perspective line-of-sight schlieren/shadowgraphy or single axis wall pressure measurements, have been unable to resolve the three-dimensional flow features inside the rectangular isolator. These flow characteristics need to be thoroughly understood if robust dual-mode scramjet designs are to be fielded. The work presented in this thesis is focused on experimentally analyzing shock train/boundary layer interactions from multiple perspectives in aspect ratio 1.0, 3.0, and 6.0 rectangular isolators with inflow Mach numbers ranging from 2.4 to 2.7. Secondary steady-state Computational Fluid Dynamics studies are performed to compare to the experimental results and to provide additional perspectives of the flow field. Specific issues that remain unresolved after decades of isolator shock train studies that are addressed in this work include the three-dimensional formation of the isolator shock train front, the spatial and temporal low momentum corner flow separation scales, the transient behavior of shock train/boundary layer interaction at specific coordinates along the isolator's lateral axis, and effects of the rectangular geometry on semi-empirical relations for shock train length prediction. A novel multiplane shadowgraph technique is developed to resolve the structure of the shock train along both the minor and major duct axis simultaneously. It is shown that the shock train front is of a hybrid oblique/normal nature. Initial low momentum corner flow separation spawns the formation of oblique shock planes which interact and proceed toward the center flow region, becoming more normal in the process. The hybrid structure becomes more two-dimensional as aspect ratio is increased but corner flow separation precedes center flow separation on the order of 1 duct height for all aspect ratios considered. Additional instantaneous oil flow surface visualization shows the symmetry of the three-dimensional shock train front around the lower wall centerline. Quantitative synthetic schlieren visualization shows the density gradient magnitude approximately double between the corner oblique and center flow normal structures. Fast response pressure measurements acquired near the corner region of the duct show preliminary separation in the outer regions preceding centerline separation on the order of 2 seconds. Non-intrusive Focusing Schlieren Deflectometry Velocimeter measurements reveal that both shock train oscillation frequency and velocity component decrease as measurements are taken away from centerline and towards the side-wall region, along with confirming the more two dimensional shock train front approximation for higher aspect ratios. An updated modification to Waltrup \& Billig's original semi-empirical shock train length relation for circular ducts based on centerline pressure measurements is introduced to account for rectangular isolator aspect ratio, upstream corner separation length scale, and major- and minor-axis boundary layer momentum thickness asymmetry. The latter is derived both experimentally and computationally and it is shown that the major-axis (side-wall) boundary layer has lower momentum thickness compared to the minor-axis (nozzle bounded) boundary layer, making it more separable. Furthermore, it is shown that the updated correlation drastically improves shock train length prediction capabilities in higher aspect ratio isolators. This thesis suggests that performance analysis of rectangular confined supersonic flow fields can no longer be based on observations and measurements obtained along a single axis alone. Knowledge gained by the work performed in this study will allow for the development of more robust shock train leading edge detection techniques and isolator designs which can greatly mitigate the risk of inlet unstart and/or vehicle loss in flight.

Production Lot Detection through Synthetic Generated Data

Correctness of information gathered in production environments is an essential part of quality assurance processes in many industries, this task is often performed by human resources who visually take annotations in various steps of the production flow. Depending on the performed task the correlation between where exactly the information is gathered and what it represents is more than often lost in the process. The lack of labeled data places a great boundary on the application of deep neural networks aimed at object detection tasks, moreover supervised training of deep models requires a great amount of data to be available. Reaching an adequate large collection of labeled images through classic techniques of data annotations is an exhausting and costly task to perform, not always suitable for every scenario. A possible solution is to generate synthetic data that replicates the real one and use it to fine-tune a deep neural network trained on one or more source domains to a different target domain. The purpose of this thesis is to show a real case scenario where the provided data were both in great scarcity and missing the required annotations. Sequentially a possible approach is presented where synthetic data has been generated to address those issues while standing as a training base of deep neural networks for object detection, capable of working on images taken in production-like environments. Lastly, it compares performance on different types of synthetic data and convolutional neural networks used as backbones for the model.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Detection of human cytomegalovirus and Epstein-Barr virus in coronary atherosclerotic tissue

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

Validity and reliability of methods for the detection of secondary caries around amalgam restorations in primary teeth

Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.

Spatial pattern detection modeling of thrips (Thrips tabaci) on onion fields

Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.

Detection of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil

To determine the presence of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil, 80 animals slaughtered in the public slaughterhouse of Patos city were used. Before slaughter, blood samples were collected by jugular venopuncture from each animal, and after slaughter, testicles, epidydimus and uterus were aseptically collected. For the serological diagnosis of B. ovis and B. abortus infections, the agar gel immunodiffusion (AGID) and Rose Bengal (RBT) tests were carried out, respectively. In addition, microbiological culture and polymerase chain reaction (PCR) were performed on testicle, epidydimus and uterus samples. Six animals (7.5%) tested positive for the presence of B. ovis antibodies and all animals tested negative for the presence of B. abortus antibodies. One AGID-positive animal tested positive at uterine swab culture. PCR was able to amplify DNA of Brucella spp. from the pool of testicle, epidydimus and uterus samples from AGID-positive animals. This is the first report of isolation and detection of B. ovis DNA by PCR in ovine from the Northeast region of Brazil.

Evaluation of DNA extraction protocols for Brucella abortus pcr detection in aborted fetuses or calves born from cows experimentally infected with strain 2308

The objective of the present study was to improve the detection of B. abortus by PCR in organs of aborted fetuses from infected cows, an important mechanism to find infected herds on the eradication phase of the program. So, different DNA extraction protocols were compared, focusing the PCR detection of B. abortus in clinical samples collected from aborted fetuses or calves born from cows challenged with the 2308 B. abortus strain. Therefore, two gold standard groups were built based on classical bacteriology, formed from: 32 lungs (17 positives), 26 spleens (11 positives), 23 livers (8 positives) and 22 bronchial lymph nodes (7 positives). All samples were submitted to three DNA extraction protocols, followed by the same amplification process with the primers B4 and B5. From the accumulated results for organ, the proportion of positives for the lungs was higher than the livers (p=0.04) or bronchial lymph nodes (p=0.004) and equal to the spleens (p=0.18). From the accumulated results for DNA extraction protocol, the proportion of positives for the Boom protocol was bigger than the PK (p<0.0001) and GT (p=0.0004). There was no difference between the PK and GT protocols (p=0.5). Some positive samples from the classical bacteriology were negative to the PCR and viceversa. Therefore, the best strategy for B. abortus detection in the organs of aborted fetuses or calves born from infected cows is the use, in parallel, of isolation by classical bacteriology and the PCR, with the DNA extraction performed by the Boom protocol.

A closer look at multiple-clone Plasmodium vivax infections: detection methods, prevalence and consequences

The naturally occurring clonal diversity among field isolates of the major human malaria parasite Plasmodium vivax remained unexplored until the early 1990s, when improved molecular methods allowed the use of blood samples obtained directly from patients, without prior in vitro culture, for genotyping purposes. Here we briefly review the molecular strategies currently used to detect genetically distinct clones in patient-derived P. vivax samples, present evidence that multiple-clone P. vivax infections are commonly detected in areas with different levels of malaria transmission and discuss possible evolutionary and epidemiological consequences of the competition between genetically distinct clones in natural human infections. We suggest that, when two or more genetically distinct clones are present in the same host, intra-host competition for limited resources may select for P. vivax traits that represent major public health challenges, such as increased virulence, increased transmissibility and antimalarial drug resistance.

Pre-processing for noise detection in gene expression classification data

Due to the imprecise nature of biological experiments, biological data is often characterized by the presence of redundant and noisy data. This may be due to errors that occurred during data collection, such as contaminations in laboratorial samples. It is the case of gene expression data, where the equipments and tools currently used frequently produce noisy biological data. Machine Learning algorithms have been successfully used in gene expression data analysis. Although many Machine Learning algorithms can deal with noise, detecting and removing noisy instances from the training data set can help the induction of the target hypothesis. This paper evaluates the use of distance-based pre-processing techniques for noise detection in gene expression data classification problems. This evaluation analyzes the effectiveness of the techniques investigated in removing noisy data, measured by the accuracy obtained by different Machine Learning classifiers over the pre-processed data.