967 resultados para Recombination fingerprinting


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Glioma cell lines are an important tool for research in basic and translational neuro-oncology. Documentation of their genetic identity has become a requirement for scientific journals and grant applications to exclude cross-contamination and misidentification that lead to misinterpretation of results. Here, we report the standard 16 marker short tandem repeat (STR) DNA fingerprints for a panel of 39 widely used glioma cell lines as reference. Comparison of the fingerprints among themselves and with the large DSMZ database comprising 9 marker STRs for 2278 cell lines uncovered 3 misidentified cell lines and confirmed previously known cross-contaminations. Furthermore, 2 glioma cell lines exhibited identity scores of 0.8, which is proposed as the cutoff for detecting cross-contamination. Additional characteristics, comprising lack of a B-raf mutation in one line and a similarity score of 1 with the original tumor tissue in the other, excluded a cross-contamination. Subsequent simulation procedures suggested that, when using DNA fingerprints comprising only 9 STR markers, the commonly used similarity score of 0.8 is not sufficiently stringent to unambiguously differentiate the origin. DNA fingerprints are confounded by frequent genetic alterations in cancer cell lines, particularly loss of heterozygosity, that reduce the informativeness of STR markers and, thereby, the overall power for distinction. The similarity score depends on the number of markers measured; thus, more markers or additional cell line characteristics, such as information on specific mutations, may be necessary to clarify the origin.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A total of 189 Candida albicans isolates have been typed by multilocus enzyme electrophoresis. The results obtained confirm the clonal mode of reproduction of C. albicans. The C. albicans populations found in the oropharynx of human immunodeficiency virus (HIV)-infected patients, in the oropharynx of healthy carriers, or in association with invasive candidiasis could not be distinguished. No clone or group of clones could be associated with the appearance of clinical disorders or with a reduced in vitro susceptibility to the antifungal agent fluconazole. Multiple and sequential oral isolates from 24 HIV-infected patients were also typed by restriction enzyme analysis with the enzymes EcoRI and HinfI and by use of the Ca3 repetitive probe. The results obtained by the combination of all three typing methods show that all but one patient each carried a unique major C. albicans clone in their oropharynx. The 21 patients with sequential isolates had the same C. albicans clones in their throats during recurrent oropharyngeal candidiasis episodes, independently of clinical status or of changes of in vitro susceptibility to fluconazole. Finally, several isolates of the same C. albicans clone found simultaneously in the oropharynx of a patient may present different levels of susceptibility to fluconazole.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A deep understanding of the recombination dynamics of ZnO nanowires NWs is a natural step for a precise design of on-demand nanostructures based on this material system. In this work we investigate the influence of finite-size on the recombination dynamics of the neutral bound exciton around 3.365 eV for ZnO NWs with different diameters. We demonstrate that the lifetime of this excitonic transition decreases with increasing the surface-to-volume ratio due to a surface induced recombination process. Furthermore, we have observed two broad transitions around 3.341 and 3.314 eV, which were identified as surface states by studying the dependence of their life time and intensitiy with the NWs dimensions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We propose a light emitting transistor based on silicon nanocrystals provided with 200 Mbits/ s built-in modulation. Suppression of electroluminescence from silicon nanocrystals embedded into the gate oxide of a field effect transistor is achieved by fast Auger quenching. In this process, a modulating drain signal causes heating of carriers in the channel and facilitates the charge injection into the nanocrystals. This excess of charge enables fast nonradiative processes that are used to obtain 100% modulation depths at modulating voltages of 1 V.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In a paper in this week's issue of Science, Voloshin et al. (p. 868) show that a 20-amino acid peptide from RecA, a bacterial protein that repairs and recombines DNA, can mediate DNA strand exchange--one of the functions of the RecA protein. Stasiak discusses why this result is surprising and what the rest of the RecA protein is for.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Sex chromosomes are expected to evolve suppressed recombination, which leads to degeneration of the Y and heteromorphism between the X and Y. Some sex chromosomes remain homomorphic, however, and the factors that prevent degeneration of the Y in these cases are not well understood. The homomorphic sex chromosomes of the European tree frogs (Hyla spp.) present an interesting paradox. Recombination in males has never been observed in crossing experiments, but molecular data are suggestive of occasional recombination between the X and Y. The hypothesis that these sex chromosomes recombine has not been tested statistically, however, nor has the X-Y recombination rate been estimated. Here, we use approximate Bayesian computation coupled with coalescent simulations of sex chromosomes to quantify X-Y recombination rate from existent data. We find that microsatellite data from H. arborea, H. intermedia and H. molleri support a recombination rate between X and Y that is significantly different from zero. We estimate that rate to be approximately 10(5) times smaller than that between X chromosomes. Our findings support the notion that very low recombination rate may be sufficient to maintain homomorphism in sex chromosomes.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Gene transfer and expression in eukaryotes is often limited by a number of stably maintained gene copies and by epigenetic silencing effects. Silencing may be limited by the use of epigenetic regulatory sequences such as matrix attachment regions (MAR). Here, we show that successive transfections of MAR-containing vectors allow a synergistic increase of transgene expression. This finding is partly explained by an increased entry into the cell nuclei and genomic integration of the DNA, an effect that requires both the MAR element and iterative transfections. Fluorescence in situ hybridization analysis often showed single integration events, indicating that DNAs introduced in successive transfections could recombine. High expression was also linked to the cell division cycle, so that nuclear transport of the DNA occurs when homologous recombination is most active. Use of cells deficient in either non-homologous end-joining or homologous recombination suggested that efficient integration and expression may require homologous recombination-based genomic integration of MAR-containing plasmids and the lack of epigenetic silencing events associated with tandem gene copies. We conclude that MAR elements may promote homologous recombination, and that cells and vectors can be engineered to take advantage of this property to mediate highly efficient gene transfer and expression.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Transcription Activator-Like Effector Nucleases (TALEN) are potential tools for precise genome engineering of laboratory animals. We report the first targeted genomic integration in the rat using TALENs (Transcription Activator-Like Effector Nucleases) by homology-derived recombination (HDR). We assembled TALENs and designed a linear donor insert targeting a pA476T mutation in the rat Glucocorticoid Receptor (Nr3c1) namely GR(dim), that prevents receptor homodimerization in the mouse. TALEN mRNA and linear double-stranded donor were microinjected into rat one-cell embryos. Overall, we observed targeted genomic modifications in 17% of the offspring, indicating high TALEN cutting efficiency in rat zygotes.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Although several approaches have been attempted, the estimation of recombination frequencies in natural populations ofbacteria remains challenging. Previous studies have demonstrated awide variety of situations among bacterial species, ranging from theclonal diversification of Salmonella or Escherichia coli, which aremainly due to mutation, to the frequent recombination found inNeisseria gonorrhoeae or Helicobacter pylori. Most of the populationstudies done with bacterial species suggest that recombination occursin nature but that it is infrequent compared to mutation. Consequently,bacterial populations consist largely of independent clonal lineages.Our research suggests little or null influence of recombination in thegenetic structure of "Aeromonas hydrophila Species Complex", despite the presence of some strains with recombinant gene fragments.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: Arbuscular mycorrhizal fungi (AMF) are important symbionts of most plant species, promoting plant diversity and productivity. This symbiosis is thought to have contributed to the early colonisation of land by plants. Morphological stasis over 400 million years and the lack of an observed sexual stage in any member of the phylum Glomeromycota led to the controversial suggestion of AMF being ancients asexuals. Evidence for recombination in AMF is contradictory. Results: We addressed the question of recombination in the AMF Glomus intraradices by sequencing 11 polymorphic nuclear loci in 40 morphologically identical isolates from one field. Phylogenetic relationships among genotypes showed a reticulate network pattern providing a rationale to test for recombination. Five statistical tests predicted multiple recombinant regions in the genome of a core set of isolates. In contrast, five clonal lineages had fixed a large number of differences. Conclusion: Our data show that AMF from one field have undergone recombination but that clonal lineages coexist. This finding has important consequences for understanding AMF evolution, co-evolution of AMF and plants and highlights the potential for commercially introduced AMF inoculum recombining with existing local populations. Finally, our results reconcile seemingly contradictory studies on whether AMF are clonal or form recombining populations.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In vertebrates, the RAD51 protein is required for genetic recombination, DNA repair, and cellular proliferation. Five paralogs of RAD51, known as RAD51B, RAD51C, RAD51D, XRCC2, and XRCC3, have been identified and also shown to be required for recombination and genome stability. At the present time, however, very little is known about their biochemical properties or precise biological functions. As a first step toward understanding the roles of the RAD51 paralogs in recombination, the human RAD51C and XRCC3 proteins were overexpressed and purified from baculovirus-infected insect cells. The two proteins copurify as a complex, a property that reflects their endogenous association observed in HeLa cells. Purified RAD51C--XRCC3 complex binds single-stranded, but not duplex DNA, to form protein--DNA networks that have been visualized by electron microscopy.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The Saccharomyces cerevisiae Dmc1 and Tid1 proteins are required for the pairing of homologous chromosomes during meiotic recombination. This pairing is the precursor to the formation of crossovers between homologs, an event that is necessary for the accurate segregation of chromosomes. Failure to form crossovers can have serious consequences and may lead to chromosomal imbalance. Dmc1, a meiosis-specific paralog of Rad51, mediates the pairing of homologous chromosomes. Tid1, a Rad54 paralog, although not meiosis-specific, interacts with Dmc1 and promotes crossover formation between homologs. In this study, we show that purified Dmc1 and Tid1 interact physically and functionally. Dmc1 forms stable nucleoprotein filaments that can mediate DNA strand invasion. Tid1 stimulates Dmc1-mediated formation of joint molecules. Under conditions optimal for Dmc1 reactions, Rad51 is specifically stimulated by Rad54, establishing that Dmc1-Tid1 and Rad51-Rad54 function as specific pairs. Physical interaction studies show that specificity in function is not dictated by direct interactions between the proteins. Our data are consistent with the hypothesis that Rad51-Rad54 function together to promote intersister DNA strand exchange, whereas Dmc1-Tid1 tilt the bias toward interhomolog DNA strand exchange.