Concurrent or sequential adjuvant letrozole and radiotherapy after conservative surgery for early-stage breast cancer (CO-HO-RT): a phase 2 randomised trial.

BACKGROUND: Letrozole radiosensitises breast cancer cells in vitro. In clinical settings, no data exist for the combination of letrozole and radiotherapy. We assessed concurrent and sequential radiotherapy and letrozole in the adjuvant setting. METHODS: This phase 2 randomised trial was undertaken in two centres in France and one in Switzerland between Jan 12, 2005, and Feb 21, 2007. 150 postmenopausal women with early-stage breast cancer were randomly assigned after conserving surgery to either concurrent radiotherapy and letrozole (n=75) or sequential radiotherapy and letrozole (n=75). Randomisation was open label with a minimisation technique, stratified by investigational centres, chemotherapy (yes vs no), radiation boost (yes vs no), and value of radiation-induced lymphocyte apoptosis (< or = 16% vs >16%). Whole breast was irradiated to a total dose of 50 Gy in 25 fractions over 5 weeks. In the case of supraclavicular and internal mammary node irradiation, the dose was 44-50 Gy. Letrozole was administered orally once daily at a dose of 2.5 mg for 5 years (beginning 3 weeks pre-radiotherapy in the concomitant group, and 3 weeks post-radiotherapy in the sequential group). The primary endpoint was the occurrence of acute (during and within 6 weeks of radiotherapy) and late (within 2 years) radiation-induced grade 2 or worse toxic effects of the skin. Analyses were by intention to treat. This study is registered with ClinicalTrials.gov, number NCT00208273. FINDINGS: All patients were analysed apart from one in the concurrent group who withdrew consent before any treatment. During radiotherapy and within the first 12 weeks after radiotherapy, 31 patients in the concurrent group and 31 in the sequential group had any grade 2 or worse skin-related toxicity. The most common skin-related adverse event was dermatitis: four patients in the concurrent group and six in the sequential group had grade 3 acute skin dermatitis during radiotherapy. At a median follow-up of 26 months (range 3-40), two patients in each group had grade 2 or worse late effects (both radiation-induced subcutaneous fibrosis). INTERPRETATION: Letrozole can be safely delivered shortly after surgery and concomitantly with radiotherapy. Long-term follow-up is needed to investigate cardiac side-effects and cancer-specific outcomes. FUNDING: Novartis Oncology France.

Pilot study about the effect of rt-PA administration on the excitotoxicity mediated brain damage and its repercussion on the functional prognosis of patients with ischaemic stroke: research protocol

Fibrinolytic therapy with Recombinant Tissue-Plasminogen Activator (rt-PA) is currently the only effective treatment for ischaemic stroke in its acute phase. Even though its use generally improves the prognosis of those patients likely to receive it, rt-PA administration is associated to several risks, such as haemorrhagic transformation ofthe ischaemic lesion and activation of excitotoxic mechanisms that may contribute to an increase in mortality or to a poor outcome in certain occasions, specially when arterial recanalization is not achieved or the rt-PA is lately administrated. Since in the last few years the role of glutamate in the neurotoxicity associated toischaemia has been widely studied and it is known that high plasma glutamate levels are predictors of ischaemic lesion growth and poor neurological outcome, it is necessary to find out which factors can contribute to glutamate release in the brain. The aim of this study is to determine if rt-PA administration is related to an increase in plasma glutamate levels, as well as to define if higher plasma glutamate levels at admission are related to different evolution and prognosis of our patients, both in those in which recanalisation is achieved and not. A series of cases of patients with hemispheric cerebral infarction admitted in our hospital during a year will be studied, and the data obtained from them will be compared to the data obtained from a control group, the samples of wich were takenyears ago, before rt-PA was routinely used

RT-PCR and Dot Blot hybridization methods for a universal detection of tospoviruses

Transcriptase reverse - polymerase chain reaction (RT-PCR) and dot blot hybridization with digoxigenin-labeled probes were applied for the universal detection of Tospovirus species. The virus species tested were Tomato spotted wilt virus, Tomato chlorotic spot virus, Groundnut ringspot virus, Chrysanthemum stem necrosis virus, Impatiens necrotic spot virus, Zucchini lethal chlorosis virus, Iris yellow spot virus. Primers for PCR amplification were designed to match conserved regions of the tospovirus genome. RT-PCR using distinct primer combinations was unable to simultaneously amplify all tospovirus species and consistently failed to detect ZLCV and IYSV in total RNA extracts. However, all tospovirus species were detected by RT-PCR when viral RNA was used as template. RNA-specific PCR products were used as probes for dot hybridization. This assay with a M probe (directed to the G1/G2 gene) detected at low stringency conditions all Tospovirus species, except IYSV. At low stringency conditions, the L non-radioactive probe detected the seven Tospovirus species in a single assay. This method for broad spectrum detection can be potentially employed in quarantine services for indexing in vitro germplasm.

RT-PCR-ELISA for detection of Apple stem grooving virus in apple trees

A method to detect Apple stem grooving virus (ASGV) based on reverse transcription polymerase chain reaction (RT-PCR) was developed using primers ASGV4F-ASGV4R targeting the viral replicase gene, followed by a sandwich hybridisation, in microtiter plates, for colorimetric detection of the PCR products. The RT-PCR was performed with the Titan™ RT-PCR system, using AMV and diluted crude extracts of apple (Malus domestica) leaf or bark for the first strand synthesis and a mixture of Taq and PWO DNA polymerase for the PCR step. The RT-PCR products is hybridised with both a biotin-labelled capture probe linked to a streptavidin-coated microtiter plate and a digoxigenin (DIG)-labelled detection probe. The complex was detected with an anti-DIG conjugate labelled with alkaline phosphatase. When purified ASGV was added to extracts of plant tissue, as little as 400 fg of the virus was detected with this method. The assay with ASGV4F-ASGV4R primers specifically detected the virus in ASGV-infected apple trees from different origins, whereas no signal was observed with amplification products obtained with primers targeting the coat protein region of the ASGV genome or with primers specific for Apple chlorotic leaf spot virus (ACLSV) and Apple stem pitting virus (ASPV). The technique combines the power of PCR to increase the number of copies of the targeted gene, the specificity of DNA hybridization, and the ease of colorimetric detection and sample handling in microplates.

Detecção de allexivírus em primórdios foliares de alho via RT-PCR

Nos procedimentos de detecção de allexivirus em bulbos de alho, tem-se como rotina o plantio de bulbilhos para obtenção de tecido foliar a ser analisado via testes sorológicos e/ou moleculares. A disponibilização das plantas em casa de vegetação implica em gastos com a manutenção e requer, em média, 30 dias. Em áreas isentas desses vírus, corre-se, ainda, o risco de sua introdução e disseminação. No presente trabalho buscou-se ajustar um protocolo para detecção rápida de allexivírus em alho a partir de primórdios foliares. Bulbilhos de alho para consumo, oriundos do Rio Grande do Sul e importados da Argentina foram dissecados para obtenção de primórdios foliares e extração de RNA total a partir de 0,1 g de tecido. A seguir foram conduzidas reações de RT-PCR com um par de oligonucleotídeos, capaz de gerar um fragmento de aproximadamente 500 pb relativo à porção interna do gene da capa protéica de várias espécies do gênero Allexivirus. Uma banda com tamanho aproximado de 500 pb foi visualizada, em gel de agarose e, posteriormente, confirmada por Southern Blot e por seqüenciamento como sendo Garlic vírus C (GarV-C, AY170322.1). A obtenção de RNA total diretamente de primórdios foliares de bulbilhos e seu uso em análise de RT-PCR, constituem-se em uma metodologia econômica, rápida e segura para a detecção de allexivírus em bulbos de alho.

Bidens mosaic virus: detecção via RT-PCR e identificação de Galinsoga parviflora como um novo hospedeiro natural do vírus

O Bidens mosaic virus (BiMV) é uma espécie tentativa do gênero Potyvirus, que infecta alface (Lactuca sativa). Na ausência de métodos eficientes para diagnose deste vírus, o objetivo do trabalho foi a síntese de oligonucleotídeos específicos e sua otimização em testes de RT-PCR em uma só etapa, partindo-se de extrações de RNA total. Os oligonucleotídeos 8851sens (5'AGG CAG TTC GCA CGG CAT AC 3´) e 9211ant (5´ CTT CAT CTG GAT GTG TGC TTC 3´) permitem a eficiente detecção do vírus e possibilitaram a descoberta de uma nova hospedeira do vírus, a planta Galinsoga parviflora, comumente encontrada em canteiros de produção comercial de alface.

Genetic grouping of avian infectious bronchitis virus isolated in Brazil based on RT-PCR/RFLP analysis of the S1 gene

Twelve Brazilian isolates and one reference vaccine strain of avian infectious bronchitis virus (IBV) were propagated in embryonating chicken eggs. The entire S1 glycoprotein gene of these viruses was analysed by reverse-transcriptase-polymerase chain reaction and restriction fragment length polymorphism (RT-PCR-RFLP), using the restriction enzymes HaeIII, XcmI and BstyI. The RFLP patterns led to the classification of these isolates into five distinct genotypes: A, B, C, D and Massachusetts. Five of twelve isolates were grouped in Massachusetts genotype and the remaining seven viruses were classified into four distinct genotypes: A (2), B (2), C (2) or D (1). Such genotyping classification agreed with previous immunological analysis for most of these viruses, highlighting the occurrence of a relevant variability among the IBV strains that are circulating in Brazilian commercial poultry flocks.

Rapid detection of bovine coronavirus by a semi-nested RT-PCR

Bovine coronavirus (BCoV) is a member of the group 2 of the Coronavirus (Nidovirales: Coronaviridae) and the causative agent of enteritis in both calves and adult bovine, as well as respiratory disease in calves. The present study aimed to develop a semi-nested RT-PCR for the detection of BCoV based on representative up-to-date sequences of the nucleocapsid gene, a conserved region of coronavirus genome. Three primers were designed, the first round with a 463bp and the second (semi-nested) with a 306bp predicted fragment. The analytical sensitivity was determined by 10-fold serial dilutions of the BCoV Kakegawa strain (HA titre: 256) in DEPC treated ultra-pure water, in fetal bovine serum (FBS) and in a BCoV-free fecal suspension, when positive results were found up to the 10-2, 10-3 and 10-7 dilutions, respectively, which suggests that the total amount of RNA in the sample influence the precipitation of pellets by the method of extraction used. When fecal samples was used, a large quantity of total RNA serves as carrier of BCoV RNA, demonstrating a high analytical sensitivity and lack of possible substances inhibiting the PCR. The final semi-nested RT-PCR protocol was applied to 25 fecal samples from adult cows, previously tested by a nested RT-PCR RdRp used as a reference test, resulting in 20 and 17 positives for the first and second tests, respectively, and a substantial agreement was found by kappa statistics (0.694). The high sensitivity and specificity of the new proposed method and the fact that primers were designed based on current BCoV sequences give basis to a more accurate diagnosis of BCoV-caused diseases, as well as to further insights on protocols for the detection of other Coronavirus representatives of both Animal and Public Health importance.

Application of the differential display RT-PCR strategy for the identification of inflammation-related mouse genes

The inflammatory response elicited by various stimuli such as microbial products or cytokines is determined by differences in the pattern of cellular gene expression. We have used the differential display RT-PCR (DDRT-PCR) strategy to identify mRNAs that are differentially expressed in various murine cell types stimulated with pro-inflammatory cytokines, microbial products or anti-inflammatory drugs. Mouse embryonic fibroblasts (MEFs) were treated with IFNs, TNF, or sodium salicylate. Also, peritoneal macrophages from C3H/Hej mice were stimulated with T. cruzi-derived GPI-mucin and/or IFN-g. After DDRT-PCR, various cDNA fragments that were differentially represented on the sequencing gel were recovered, cloned and sequenced. Here, we describe a summary of several experiments and show that, when 16 of a total of 28 recovered fragments were tested for differential expression, 5 (31%) were found to represent mRNAs whose steady-state levels are indeed modulated by the original stimuli. Some of the identified cDNAs encode for known proteins that were not previously associated with the inflammatory process triggered by the original stimuli. Other cDNA fragments (8 of 21 sequences, or 38%) showed no significant homology with known sequences and represent new mouse genes whose characterization might contribute to our understanding of inflammation. In conclusion, DDRT-PCR has proven to be a potent technology that will allow us to identify genes that are differentially expressed when cells are subjected to changes in culture conditions or isolated from different organs.

A simple RT-PCR-based strategy for screening connexin identity

Vertebrate gap junctions are aggregates of transmembrane channels which are composed of connexin (Cx) proteins encoded by at least fourteen distinct genes in mammals. Since the same Cx type can be expressed in different tissues and more than one Cx type can be expressed by the same cell, the thorough identification of which connexin is in which cell type and how connexin expression changes after experimental manipulation has become quite laborious. Here we describe an efficient, rapid and simple method by which connexin type(s) can be identified in mammalian tissue and cultured cells using endonuclease cleavage of RT-PCR products generated from "multi primers" (sense primer, degenerate oligonucleotide corresponding to a region of the first extracellular domain; antisense primer, degenerate oligonucleotide complementary to the second extracellular domain) that amplify the cytoplasmic loop regions of all known connexins except Cx36. In addition, we provide sequence information on RT-PCR primers used in our laboratory to screen individual connexins and predictions of extension of the "multi primer" method to several human connexins.

Comparison of the quantitative competitive and semiquantitative RT-PCR methods for the determination of interferon-gamma mRNA levels in AIDS-free HIV-infected individuals

IFN-gamma mRNA expression was evaluated in nonstimulated peripheral blood mononuclear cells (PBMC) of HIV-infected and seronegative individuals using quantitative competitive and semiquantitative RT-PCR and the sensitivity of these methods was compared. A significant correlation was found between quantitative competitive and semiquantitative RT-PCR in samples of both HIV-seronegative (P = 0.004) and HIV-infected individuals (P = 0.0004). PBMC from HIV-infected individuals presented a remarkable increase of IFN-gamma mRNA expression, as determined by both types of RT-PCR methods. Semiquantitative RT-PCR even without an internal standard is also acceptable for measuring cytokine mRNA expression, but less reliable if small amounts are quantified. Moreover, we found that increased IFN-gammamRNA expression is independent of CD4+ cell count in AIDS-free HIV-infected patients.

Standard-curve competitive RT-PCR quantification of myogenic regulatory factors in chicken embryos

The reverse transcription-polymerase chain reaction (RT-PCR) is the most sensitive method used to evaluate gene expression. Although many advances have been made since quantitative RT-PCR was first described, few reports deal with the mathematical bases of this technique. The aim of the present study was to develop and standardize a competitive PCR method using standard-curves to quantify transcripts of the myogenic regulatory factors MyoD, Myf-5, Myogenin and MRF4 in chicken embryos. Competitor cDNA molecules were constructed for each gene under study using deletion primers, which were designed to maintain the anchorage sites for the primers used to amplify target cDNAs. Standard-curves were prepared by co-amplification of different amounts of target cDNA with a constant amount of competitor. The content of specific mRNAs in embryo cDNAs was determined after PCR with a known amount of competitor and comparison to standard-curves. Transcripts of the housekeeping ß-actin gene were measured to normalize the results. As predicted by the model, most of the standard-curves showed a slope close to 1, while intercepts varied depending on the relative efficiency of competitor amplification. The sensitivity of the RT-PCR method permitted the detection of as few as 60 MyoD/Myf-5 molecules per reaction but approximately 600 molecules of MRF4/Myogenin mRNAS were necessary to produce a measurable signal. A coefficient of variation of 6 to 19% was estimated for the different genes analyzed (6 to 9 repetitions). The competitive RT-PCR assay described here is sensitive, precise and allows quantification of up to 9 transcripts from a single cDNA sample.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.