985 resultados para Quantitative RT-PCR


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Nos procedimentos de detecção de allexivirus em bulbos de alho, tem-se como rotina o plantio de bulbilhos para obtenção de tecido foliar a ser analisado via testes sorológicos e/ou moleculares. A disponibilização das plantas em casa de vegetação implica em gastos com a manutenção e requer, em média, 30 dias. Em áreas isentas desses vírus, corre-se, ainda, o risco de sua introdução e disseminação. No presente trabalho buscou-se ajustar um protocolo para detecção rápida de allexivírus em alho a partir de primórdios foliares. Bulbilhos de alho para consumo, oriundos do Rio Grande do Sul e importados da Argentina foram dissecados para obtenção de primórdios foliares e extração de RNA total a partir de 0,1 g de tecido. A seguir foram conduzidas reações de RT-PCR com um par de oligonucleotídeos, capaz de gerar um fragmento de aproximadamente 500 pb relativo à porção interna do gene da capa protéica de várias espécies do gênero Allexivirus. Uma banda com tamanho aproximado de 500 pb foi visualizada, em gel de agarose e, posteriormente, confirmada por Southern Blot e por seqüenciamento como sendo Garlic vírus C (GarV-C, AY170322.1). A obtenção de RNA total diretamente de primórdios foliares de bulbilhos e seu uso em análise de RT-PCR, constituem-se em uma metodologia econômica, rápida e segura para a detecção de allexivírus em bulbos de alho.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

O Bidens mosaic virus (BiMV) é uma espécie tentativa do gênero Potyvirus, que infecta alface (Lactuca sativa). Na ausência de métodos eficientes para diagnose deste vírus, o objetivo do trabalho foi a síntese de oligonucleotídeos específicos e sua otimização em testes de RT-PCR em uma só etapa, partindo-se de extrações de RNA total. Os oligonucleotídeos 8851sens (5'AGG CAG TTC GCA CGG CAT AC 3´) e 9211ant (5´ CTT CAT CTG GAT GTG TGC TTC 3´) permitem a eficiente detecção do vírus e possibilitaram a descoberta de uma nova hospedeira do vírus, a planta Galinsoga parviflora, comumente encontrada em canteiros de produção comercial de alface.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Twelve Brazilian isolates and one reference vaccine strain of avian infectious bronchitis virus (IBV) were propagated in embryonating chicken eggs. The entire S1 glycoprotein gene of these viruses was analysed by reverse-transcriptase-polymerase chain reaction and restriction fragment length polymorphism (RT-PCR-RFLP), using the restriction enzymes HaeIII, XcmI and BstyI. The RFLP patterns led to the classification of these isolates into five distinct genotypes: A, B, C, D and Massachusetts. Five of twelve isolates were grouped in Massachusetts genotype and the remaining seven viruses were classified into four distinct genotypes: A (2), B (2), C (2) or D (1). Such genotyping classification agreed with previous immunological analysis for most of these viruses, highlighting the occurrence of a relevant variability among the IBV strains that are circulating in Brazilian commercial poultry flocks.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Bovine coronavirus (BCoV) is a member of the group 2 of the Coronavirus (Nidovirales: Coronaviridae) and the causative agent of enteritis in both calves and adult bovine, as well as respiratory disease in calves. The present study aimed to develop a semi-nested RT-PCR for the detection of BCoV based on representative up-to-date sequences of the nucleocapsid gene, a conserved region of coronavirus genome. Three primers were designed, the first round with a 463bp and the second (semi-nested) with a 306bp predicted fragment. The analytical sensitivity was determined by 10-fold serial dilutions of the BCoV Kakegawa strain (HA titre: 256) in DEPC treated ultra-pure water, in fetal bovine serum (FBS) and in a BCoV-free fecal suspension, when positive results were found up to the 10-2, 10-3 and 10-7 dilutions, respectively, which suggests that the total amount of RNA in the sample influence the precipitation of pellets by the method of extraction used. When fecal samples was used, a large quantity of total RNA serves as carrier of BCoV RNA, demonstrating a high analytical sensitivity and lack of possible substances inhibiting the PCR. The final semi-nested RT-PCR protocol was applied to 25 fecal samples from adult cows, previously tested by a nested RT-PCR RdRp used as a reference test, resulting in 20 and 17 positives for the first and second tests, respectively, and a substantial agreement was found by kappa statistics (0.694). The high sensitivity and specificity of the new proposed method and the fact that primers were designed based on current BCoV sequences give basis to a more accurate diagnosis of BCoV-caused diseases, as well as to further insights on protocols for the detection of other Coronavirus representatives of both Animal and Public Health importance.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The inflammatory response elicited by various stimuli such as microbial products or cytokines is determined by differences in the pattern of cellular gene expression. We have used the differential display RT-PCR (DDRT-PCR) strategy to identify mRNAs that are differentially expressed in various murine cell types stimulated with pro-inflammatory cytokines, microbial products or anti-inflammatory drugs. Mouse embryonic fibroblasts (MEFs) were treated with IFNs, TNF, or sodium salicylate. Also, peritoneal macrophages from C3H/Hej mice were stimulated with T. cruzi-derived GPI-mucin and/or IFN-g. After DDRT-PCR, various cDNA fragments that were differentially represented on the sequencing gel were recovered, cloned and sequenced. Here, we describe a summary of several experiments and show that, when 16 of a total of 28 recovered fragments were tested for differential expression, 5 (31%) were found to represent mRNAs whose steady-state levels are indeed modulated by the original stimuli. Some of the identified cDNAs encode for known proteins that were not previously associated with the inflammatory process triggered by the original stimuli. Other cDNA fragments (8 of 21 sequences, or 38%) showed no significant homology with known sequences and represent new mouse genes whose characterization might contribute to our understanding of inflammation. In conclusion, DDRT-PCR has proven to be a potent technology that will allow us to identify genes that are differentially expressed when cells are subjected to changes in culture conditions or isolated from different organs.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Vertebrate gap junctions are aggregates of transmembrane channels which are composed of connexin (Cx) proteins encoded by at least fourteen distinct genes in mammals. Since the same Cx type can be expressed in different tissues and more than one Cx type can be expressed by the same cell, the thorough identification of which connexin is in which cell type and how connexin expression changes after experimental manipulation has become quite laborious. Here we describe an efficient, rapid and simple method by which connexin type(s) can be identified in mammalian tissue and cultured cells using endonuclease cleavage of RT-PCR products generated from "multi primers" (sense primer, degenerate oligonucleotide corresponding to a region of the first extracellular domain; antisense primer, degenerate oligonucleotide complementary to the second extracellular domain) that amplify the cytoplasmic loop regions of all known connexins except Cx36. In addition, we provide sequence information on RT-PCR primers used in our laboratory to screen individual connexins and predictions of extension of the "multi primer" method to several human connexins.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Amplification of the MYCN gene in neuroblastomas is a potent biological marker of highly aggressive tumors, which are invariably fatal unless sound clinical management is applied. To determine the usefulness of semi-quantitative differential PCR (SQ-PCR) for accurate quantification of MYCN gene copy number, we evaluated the analytical performance of this method by comparing the results obtained with it for 101 tumor samples of neuroblastoma to that obtained by absolute and relative real-time PCR. Similar results were obtained for 100 (99%) samples, no significant difference was detected between the median log10 MYCN copy number (1.53 by SQ-PCR versus 1.55 by absolute real-time PCR), and the results of the two assays correlated closely (r = 0.8, Pearson correlation; P < 0.001). In the comparison of SQ-PCR and relative real-time PCR, SQ-PCR versus relative real-time PCR concordant results were found in 100 (99%) samples, no significant difference was found in median log10 MYCN copy number (1.53 by SQ-PCR versus 1.27 by relative real-time PCR), and the results of the two assays correlated closely (r = 0.8, Pearson correlation; P < 0.001). These findings indicate that the performance of SQ-PCR was comparable to that of real-time PCR for the amplification and quantification of MYCN copy number. Thus, SQ-PCR can be reliably used as an alternative assay in laboratories without facilities for real-time PCR.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Tesis (Doctora en Ciencias con Especialidad en Biotecnología) U.A.N.L. Facultad de Ciencias Biológicas, 2007.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A dengue é a mais importante doença viral transmitida por mosquitos, no que diz respeito à morbidade e mortalidade, que afeta os seres humanos. Este vírus é transmitido pelos vetores Aedes albopictus e Aedes aegypti, este último é o principal vetor nas Américas. O controle da doença se baseia na vigilância laboratorial e vigilância entomológica. A vigilância laboratorial visa aprimorar a capacidade do diagnóstico, detectando precocemente a circulação viral e monitorando os sorotipos circulantes. Dentro deste tipo de vigilância, a RT-PCR é um método bastante usado no diagnóstico da doença em humanos e mosquitos, porém, a má conservação do material pode comprometer a integridade do RNA e trazer resultados falso-negativos. O desenvolvimento de melhores métodos de vigilância do vírus dengue (DENV) em mosquitos é de grande valor para os programas de controle. Desta maneira, o presente projeto visou otimizar a técnica de RT-PCR Multiplex para detecção de DENV em amostras de Ae. aegypti infectadas artificialmente pelo vírus. Primers que amplificam uma região de 80 pb do gene rpL8 de mosquito foram desenhados no site Primer3 e avaliados na ferramenta online Multiple Primer Analyzer, junto com primers que amplificam os sorotipos DENV. Não houve competição de primers e foi observado bandas distintas no gel de agarose. Foi avaliado o efeito de diferentes formas de preservação do material genético das amostras (RNAlater®, freezer -80°C e nitrogênio líquido) por 7 dias, onde não houve diferenças significativas em relação à integridade do RNA. O efeito de diferentes formas de extração de RNA (Kit da QIAGEN® , TRIzol® e Chomczymski-Sacchi) também foi avaliado e o método ChomczymskiSacchi obteve o melhor desempenho. A otimização desta técnica permitirá uma maior confiabilidade nos resultados, já que além da detecção dos sorotipos, haverá uma confirmação da qualidade do RNA, aprimorando a capacidade do diagnóstico e auxiliando a prevenção e controle da transmissão da dengue.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

TMV was tried to recover from a variety of branded cigarettes and cigars. Tobacco from six different brands of cigarettes and cigar were processed and reverse transcriptase polymerase chain reaction was employed for the detection of TMV. RTPCR confirmed the presence of TMV in tobacco from one brand of cigarette and one brand of cigar. Bean plants (Phaseolus vulgaris) were inoculated manually with tobacco sap of cigarettes resulting in the production of localized disease lesions. Together, these results showed that tobacco used to make cigarettes and cigars can function as an effective disease vector, potentially aiding the movement of infectious TMV between countries. This is an important finding prompting a need to test smoking tobacco for other virus particles that infect tobacco plants and survive processing as well as considering biosecurity measures to limit virus transmission

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Current knowledge of the pathogenic hantavirus indicates that wild rodents are its primary natural reservoir. Specific primers to detect the presence of viral genomes were developed using an SYBR-Green-based real-time RT-PCR protocol. One hundred sixty-four rodents native to the Atlantic Forest biome were captured in So Paulo State, Brazil, and their tissues were tested. The presence of hantavirus RNA was detected in sixteen rodents: three specimens of Akodon montensis, three of Akodon cursor, two of Necromys lasiurus, one of Juliomys sp., one of Thaptomys nigrita, five of Oligoryzomys nigripes, and one of Oryzomys sp. This SYBR Green real-time RT-PCR method for detection of hantavirus may be useful for surveying hantaviruses in Brazil.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Aim: To develop a TaqMan probe-based, highly sensitive and specific quantitative PCR (qPCR) assay for the detection and quantification of Mycoplasma suis in the blood of pigs. Methods and Results: Primers and probes specific to Myc. suis 16S rRNA gene were designed. The qPCR assay`s specificity, detection limit, intra- and inter-assay variability were evaluated and its performance was compared with a Myc. suis conventional PCR assay (cPCR). Blood of two experimentally infected pigs, 40 Indiana pigs, 40 Brazilian sows and 28 peccaries were tested. The assay detected as few as ten copies of Myc. suis plasmids and was 100-fold more sensitive than the cPCR. No cross-reactivity with nontarget pig mycoplasmas was observed. An average of 1.62 x 10(11) and 2.75 x 10(8) target copies ml(-1) of blood were detected in the acutely and chronically infected pigs, respectively. Three (7.5%) pigs and 32 (80.0%) sows were positive while all peccaries were negative for Myc. suis. Conclusion: The developed qPCR assay is highly sensitive and specific for Myc. suis detection and quantification. Significance and Impact of the Study: TaqMan qPCR is an accurate and quick test for detection of Myc. suis infected pigs, which can be used on varied instrumentation platforms.