943 resultados para Promoter Sequences
Resumo:
The suppressor of Hairy-wing [su(Hw)] protein exerts a polar effect on gene expression by repressing the function of transcriptional enhancers located distally from the promoter with respect to the location of su(Hw) binding sequences. The directionality of this effect suggests that the su(Hw) protein specifically interferes with the basic mechanism of enhancer action. Moreover, mutations in modifier of mdg4 [mod(mdg4)] result in the repression of expression of a gene when the su(Hw) protein is bound to sequences in the copy of this gene located in the homologous chromosome. This effect is dependent on the presence of the su(Hw) binding region from the gypsy retrotransposon in at least one of the chromosomes and is enhanced by the presence of additional gypsy sequences in the other homology. This phenomenon is inhibited by chromosomal rearrangements that disrupt pairing, suggesting that close apposition between the two copies of the affected gene is important for trans repression of transcription. These results indicate that, in the absence of mod-(mdg4) product, the su(Hw) protein present in one chromosome can act in trans and inactivate enhancers located in the other homolog.
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.
Resumo:
The promoter regions of plant pararetroviruses direct transcription of the full-length viral genome into a pregenomic RNA that is an intermediate in the replication of the virus. It serves as template for reverse transcription and as polycistronic mRNA for translation to viral proteins. We have identified functional promoter elements in the intergenic region of the Cavendish isolate of Banana streak virus (BSV-Cav), a member of the genus Badnavirus. Potential binding sites for plant transcription factors were found both upstream and downstream of the transcription start site by homology search in the PLACE database of plant cis-acting elements. The functionality of these putative cis-acting elements was tested by constructing loss-of-function and regain-of-function mutant promoters whose activity was quantified in embryogenic sugarcane suspension cells. Four regions that are important for activity of the BSV-Cav promoter were identified: the region containing an as-l-like element, the region around-141 and down to -77, containing several putative transcription factor binding sites, the region including the CAAT-box, and the leader region. The results could help explain the high BSV-Cav promoter activity that was observed previously in transgenic sugarcane plants and give more insight into the plant cell-mediated replication of the viral genome in banana streak disease. (C) 2004 Elsevier B.V. All rights reserved.
Resumo:
We have evaluated T-DNA mediated plant promoter tagging, with a left-border-linked promoterless firefly luciferase (luc) construct, as a strategy for the isolation of novel plant promoters. In a population of approximately 300 transformed tobacco plants, IO lines showed LUC activity, including novel tissue-specific and developmental patterns of expression. One line, showing LUC activity only in the shoot and root apical meristems, was further characterised. Inverse PCR was used to amplify a 1.5 kb fragment of plant DNA flanking the single-copy T-DNA insertion in this line. With the exception of a 249 bp highly repetitive element, this sequence is present as a single copy in the tobacco genome, and is not homologous to any previously characterised DNA sequences. Sequence analysis revealed the presence of several motifs that may be involved in transcriptional regulation. Transgenic tobacco plants transformed with a transcriptional fusion of this putative promoter sequence to the beta-glucuronidase (uidA) reporter gene, showed GUS activity confined to the shoot tip and mature pollen. This promoter may be useful to direct the expression of genes controlling the transition to flowering, or genes to reduce losses due to pests and stresses damaging plant apical meristems.
Resumo:
The analysis of keratin 6 expression is complicated by the presence of multiple isoforms that are expressed constitutively in a number of internal stratified epithelia, in palmoplantar epidermis, and in the companion cell layer of the hair follicle. In addition, keratin 6 expression is inducible in interfollicular epidermis and the outer root sheath of the follicle, in response to wounding stimuli, phorbol esters, or retinoic acid. In order to establish the critical regions involved in the regulation of keratin 6a (the dominant isoform in mice), we generated transgenic mice with two different-sized mouse keratin 6a constructs containing either 1.3 kb or 0.12 kb of 5' flanking sequence linked to the lacZ reporter gene. Both constructs also contained the first intron and the 3' flanking sequence of mouse keratin 6a. Ectopic expression of either transgene was not observed. Double-label immunofluorescence analyses demonstrated expression of the reporter gene in keratin 6 expressing tissues, including the hair follicle, tongue, footpad, and nail bed, showing that both transgenes retained keratinocyte-specific expression. Quantitative analysis of beta -galactosidase activity verified that both the 1.3 and 0.12 kb keratin 6a promoter constructs produced similar levels of the reporter. Notably, both constructs were constitutively expressed in the outer root sheath and interfollicular epidermis in the absence of any activating stimulus, suggesting that they lack the regulatory elements that normally silence transcription in these cells. This study has revealed that a keratin 6a minigene contains critical cis elements that mediate tissue-specific expression and that the elements regulating keratin 6 induction lie distal to the 1.3 kb promoter region.
Resumo:
Molecular epidemiological data concerning the hepatitis B virus (HBV) in Chile are not known completely. Since the HBV genotype F is the most prevalent in the country, the goal of this study was to obtain full HBV genome sequences from patients infected chronically in order to determine their subgenotypes and the occurrence of resistance-associated mutations. Twenty-one serum samples from antiviral drug-naive patients with chronic hepatitis B were subjected to full-length PCR amplification, and both strands of the whole genomes were fully sequenced. Phylogenetic analyses were performed along with reference sequences available from GenBank (n = 290). The sequences were aligned using Clustal X and edited in the SE-AL software. Bayesian phylogenetic analyses were conducted by Markov Chain Monte Carlo simulations (MCMC) for 10 million generations in order to obtain the substitution tree using BEAST. The sequences were also analyzed for the presence of primary drug resistance mutations using CodonCode Aligner Software. The phylogenetic analyses indicated that all sequences were found to be the HBV subgenotype F1b, clustered into four different groups, suggesting that diverse lineages of this subgenotype may be circulating within this population of Chilean patients. J. Med. Virol. 83: 1530-1536, 2011. (C) 2011 Wiley-Liss, Inc.
Resumo:
Although ATM, the protein defective in ataxia-telangiectasia (A-T), is activated primarily by radiation, there is also evidence that expression of the protein can be regulated by both radiation and growth factors. Computer analysis of the ATM promoter proximal 700-bp sequence reveals a number of potentially important cis-regulatory sequences. Using nucleotide substitutions to delete putative functional elements in the promoter of ATM, we examined the importance of some of these sites for both the basal and the radiation-induced activity of the promoter. In lymphoblastoid cells, most of the mutations in transcription factor consensus sequences [Sp1(1), Sp1(2), Cre, Ets, Xre, gammaIre(2), a modified AP1 site (Fse), and GCF] reduced basal activity to various extents, whereas others [gammaIre(1), NF1, Myb] left basal activity unaffected. In human skin fibroblasts, results were generally the same, but the basal activity varied up to 8-fold in these and other cell lines. Radiation activated the promoter approximately 2.5-fold in serum-starved lymphoblastoid cells, reaching a maximum by 3 hr, and all mutated elements equally blocked this activation. Reduction in Sp1 and AP1 DNA binding activity by serum starvation was rapidly reversed by exposure of cells to radiation. This reduction was not evident in A-T cells, and the response to radiation was less marked. Data provided for interaction between ATM and Sp1 by protein binding and co-immunoprecipitation could explain the altered regulation of Sp1 in A-T cells. The data described here provide additional evidence that basal and radiation-induced regulation of the ATM promoter is under multifactorial control. (C) 2003 Wiley-Liss, Inc.
Resumo:
Introduction In Brazil, little data exist regarding the distribution of genotypes in relation to basal core promoter (BCP) and precore/core mutations among chronic hepatitis B virus (HBV) carriers from different regions of the country. The aim of this study was to identify HBV genotypes and the frequency of mutations at the BCP and precore/core region among the prevalent genotypes in chronic carriers from southern Brazil. Methods Nested-polymerase chain reaction (nested-PCR) products amplified from the S-polymerase gene, BCP and precore/core region from 54 samples were sequenced and analyzed. Results Phylogenetic analysis of the S-polymerase gene sequences showed that 66.7% (36/54) of the patients were infected with genotype D (D1, D2, D3), 25.9% (14/54) with genotype A (A1, A2), 5.6% (3/54) with subgenotype C2, and 2% (1/54) with genotype E. A comparison of virological characteristics showed significant differences between genotypes A, C and D. The comparison between HBeAg status and the G1896A stop codon mutation in patients with genotype D revealed a relationship between HBV G1896A precore mutants and genotype D and hepatitis B e antigen (HBeAg) seroconversion. Genotype D had a higher prevalence of the G1896A mutation and the presence of a thymine at position 1858. Genotype A was associated with a higher prevalence of the G1862T mutation and the presence of a cytosine at position 1858. Conclusions HBV genotype D (D3) is predominant in HBV chronic carriers from southern Brazil. The presence of mutations in the BCP and precore/core region was correlated with the HBV genotype and HBeAg negative status.
Resumo:
hilA gene promoter, component of the Salmonella Pathogenicity Island 1, has been found in Salmonella serovar Typhimurium, being important for the regulation of type III secretion apparatus genes. We detected hilA gene sequences in Salmonella serovars Typhi, Enteritidis, Choleraesuis, Paratyphi A and B, and Pullorum, by polymerase chain reaction (PCR) and hybridization techniques. The primers to carry out PCR were designed according to hilA sequence. A low stringency hybridization with the probe pVV441 (hilA open-reading-frame plasmid) was carried out. To find hilA gene sequences in other Salmonella sp. suggest that these serovars could have similar sequences of this kind of virulence genes.
Resumo:
The expression of a hybrid gene formed by the promoter region of the Xenopus laevis vitellogenin gene B1 and the CAT coding region is regulated by estrogen when the gene is transfected into hormone-responsive MCF-7 cells. Furthermore, the 5' flanking region of the gene B1 alone can confer inducibility to heterologous promoters, although to a varying extent depending on the promoter used. Deletion mapping of he vitellogenin hormone-responsive sequences revealed that a 13 bp element 5'-AGTCACTGTGACC-3' at position -334 is essential for estrogen inducibility. We have shown previously that this 13 bp element is present upstream of several liver-specific estrogen-inducible genes.
Resumo:
Leishmania (Sauroleishmania) tarentolae has biotechnological potential for use as live vaccine against visceral leishmaniasis and as a system for the over expression of eukaryotic proteins that possess accurate post-translational modifications. For both purposes, new systems for protein expression in this non-pathogenic protozoan are necessary. The ribosomal RNA promoter proved to be a stronger transcription driver since its use yielded increased levels of recombinant protein in organisms of both genera Trypanosoma or Leishmania. We have evaluated heterologous expression systems using vectors with two different polypyrimidine tracts in the splice acceptor site by measuring a reporter gene transcribed from L. tarentolae RNA polymerase I promoter. Our data indicate that the efficiency of chloramphenicol acetyl transferase expression changed drastically with homologous or heterologous sequences, depending on the polypyrimidine tract used in the construct and differences in size and/or distance from the AG dinucleotide. In relation to the promoter sequence the reporter expression was higher in heterologous lizard-infecting species than in the homologous L. tarentolae or in the mammalian-infecting L. (Leishmania) amazonensis.
Resumo:
The present study investigated the prevalence of mutations in the -550 (H/L) and -221 (X/Y) mannose-binding lectin (MBL) gene promoter regions and their impact on infection by human immunodeficiency virus 1 (HIV-1) in a population of 128 HIV-1 seropositive and 97 seronegative patients. The allele identification was performed through the sequence-specific primer polymerase chain reaction method, using primer sequences specific to each polymorphism. The evolution of the infection was evaluated through CD4+ T-lymphocyte counts and plasma viral load. The allele and haplotype frequencies among HIV-1-infected patients and seronegative healthy control patients did not show significant differences. CD4+ T-lymphocyte counts showed lower levels among seropositive patients carrying haplotypes LY, LX and HX, as compared to those carrying the HY haplotype. Mean plasma viral load was higher among seropositive patients with haplotypes LY, LX and HX than among those carrying the HY haplotype. When promoter and exon 1 mutations were matched, it was possible to identify a significantly higher viral load among HIV-1 infected individuals carrying haplotypes correlated to low serum levels of MBL. The current study shows that haplotypes related to medium and low MBL serum levels might directly influence the evolution of viral progression in patients. Therefore, it is suggested that the identification of haplotypes within the promoter region of the MBL gene among HIV-1 infected persons should be further evaluated as a prognostic tool for AIDS progression.
Resumo:
Peroxisome proliferator-activated receptor (PPARs) are members of the nuclear receptor superfamily. For transcriptional activation of their target genes, PPARs heterodimerize with the retinoid-X receptor (RXR). The convergence of the PPAR and RXR signaling pathways has been shown to have an important function in lipid metabolism. The promoter of the gene encoding the acyl-coenzyme-A oxidase (ACO), the rate-limiting enzyme in peroxisomal beta-oxidation of fatty acids, is a target site of PPAR action. In this study, we examined the role and the contribution of both cis-and trans-acting factors in the transcriptional regulation of this gene using transient transfections in insect cells. We identified several functional cis-acting elements present in the promoter of the ACO gene and established that PPAR-dependent as well as PPAR-independent mechanisms can activate the ACO promoter in these cells. We show that the PPAR/RXR heterodimer exerts its effect through two response elements within the ACO promoter, in synergy with the transcription factor Sp1 via five Sp1-binding sites. Furthermore, this functional interaction also occurs when Sp1 is co-expressed with PPAR or RXR alone, indicating that activation can occur independently of PPAR/RXR heterodimers.
Resumo:
We have studied the kinetics of RNA synthesis from the vaccinia virus 7,500-molecular-weight gene (7.5K gene) which is regulated by early and late promoters arranged in tandem. Unexpectedly, after a first burst of RNA synthesis early in infection, transcription was reactivated late in infection. Reactivation was not dependent on the location of the promoter in the genome or on the presence of the upstream late regulatory sequences. The mRNA synthesized from the reactivated promoter in the late phase had the same 5' and 3' ends as the molecules transcribed in the early phase. Interestingly, these molecules were efficiently translated despite the absence of the poly(A) leader characteristic of late mRNAs. Reactivation appears to be dependent on virus assembly since it is prevented by rifampin, a specific inhibitor of morphogenesis. Finally, analysis of various other early genes showed that reactivation is not unique to the 7.5K early promoter.
Resumo:
BACKGROUND New biomarkers are needed for the prognosis of advanced colorectal cancer, which remains incurable by conventional treatments. O6-methylguanine DNA methyltransferase (MGMT) methylation and protein expression have been related to colorectal cancer treatment failure and tumor progression. Moreover, the presence in these tumors of cancer stem cells, which are characterized by CD133 expression, has been associated with chemoresistance, radioresistance, metastasis, and local recurrence. The objective of this study was to determine the prognostic value of CD133 and MGMT and their possible interaction in colorectal cancer patients. METHODS MGMT and CD133 expression was analyzed by immunohistochemistry in 123 paraffin-embedded colorectal adenocarcinoma samples, obtaining the percentage staining and intensity. MGMT promoter methylation status was obtained by using bisulfite modification and methylation-specific PCR (MSP). These values were correlated with clinical data, including overall survival (OS), disease-free survival (DFS), tumor stage, and differentiation grade. RESULTS Low MGMT expression intensity was significantly correlated with shorter OS and was a prognostic factor independently of treatment and histopathological variables. High percentage of CD133 expression was significantly correlated with shorter DFS but was not an independent factor. Patients with low-intensity MGMT expression and ≥50% CD133 expression had the poorest DFS and OS outcomes. CONCLUSIONS Our results support the hypothesis that MGMT expression may be an OS biomarker as useful as tumor stage or differentiation grade and that CD133 expression may be a predictive biomarker of DFS. Thus, MGMT and CD133 may both be useful for determining the prognosis of colorectal cancer patients and to identify those requiring more aggressive adjuvant therapies. Future studies will be necessary to determine its clinical utility.