X-Ray Diffraction Studies of Soils and Soil Stabilizers, HR-106, 1965

The two goals of this project stated in the Proposal were: (1) study lime diffusion in clayey soils, and (2) find the role of MgO in soil-dolomitic lime stabilization. Because of the practice significance of these goals we temporarily overstaffed this project, giving somewhat a "crash" program. As a result, proposed work was finished up early (as were the funds), and more important, some of the findings were early enough and of sufficient merit to put into field trials in the Fall of 1964. The work now being completed and the funds all being expended, this Final Report is therefore submitted before the anticipated project termination date.

Effect of CA-Montmorillonite Expansion on X-Ray Diffraction Intensities, Progress Report, HR-111, 1966

The most abundant clay mineral group in Iowa soils is montmorillonite, most commonly calcium-saturated (Hanway et al, 1960). The calcium montmorillonite-water system was therefore selected for detailed X-ray study. Montmorillonite is unusual among minerals in that it has an expanding lattice in the c direction. That is, upon wetting with water, the individual silicate layers separate to allow entry of water, and the mineral expands. Characteristics of this expansion are readily studied by means of X-ray diffraction: the X-ray diffraction angle gives the average layer-to-layer "d001" spacing for any given moisture condition; the sharpness of the diffraction peak is a measure of uniformity of the d001 spacing; and the intensity of the peak relates to uniformity of the d001 spacing and in addition to the electron density distribution within the repeating elements. The latter is embodied in the "structure factor".

Quantitative X-Ray Diffraction Measurements by Fast Scanning, HR-111

Two goals were pursued in this research: first, to evaluate statistically some effects of sample preparation and instrument geometry on reproducibility of X-ray diffraction intensity data; and second, to develop a procedure for finding minimum peak and background counting times for a desired level of accuracy. The ratio of calcite to dolomite in limestones was determined in trials. Ultra-fine wet grinding of the limestone in porcelain impact type ball mill gave most consistent X-ray results, but caused considerable line broadening, and peaks were best measured on an area count basis. Sample spinning reduced variance about one third, and a coarse beam-medium detector slit arrangement was found to be best. An equation is developed relating coefficient of variation of a count ratio to peak and background counts. By use of the equation or graphs the minimum coefficient of variation is predicted from one fast scan, and the number and optimum arrangement of additional counting periods to reduce variation to a desired limit may be obtained. The calculated coefficient is the maximum which may be attributed to the counting statistic but does not include experimental deviations.

Alterations of Na, K and Rb concentrations in Mycenaean pottery and a proposed explanation using X-ray diffraction

One of the most important reference groups for Mycenaean pottery is the Mycenae/Berbati (MB). In several studies, a second group has been identified (MBKR). The chemical compositions were similar to MB, but with important differences in the Na, K and Rb contents. The present study suggests that these differences are due to selective alteration and contamination processes that are indirectly determined by the original firing temperature. Therefore, groups MB and MBKR should be considered as a single reference group.

Nanoporous materials: pillared clays and regular silicas as an example of synthesis and their porosity characterization by X-ray diffraction

Because of their practical applications, porous materials attract the attention of undergraduate students in a way that can be used to teach techniques and concepts in various chemistry disciplines. Porous materials are studied in various chemistry disciplines, including inorganic, organic, and physical chemistry. In this work, the syntheses of a microporous material and a mesoporous material are presented. The porosity of the synthesized materials is characterized by X-ray diffraction analysis. We show that this technique can be used to determine the pore dimensions of the synthesized materials.

X-ray diffraction studies of muscle : observations on the anterior byssus retractor muscle of Mytilus edulis and the insect flight muscle from Sarcophaga bullata

The interfilament spacing of the anterior byssus retractor muscle from Mytilus edulis was studied as the muscle was extended. It was found that variations in this spacing were very small and consistent with the hypothesis that the interfilament spacing was independent of the extension of the muscle. It was observed that the interfilament spacing was dependent on the osmolarity of the bathing medium. In concentrated solutions of the artificial seawater, the interfilament spacing decreased; while in dilute solutions of artificial seawater, it was observed that the interfilament spacing was increasing. X-ray diffraction patterns were obtained from fresh, and glutaraldehyde fixed, specimens of insect flight muscle from Sarcophaga bullata. There patterns were in general agreement with previous X-ray diffraction studies of insect flight muscle. A reflexion G at 93A was observed and interpreted as arising from diffraction in the mitochondria. Specimens of dried insect flight muscle produced a diffraction pattern consisting of arc and ring reflexions. This was interpreted as suggesting an ordered arrangement of cristae, in the mitochondria from these muscles.

X-ray diffraction of a gram-negative bacterial membrane mimetic

This thesis applies x-ray diffraction to measure he membrane structure of lipopolysaccharides and to develop a better model of a LPS bacterial melilbrane that can be used for biophysical research on antibiotics that attack cell membranes. \iVe ha'e Inodified the Physics department x-ray machine for use 3.'3 a thin film diffractometer, and have lesigned a new temperature and relative humidity controlled sample cell.\Ve tested the sample eel: by measuring the one-dimensional electron density profiles of bilayers of pope with 0%, 1%, 1G :VcJ, and 100% by weight lipo-polysaccharide from Pse'udo'lTwna aeTuginosa. Background VVe now know that traditional p,ntibiotics ,I,re losing their effectiveness against ever-evolving bacteria. This is because traditional antibiotic: work against specific targets within the bacterial cell, and with genetic mutations over time, themtibiotic no longer works. One possible solution are antimicrobial peptides. These are short proteins that are part of the immune systems of many animals, and some of them attack bacteria directly at the membrane of the cell, causing the bacterium to rupture and die. Since the membranes of most bacteria share common structural features, and these featuret, are unlikely to evolve very much, these peptides should effectively kill many types of bacteria wi Lhout much evolved resistance. But why do these peptides kill bacterial cel: '3 , but not the cells of the host animal? For gramnegative bacteria, the most likely reason is that t Ileir outer membrane is made of lipopolysaccharides (LPS), which is very different from an animal :;ell membrane. Up to now, what we knovv about how these peptides work was likely done with r !10spholipid models of animal cell membranes, and not with the more complex lipopolysa,echaricies, If we want to make better pepticies, ones that we can use to fight all types of infection, we need a more accurate molecular picture of how they \vork. This will hopefully be one step forward to the ( esign of better treatments for bacterial infections.

Preparation and properties of gallaborane, GaBH6: structure of the gaseous molecule H2Ga(μ-H)2BH2 as determined by vibrational, electron diffraction, and ab initio studies, and structure of the crystalline solid at 110 K as determined by x-ray diffraction``

Gallaborane (GaBH6, 1), synthesized by the metathesis of LiBH4 with [H2GaCl]n at ca. 250 K, has been characterized by chemical analysis and by its IR and 1H and 11B NMR spectra. The IR spectrum of the vapor at low pressure implies the presence of only one species, viz. H2Ga(μ-H)2BH2, with a diborane-like structure conforming to C2v symmetry. The structure of this molecule has been determined by gas-phase electron diffraction (GED) measurements afforced by the results of ab initio molecular orbital calculations. Hence the principal distances (rα in Å) and angles ( α in deg) are as follows: r(Ga•••B), 2.197(3); r(Ga−Ht), 1.555(6); r(Ga−Hb), 1.800(6); r(B−Ht), 1.189(7); r(B−Hb), 1.286(7); Hb−Ga−Hb, 71.6(4); and Hb−B−Hb, 110.0(5) (t = terminal, b = bridging). Aggregation of the molecules occurs in the condensed phases. X-ray crystallographic studies of a single crystal at 110 K reveal a polymeric network with helical chains made up of alternating pseudotetrahedral GaH4 and BH4 units linked through single hydrogen bridges; the average Ga•••B distance is now 2.473(7) Å. The compound decomposes in the condensed phases at temperatures exceeding ca. 240 K with the formation of elemental Ga and H2 and B2H6. The reactions with NH3, Me3N, and Me3P are also described.

Overproduction, purification and preliminary X-ray diffraction analysis of YncE, an iron-regulated Sec-dependent periplasmic protein from Escherichia coli

The yncE gene of Escherichia coli encodes a predicted periplasmic protein of unknown function. The gene is de-repressed under iron restriction through the action of the global iron regulator Fur. This suggests a role in iron acquisition, which is supported by the presence of the adjacent yncD gene encoding a potential TonB-dependent outer-membrane transporter. Here, the preliminary crystallographic structure of YncE is reported, revealing that it consists of a seven-bladed beta-propeller which resembles the corresponding domain of the `surface-layer protein' of Methanosarcina mazei. A full structure determination is under way in order to provide insight into the function of this protein.

Preliminary X-ray diffraction analysis of YcdB from Escherichia coli: a novel haem-containing and Tat-secreted periplasmic protein with a potential role in iron transport

YcdB is a periplasmic haem-containing protein from Escherichia coli that has a potential role in iron transport. It is currently the only reported haem-containing Tat-secreted substrate. Here, the overexpression, purification, crystallization and structure determination at 2.0 angstrom resolution are reported for the apo form of the protein. The apo-YcdB structure resembles those of members of the haem-dependent peroxidase family and thus confirms that YcdB is also a member of this family. Haem-soaking experiments with preformed apo-YcdB crystals have been optimized to successfully generate haem-containing YcdB crystals that diffract to 2.9 angstrom. Completion of model building and structure refinement are under way.

A pressure-jump time-resolved x-ray diffraction study of cubic-cubic transition kinetics in monoolein

In the past two decades, the geometric pathways involved in the transformations between inverse bicontinuous cubic phases in amphiphilic systems have been extensively theoretically modeled. However, little experimental data exists on the cubic-cubic transformation in pure lipid systems. We have used pressure-jump time-resolved X-ray diffraction to investigate the transition between the gyroid Q(II)(G) and double-diamond Q(II)(D) phases in mixtures of 1-monoolein in 30 wt% water. We find for this system that the cubic-cubic transition occurs without any detectable intermediate structures. In addition, we have determined the kinetics of the transition, in both the forward and reverse directions, as a function of pressure-jump amplitude, temperature, and water content. A recently developed model allows (at least in principle) the calculation of the activation energy for lipid phase transitions from such data. The analysis is applicable only if kinetic reproducibility is achieved, at least within one sample, and achievement of such kinetic reproducibility is shown here, by carrying out prolonged pressure-cycling. The rate of transformation shows clear and consistent trends with pressure-jump amplitude, temperature, and water content, all of which are shown to be in agreement with the effect of the shift in the position of the cubic-cubic phase boundary following a change in the thermodynamic parameters.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Structure of single-wall peptide nanotubes: in situ flow aligning X-ray diffraction

The structure of single wall peptide nanotubes is presented for the model surfactant-like peptide A6K. Capillary flow alignment of a sample in the nematic phase at high concentration in water leads to oriented X-ray diffraction patterns. Analysis of these, accompanied by molecular dynamics simulations, suggests the favourable self-assembly of antiparallel peptide dimers into beta-sheet ribbons that wrap helically to form the nanotube wall.

Preliminary X-ray diffraction analysis of YqjH from Escherichia coli: a putative cytoplasmic ferri-siderophore reductase

YqjH is a cytoplasmic FAD-containing protein from Escherichia coli; based on homology to ViuB of Vibrio cholerae, it potentially acts as a ferri-siderophore reductase. This work describes its overexpression, purification, crystallization and structure solution at 3.0 A resolution. YqjH shares high sequence similarity with a number of known siderophore-interacting proteins and its structure was solved by molecular replacement using the siderophore-interacting protein from Shewanella putrefaciens as the search model. The YqjH structure resembles those of other members of the NAD(P)H:flavin oxidoreductase superfamily.

The biomechanics of amnion rupture: an X-ray diffraction study

Pre-term birth is the leading cause of perinatal and neonatal mortality, 40% of which are attributed to the pre-term premature rupture of amnion. Rupture of amnion is thought to be associated with a corresponding decrease in the extracellular collagen content and/or increase in collagenase activity. However, there is very little information concerning the detailed organisation of fibrillar collagen in amnion and how this might influence rupture. Here we identify a loss of lattice like arrangement in collagen organisation from areas near to the rupture site, and present a 9% increase in fibril spacing and a 50% decrease in fibrillar organisation using quantitative measurements gained by transmission electron microscopy and the novel application of synchrotron X-ray diffraction. These data provide an accurate insight into the biomechanical process of amnion rupture and highlight X-ray diffraction as a new and powerful tool in our understanding of this process.