967 resultados para Human Element


Relevância:

40.00% 40.00%

Publicador:

Resumo:

The TATA box-binding protein (TBP) is required by all three eukaryotic RNA polymerases for correct initiation of transcription of ribosomal, messenger, small nuclear, and transfer RNAs. The cocrystal structure of the C-terminal/core region of human TBP complexed with the TATA element of the adenovirus major late promoter has been determined at 1.9 angstroms resolution. Structural and functional analyses of the protein-DNA complex are presented, with a detailed comparison to our 1.9-angstroms resolution structure of Arabidopsis thaliana TBP2 bound to the same TATA box.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Rev-erb alpha belongs to the nuclear receptor superfamily, which contains receptors for steroids, thyroid hormones, retinoic acid, and vitamin D, as well as "orphan" receptors. No ligand has been found for Rev-erb alpha to date, making it one of these orphan receptors. Similar to some other orphan receptors, Rev-erb alpha has been shown to bind DNA as a monomer on a specific sequence called a Rev-erb alpah responsive element (RevRE), but its transcriptional activity remains unclear. In this paper, we characterize a functional RevRE located in the human Rev-erb alpha promoter itself. We also present evidence that (i) Rev-erb alpha mediates transcriptional repression of its own promoter in vitro, (ii) this repressing effect strictly depends on the binding of Rev-erb alpha to its responsive element and is transferable to a heterologous promoter; and (iii) Rev-erb alpha binds to this responsive sequence as a homodimer.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The human immunodeficiency virus type 1 (HIV-1) Rev protein is required for nuclear export of late HIV-1 mRNAs. This function is dependent on the mutationally defined Rev activation domain, which also forms a potent nuclear export signal. Transcription factor IIIA (TFIIIA) binds to 5S rRNA transcripts and this interaction has been proposed to play a role in the efficient nuclear export of 5S rRNA in amphibian oocytes. Here it is reported that amphibian TFIIIA proteins contain a sequence element with homology to the Rev activation domain that effectively substitutes for this domain in inducing the nuclear export of late HIV-1 mRNAs. It is further demonstrated that this TFIIIA sequence element functions as a protein nuclear export signal in both human cells and frog oocytes. Thus, this shared protein motif may play an analogous role in mediating the nuclear export of both late HIV-1 RNAs and 5S rRNA transcripts.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

In human immunodeficiency virus type 1-infected cells, the efficient expression of viral proteins from unspliced and singly spliced RNAs is dependent on two factors: the presence in the cell of the viral protein Rev and the presence in the viral RNA of the Rev-responsive element (RRE). We show here that the HIV-1 Rev/RRE system can increase the expression of avian leukosis virus (ALV) structural proteins in mammalian cells (D-17 canine osteosarcoma) and promote the release of mature ALV virions from these cells. In this system, the Rev/RRE interaction appears to facilitate the export of full-length unspliced ALV RNA from the nucleus to the cytoplasm, allowing increased production of the ALV structural proteins. Gag protein is produced in the cytoplasm of the ALV-transfected cells even in the absence of a Rev/RRE interaction. However, a functional Rev/RRE interaction increases the amount of Gag present intracellularly and, more strikingly, results in the release of mature ALV particles into the supernatant. RCAS virus containing an RRE is replication-competent in chicken embryo fibroblasts; however, we have been unable to determine whether the particles produced in D-17 cells are as infectious as the particles produced in chicken embryo fibroblasts.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Human peripheral blood lymphocytes (PBLs) were transduced with a number of recombinant retroviruses including RRz2, an LNL6-based virus with a ribozyme targeted to the human immunodeficiency virus (HIV) tat gene transcript inserted within the 3' region of the neomycin-resistance gene; RASH5, and LNHL-based virus containing an antisense sequence to the 5' leader region of HIV-1 downstream of the human cytomegalovirus promoter; and R20TAR, an LXSN-based virus with 20 tandem copies of the HIV-1 trans-activation response element sequence driven by the Moloney murine leukemia virus long terminal repeat. After G418 selection, transduced PBLs were challenged with the HIV-1 laboratory strain IIIB and a primary clinical isolate of HIV-1, 82H. Results showed that PBLs from different donors could be transduced and that this conferred resistance to HIV-1 infection. For each of the constructs, a reduction of approximately 70% in p24 antigen level relative to the corresponding control-vector-transduced PBLs was observed. Molecular analyses showed constitutive expression of all the transduced genes from the retroviral long terminal repeat, but no detectable transcript was seen from the internal human cytomegalovirus transcript was seen from the internal human cytomegalovirus promoter for the antisense construct. Transduction of, and consequent transgene expression in, PBLs did not impact on the surface expression of either CD4+/CD8+ (measured by flow cytometry) or on cell doubling time (examined by [3H]thymidine uptake). These results indicate the potential utility of these anti-HIV-1 gene therapeutic agents and show the preclinical value of this PBL assay system.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The trans-activation response element (TAR) found near the 5' end of the viral RNA of the human immunodeficiency virus contains a 3-nt bulge that is recognized by the virally encoded trans-activator protein (Tat), an important mediator of transcriptional activation. Insertion of the TAR bulge into double-stranded RNA is known to result in reduced electrophoretic mobility, suggestive of a bulge-induced bend. Furthermore, NMR studies indicate that Arg causes a change in the structure of the TAR bulge, possibly reducing the bulge angle. However, neither of these effects has been quantified, nor have they been compared with the effects of the TAR-Tat interaction. Recently, an approach for the quantification of bulge-induced bends has been described in which hydrodynamic measurements, employing the method of transient electric birefringence, have yielded precise estimates for the angles of a series of RNA bulges, with the angles ranging from 7 degrees to 93 degrees. In the current study, transient electric birefringence measurements indicate that the TAR bulge introduces a bend of 50 degrees +/- 5 degrees in the absence of Mg2+. Addition of Arg leads to essentially complete straightening of the helix (to < 10 degrees) with a transition midpoint in the 1 mM range. This transition demonstrates specificity for the TAR bulge: no comparable transition was observed for U3 or A3 (control) bulges with differing flanking sequences. An essentially identical structural transition is observed for the Tat-derived peptide, although the transition midpoint for the latter is near 1 microM. Finally, low concentrations of Mg2+ alone reduce the bend angle by approximately 50%, consistent with the effects of Mg2+ on other pyrimidine bulges. This last observation is important in view of the fact that most previous structural/binding studies were performed in the absence of Mg2+.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Finite element analysis is a useful tool in understanding how the accommodation system of the eye works. Further to simpler FEA models that have been used hitherto, this paper describes a sensitivity study which aims to understand which parameters of the crystalline lens are key to developing an accurate model of the accommodation system. A number of lens models were created, allowing the mechanical properties, internal structure and outer geometry to be varied. These models were then spun about their axes, and the deformations determined. The results showed the mechanical properties are the critical parameters, with the internal structure secondary. Further research is needed to fully understand how the internal structure and properties interact to affect lens deformation.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The human accommodation system has been extensively examined for over a century, with a particular focus on trying to understand the mechanisms that lead to the loss of accommodative ability with age (Presbyopia). The accommodative process, along with the potential causes of presbyopia, are disputed; hindering efforts to develop methods of restoring accommodation in the presbyopic eye. One method that can be used to provide insight into this complex area is Finite Element Analysis (FEA). The effectiveness of FEA in modelling the accommodative process has been illustrated by a number of accommodative FEA models developed to date. However, there have been limitations to these previous models; principally due to the variation in data on the geometry of the accommodative components, combined with sparse measurements of their material properties. Despite advances in available data, continued oversimplification has occurred in the modelling of the crystalline lens structure and the zonular fibres that surround the lens. A new accommodation model was proposed by the author that aims to eliminate these limitations. A novel representation of the zonular structure was developed, combined with updated lens and capsule modelling methods. The model has been designed to be adaptable so that a range of different age accommodation systems can be modelled, allowing the age related changes that occur to be simulated. The new modelling methods were validated by comparing the changes induced within the model to available in vivo data, leading to the definition of three different age models. These were used in an extended sensitivity study on age related changes, where individual parameters were altered to investigate their effect on the accommodative process. The material properties were found to have the largest impact on the decline in accommodative ability, in particular compared to changes in ciliary body movement or zonular structure. Novel data on the importance of the capsule stiffness and thickness was also established. The new model detailed within this thesis provides further insight into the accommodation mechanism, as well as a foundation for future, more detailed investigations into accommodation, presbyopia and accommodative restoration techniques.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Introduction: Bone mineral density (BMD) is currently the preferred surrogate for bone strength in clinical practice. Finite element analysis (FEA) is a computer simulation technique that can predict the deformation of a structure when a load is applied, providing a measure of stiffness (Nmm−1). Finite element analysis of X-ray images (3D-FEXI) is a FEA technique whose analysis is derived froma single 2D radiographic image. Methods: 18 excised human femora had previously been quantitative computed tomography scanned, from which 2D BMD-equivalent radiographic images were derived, and mechanically tested to failure in a stance-loading configuration. A 3D proximal femur shape was generated from each 2D radiographic image and used to construct 3D-FEA models. Results: The coefficient of determination (R2%) to predict failure load was 54.5% for BMD and 80.4% for 3D-FEXI. Conclusions: This ex vivo study demonstrates that 3D-FEXI derived from a conventional 2D radiographic image has the potential to significantly increase the accuracy of failure load assessment of the proximal femur compared with that currently achieved with BMD. This approach may be readily extended to routine clinical BMD images derived by dual energy X-ray absorptiometry. Crown Copyright © 2009 Published by Elsevier Ltd on behalf of IPEM. All rights reserved

Relevância:

30.00% 30.00%

Publicador:

Resumo:

This paper describes the current status of a program to develop an automated forced landing system for a fixed-wing Unmanned Aerial Vehicle (UAV). This automated system seeks to emulate human pilot thought processes when planning for and conducting an engine-off emergency landing. Firstly, a path planning algorithm that extends Dubins curves to 3D space is presented. This planning element is then combined with a nonlinear guidance and control logic, and simulated test results demonstrate the robustness of this approach to strong winds during a glided descent. The average path deviation errors incurred are comparable to or even better than that of manned, powered aircraft. Secondly, a study into suitable multi-criteria decision making approaches and the problems that confront the decision-maker is presented. From this study, it is believed that decision processes that utilize human expert knowledge and fuzzy logic reasoning are most suited to the problem at hand, and further investigations will be conducted to identify the particular technique/s to be implemented in simulations and field tests. The automated UAV forced landing approach presented in this paper is promising, and will allow the progression of this technology from the development and simulation stages through to a prototype system

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Osteoporosis is a disease characterized by low bone mass and micro-architectural deterioration of bone tissue, with a consequent increase in bone fragility and susceptibility to fracture. Osteoporosis affects over 200 million people worldwide, with an estimated 1.5 million fractures annually in the United States alone, and with attendant costs exceeding $10 billion dollars per annum. Osteoporosis reduces bone density through a series of structural changes to the honeycomb-like trabecular bone structure (micro-structure). The reduced bone density, coupled with the microstructural changes, results in significant loss of bone strength and increased fracture risk. Vertebral compression fractures are the most common type of osteoporotic fracture and are associated with pain, increased thoracic curvature, reduced mobility, and difficulty with self care. Surgical interventions, such as kyphoplasty or vertebroplasty, are used to treat osteoporotic vertebral fractures by restoring vertebral stability and alleviating pain. These minimally invasive procedures involve injecting bone cement into the fractured vertebrae. The techniques are still relatively new and while initial results are promising, with the procedures relieving pain in 70-95% of cases, medium-term investigations are now indicating an increased risk of adjacent level fracture following the procedure. With the aging population, understanding and treatment of osteoporosis is an increasingly important public health issue in developed Western countries. The aim of this study was to investigate the biomechanics of spinal osteoporosis and osteoporotic vertebral compression fractures by developing multi-scale computational, Finite Element (FE) models of both healthy and osteoporotic vertebral bodies. The multi-scale approach included the overall vertebral body anatomy, as well as a detailed representation of the internal trabecular microstructure. This novel, multi-scale approach overcame limitations of previous investigations by allowing simultaneous investigation of the mechanics of the trabecular micro-structure as well as overall vertebral body mechanics. The models were used to simulate the progression of osteoporosis, the effect of different loading conditions on vertebral strength and stiffness, and the effects of vertebroplasty on vertebral and trabecular mechanics. The model development process began with the development of an individual trabecular strut model using 3D beam elements, which was used as the building block for lattice-type, structural trabecular bone models, which were in turn incorporated into the vertebral body models. At each stage of model development, model predictions were compared to analytical solutions and in-vitro data from existing literature. The incremental process provided confidence in the predictions of each model before incorporation into the overall vertebral body model. The trabecular bone model, vertebral body model and vertebroplasty models were validated against in-vitro data from a series of compression tests performed using human cadaveric vertebral bodies. Firstly, trabecular bone samples were acquired and morphological parameters for each sample were measured using high resolution micro-computed tomography (CT). Apparent mechanical properties for each sample were then determined using uni-axial compression tests. Bone tissue properties were inversely determined using voxel-based FE models based on the micro-CT data. Specimen specific trabecular bone models were developed and the predicted apparent stiffness and strength were compared to the experimentally measured apparent stiffness and strength of the corresponding specimen. Following the trabecular specimen tests, a series of 12 whole cadaveric vertebrae were then divided into treated and non-treated groups and vertebroplasty performed on the specimens of the treated group. The vertebrae in both groups underwent clinical-CT scanning and destructive uniaxial compression testing. Specimen specific FE vertebral body models were developed and the predicted mechanical response compared to the experimentally measured responses. The validation process demonstrated that the multi-scale FE models comprising a lattice network of beam elements were able to accurately capture the failure mechanics of trabecular bone; and a trabecular core represented with beam elements enclosed in a layer of shell elements to represent the cortical shell was able to adequately represent the failure mechanics of intact vertebral bodies with varying degrees of osteoporosis. Following model development and validation, the models were used to investigate the effects of progressive osteoporosis on vertebral body mechanics and trabecular bone mechanics. These simulations showed that overall failure of the osteoporotic vertebral body is initiated by failure of the trabecular core, and the failure mechanism of the trabeculae varies with the progression of osteoporosis; from tissue yield in healthy trabecular bone, to failure due to instability (buckling) in osteoporotic bone with its thinner trabecular struts. The mechanical response of the vertebral body under load is highly dependent on the ability of the endplates to deform to transmit the load to the underlying trabecular bone. The ability of the endplate to evenly transfer the load through the core diminishes with osteoporosis. Investigation into the effect of different loading conditions on the vertebral body found that, because the trabecular bone structural changes which occur in osteoporosis result in a structure that is highly aligned with the loading direction, the vertebral body is consequently less able to withstand non-uniform loading states such as occurs in forward flexion. Changes in vertebral body loading due to disc degeneration were simulated, but proved to have little effect on osteoporotic vertebra mechanics. Conversely, differences in vertebral body loading between simulated invivo (uniform endplate pressure) and in-vitro conditions (where the vertebral endplates are rigidly cemented) had a dramatic effect on the predicted vertebral mechanics. This investigation suggested that in-vitro loading using bone cement potting of both endplates has major limitations in its ability to represent vertebral body mechanics in-vivo. And lastly, FE investigation into the biomechanical effect of vertebroplasty was performed. The results of this investigation demonstrated that the effect of vertebroplasty on overall vertebra mechanics is strongly governed by the cement distribution achieved within the trabecular core. In agreement with a recent study, the models predicted that vertebroplasty cement distributions which do not form one continuous mass which contacts both endplates have little effect on vertebral body stiffness or strength. In summary, this work presents the development of a novel, multi-scale Finite Element model of the osteoporotic vertebral body, which provides a powerful new tool for investigating the mechanics of osteoporotic vertebral compression fractures at the trabecular bone micro-structural level, and at the vertebral body level.