Upregulation of class I major histocompatibility complex antigens by interferon gamma is necessary for T-cell-mediated elimination of recombinant adenovirus-infected hepatocytes in vivo.

Recombinant adenoviruses are attractive vehicles for liver-directed gene therapy because of the high efficiency with which they transfer genes to hepatocytes in vivo. First generation recombinant adenoviruses deleted of E1 sequences also express recombinant and early and late viral genes, which lead to development of destructive cellular immune responses. Previous studies indicated that class I major histocompatibility complex (MHC)-restricted cytotoxic T lymphocytes (CTLs) play a major role in eliminating virus-infected cells. The present studies utilize mouse models to evaluate the role of T-helper cells in the primary response to adenovirus-mediated gene transfer to the liver. In vivo ablation of CD4+ cells or interferon gamma (IFN-gamma) was sufficient to prevent the elimination of adenovirus-transduced hepatocytes, despite the induction of a measurable CTL response. Mobilization of an effective TH1 response as measured by in vitro proliferation assays was associated with substantial upregulation of MHC class I expression, an effect that was prevented in IFN-gamma-deficient animals. These results suggest that elimination of virus-infected hepatocytes in a primary exposure to recombinant adenovirus requires both induction of antigen-specific CTLs as well as sensitization of the target cell by TH1-mediated activation of MHC class I expression.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Logical Modeling and Dynamical Analysis of Cellular Networks

The logical (or logic) formalism is increasingly used to model regulatory and signaling networks. Complementing these applications, several groups contributed various methods and tools to support the definition and analysis of logical models. After an introduction to the logical modeling framework and to several of its variants, we review here a number of recent methodological advances to ease the analysis of large and intricate networks. In particular, we survey approaches to determine model attractors and their reachability properties, to assess the dynamical impact of variations of external signals, and to consistently reduce large models. To illustrate these developments, we further consider several published logical models for two important biological processes, namely the differentiation of T helper cells and the control of mammalian cell cycle.

Estudo da resposta Th17 no transplante renal alogênico: contribuição do eixo quimiotático CCR6/CCL20 e dos polimorfismos gênicos em IL17A e IL17RA

Kidney transplantation is the best treatment for patients who have lost kidney function. Renal transplant patients require accurate immunosuppressive drugs to prevent rejection. In this process T helper cells of the immune system perform key role in the immune response to the graft, and recently the Th17 cells has been investigated by production of IL-17 potent proinflammatory cytokine whose role in the rejection has also been described. Increased of Th17 cell expression has an important association with the development of rejection in renal microenvironment, however the likely mechanism is not well understood. This study aimed to evaluate the Th17 response from the influence of the chemotactic axis CCR6/CCL20 and genetic variants in IL-17 and IL-17RA. We conducted a case-control study involving 148 patients transplanted at the University Hospital Onofre Lopes/UFRN in which assessed by immunohistochemistry protein expression of IL-17 and chemokines CCR6/CCL20 and by PCR-RFLP genetic variants in IL17A and IL17RA. Our results showed no influence of genetic polymorphisms on the outcome of the graft or the protein expression of IL-17. In renal graft microenvironment found several sources producing IL-17: tubular epithelial cells, glomerular cells, neutrophils and cell interstitial infiltration, in turn the expression of chemotactic axis CCR6/CCL20 was restricted to the tubular epithelium cells. There was a slight positive linear correlation between the presence of IL-17 and expression of chemotactic axis CCR6/CCL20 in the microenvironment of renal graft. Therefore, we believe that, combined with our results, further studies with increased "n" sample and greater control over the variables involved in obtaining the renal specimen, can determine more clearly the influence of chemotactic axis CCR6 / CCL20 and polymorphisms in cytokines related to Th17 profile on the control of this cell subtype response in rejection processes to renal allograft.

Studies on the protective immune response to Plasmodium chabaudi in mice

Inbred strains of C5731 and NIH nice infected with the A/S strain of Plasmodium chaubaudi usually developed high parasitaemias but infections were rarely fatal in immunocompetent mice and in most mice the parasites could be eradicated within 53 days or less. The immune response of C57B1 and NTH mice to infection with the A/S strain of P. chabaudi was studied. The principle method used in this study for investigating the immune response of the mice was to examine the immunity conferred on syngeneic mice, either X-irradiated or non-irradiated, by transferring to them lymphoid cells or serum from immune or semi-immune donors. The lymphoid cell populations examined were unfractionated spleen cells, nylon wool column enriched subpopulations of thymus-derived lymphocytes (T cells) and the so-called bursa-derived lymphocytes (B cells), bone marrow cells and phagocytic cells. In the course of these experiments observations were made on the effect of X-irradiation on the subsequent growth and multiplication of the parasite. In addition, an in vitro assay for antibody-dependent cell mediated cytotoxicity was used to investigate the activity of splenic K cells during malaria infection. K cells are lymphoid cells which may include lymphocytes of an undefined category, but possess receptors for the Fc portion of antibody on their surface and have the ability to non-specifically lyse target cells coated in antibodies. a) The adoptive transfer of immunity to P.chabaudi with immune spleen cells. Spleen cells from mice which had previously been infected with P.chabaudi were able to confer some immunity on syngeneic mice which had been irradiated with 600 or 800 rads. The protection was detected as a shortened patent parasitaemia in immune cell recipients compared to controls. The early experiments indicated the value of using irradiated recipients rather than non-irradiated recipients. In irradiated mice, a) smaller numbers of immune cells were required to promote detectable immunity than in non-irradiated mice, b) there was an amplification of the difference in the duration of primary parasitaemias in recipients of immune cells and normal cells compared to non-irradiated mice and c) as the irradiated host is immunodepressed, the protective effect of donor cells can be examined with a reduced contribution by the hosts own immune system. An initial non-specific resistance to P.chabaudi infection was observed in irradiated mice, although the infection in most of these mice was subsequently more severe than in non-irradiated mice. The non-specific resistance could be reduced or abolished by injecting lymphoid cells into mice shortly after irradiation or by infecting irradiated mice more than 15 days after irradiation. Other workers suggest that following irradiation, the reticulo-endothelial system is stimulated at the time that the non-specific resistance to P.chabaudi was observed. b) the adoptive transfer of immunity in syngeneic mice with enriched subpopulations of splenic immune T cells, B. cells, bone marrow cells and phagocytes. Immunity to P.chabaudi could be adoptively transferred with enriched spleen subpopulations of immune T cells or immune B cells in mice which had been irradiated 600 or 300 rads. The protective effects of unfractionated immune cells was, however, usually better than that of either immune T or F cell subpopulations. In most experiments enriched immune T cell recipients were more likely to suffer relapsing patent parasitaemias than either enriched immune B cell recipients or unfractionated immune cell recipients. In one experiment a comparison was made of the course of P.chabaudi infection in mice which had been irradiated with either 600 rads or 300 rads and which received injections of different immune cells. A dose of 600 rads permits the immune system of mice to recover from the effects of irradiation, but a dose of 800 rads is lethal to mice unless lymphoid cells are injected after irradiation. It was found that in recipients of enriched immune T or B cells, which had been irradiated with 600 rads, the parasitaemia became subpatent before their equivalents irradiated with 800 rads, but that there was little difference in parasitaemias between recipients of unfractionated immune cells given 600 or 800 rads. Experiments in which enriched immune T cells and B cells were recombined and injected into syngeneic mice gave inconclusive results as to whether the immune subpopulations acted synergistically. Similar experiments in which immune subpopulations of lymphoid cells were recombined with normal subpopulations of lymphoid cells demonstrated that the latter cells did not enhance the protective effect of the former cells. Bone marrow cells from immune mice were able to confer some protection on syngeneic recipients, but were not as protective as enriched immune T cells or B cells. The results obtained in adoptive transfer experiments using phagocytic cells from the spleen of immune mice depended on the length of time spleen cells were incubated in petri-dishes at 37° C before harvesting the phagocytes. Using C57B1 mice, phagocytes harvested after 15 hours incubation were as protective as unfractionated immune cells in a cell transfer experiment, but phagocytes harvested after 16 hours incubation were not protective. Examination of NIH phagocytic cells after 2.5 hours incubation at 37°C, which were as protective as unfractionated immune spleen cells in a cell transfer experiment, demonstrated that the petri-dish adherent cells may have contained B lymphocytes. c) The passive transfer of immunity with serum from P.chabaudi infected mice. The passive transfer of serum from C57B1 mice which had been previously infected with P.chabaudi to normal or irradiated syngeneic mice demonstrated that the serum recipients were initially protected from infection. Irradiated mice, however, were delayed longer in the onset of parasitaemia compared to non-irradiated mice. Using NIH mice, sera were collected from unfractionated immune spleen cell recipients, enriched immune T cell recipients and normal spleen recipients on the 11th day of a P.chabaudi infection, just after peak parasitaemia, and also on the 14th day of infection. On day 14, all immune cells recipients and most of the enriched immune T cell recipients had become subpatent but all normal cell recipients still had patent infections. Sera collected from the different spleen cell recipients on the 11th day of infection and passively transferred to irradiated mice demonstrated little protection. Sera collected on the 14th day of infect ion, however, reflected the immune status of the donors in their protective properties in mice infected with P.chabaudi. The serum from unfractionated immune cell recipients was the most protective of the 3 sera when compared to normal NIH serum and the serum from enriched immune T cell recipients was slightly protective, but the serum from normal cell recipients produced an enhanced infection in mice infected with P.chabaudi. d) Antibody-dependent cell-mediated cytotoxicity of spleen cells in P.chabaudi infected mice. In a preliminary investigation of K cell activity in the spleens of P.chabaudi infected mice, it was found that there was an increased activity of K cells collected at around peak parasitaemia compared to the activity of K cells in non-infected mice, and that this increased activity could also be found in mice which had recently become subpatent. As the target cell for antibody-dependent cell-mediated cytotoxicity employed was the thick red blood cell, it is not known whether the K cell is involved in the killing of P.chabaudi parasites. These results suggest that both T cells and B cells and antibody may be important in the immune response to P.chabaudi in mice. Primed T cells may act as helper cells in the production of malarial antibodies, but, as enriched primed T cells could confer protection on immunodepressed mice, it is possible that a cell-mediated mechanism of immunity may also exist.

Fiber, a component for health gastrointestinal endocrine system

Dietary fiber was classified according to its solubility in an attempt to relate physiological effects to chemical types of fiber. Soluble fibers (B-glucans, gums, wheat dextrin, psyllium, pectin, inulin) were considered to have benefits on serum lipids, while insoluble fibers (cellulose, lignin, pectins, hemicelluloses) were linked with laxation benefits. More important characteristics of fiber in terms of physiological benefits are viscosity and fermentability. Viscous fibers (pectins, B-glucans, gums, psyllium) are those that have gel-forming properties in the intestinal tract, and fermentable fibers (wheat dextrin, pectins, B-glucans, gum, inulin) are those that can be metabolized by colonic bacteria. Objective: To summarize the beneficial effects of dietary fiber, as nutraceuticals, in order to maintain a healthy gastrointestinal system. Methods: Our study is a systematic review. Electronic databases, including PubMed, Medline, with supplement of relevant websites, were searched. We included randomized and non-randomized clinical trials, epidemiological studies (cohort and case-control). We excluded case series, case reports, in vitro and animal studies. Results: The WHO, the U.S. Food and Drug Administration (FDA), the Heart Foundation and the Romanian Dietary Guidelines recommends that adults should aim to consume approximately 25–30 g fiber daily. Dietary fiber is found in the indigestible parts of cereals, fruits and vegetables. There are countries where people don’t eat enough food fibers, these people need to take some kind of fiber supplement. Evidence has been found that dietary fiber from whole foods or supplements may (1) reduce the risk of cardiovascular disease by improving serum lipids and reducing serum total and low-density lipoprotein (LDL) cholesterol concentrations, (2) decreases the glycaemic index of foods, which leads to an improvement in glycemic response, positive impact on diabetes, (3) protect against development of obesity by increasing satiety hormone leptin concentrations, (4) reduced risk of developing colorectal cancer by normalizes bowel movements, improve the integrity of the epithelial layer of the intestines, increase the resistance against pathogenic colonization, have favorable effects on the gut microbiome, wich is the second genomes of the microorganisms, (5) have a positive impact on the endocrine system by gastrointestinal polypeptide hormonal regulation of digestion, (6) have prebiotic effect by short-chain fatty acids (SCFA) production; butyrate acid is the preferred energy source for colonic epithelial cells, promotes normal cell differentiation and proliferation, and also help regulate sodium and water absorption, and can enhance absorption of calcium and other minerals. Although all prebiotics are fiber, not all fiber is prebiotic. This generally refers to the ability of a fiber to increase the growth of bifidobacteria and lactobacilli, which are beneficial to human health, and (7) play a role in improving immune function via production of SCFAs by increases T helper cells, macrophages, neutrophils, and increased cytotoxic activity of natural killer cells. Conclusion: Fiber consumption is associated with high nutritional value and antioxidant status of the diet, enhancing the effects on human health. Fibers with prebiotic properties can also be recommended as part of fiber intake. Due to the variability of fiber’s effects in the body, it is important to consume fiber from a variety of sources. Increasing fiber consumption for health promotion and disease prevention is a critical public health goal.

CD4+ CD25+ regulatory T cells control T helper cell type 1 responses to foreign antigens induced by mature dendritic cells in vivo.

Recent evidence suggests that in addition to their well known stimulatory properties, dendritic cells (DCs) may play a major role in peripheral tolerance. It is still unclear whether a distinct subtype or activation status of DC exists that promotes the differentiation of suppressor rather than effector T cells from naive precursors. In this work, we tested whether the naturally occurring CD4+ CD25+ regulatory T cells (Treg) may control immune responses induced by DCs in vivo. We characterized the immune response induced by adoptive transfer of antigen-pulsed mature DCs into mice depleted or not of CD25+ cells. We found that the development of major histocompatibility complex class I and II-restricted interferon gamma-producing cells was consistently enhanced in the absence of Treg. By contrast, T helper cell (Th)2 priming was down-regulated in the same conditions. This regulation was independent of interleukin 10 production by DCs. Of note, splenic DCs incubated in vitro with Toll-like receptor ligands (lipopolysaccharide or CpG) activated immune responses that remained sensitive to Treg function. Our data further show that mature DCs induced higher cytotoxic activity in CD25-depleted recipients as compared with untreated hosts. We conclude that Treg naturally exert a negative feedback mechanism on Th1-type responses induced by mature DCs in vivo.

MOLECULAR MECHANISMS UNDERLYING THE TRANSCRIPTIONAL REGULATION OF T HELPER 17 AND REGULATORY T CELLS

CD4+ T helper (Th) lymphocytes are vital for integrating immune responses by orchestrating the function of other immune cell types. Naïve Th cells can differentiate into different effector subsets that are characterized by their cytokine profile and immune regulatory functions. These subsets include Th1, Th2, Th17, natural and inducible regulatory T cells (nTreg and iTreg respectively), among others. We focused our investigation on two Th lineages, Th17 and regulatory T cells, with opposing functions in the immune system. These subsets have been suggested to be reciprocally regulated since they both require TGF-b for their development. We investigated the role of the Treg-associated master transcription factor Foxp3, and found that Foxp3 inhibits Th17 cell generation by preventing the transcriptional activity of the two main Th17-specific transcription factors, nuclear orphan receptors RORa and RORgt. At the molecular level, we identified two different functional domains in Foxp3 required for such inhibition: the LQALL sequence in exon 2 and the TIP60/HDAC7 binding domain. These domains could be crucial to either prevent the association of the nuclear receptors to coactivators or to recruit histone deacetylases to RORa- or RORgt-target genes. Since TGF-b is a common cytokine required for the commitment towards both Th lineages, we determined the role of the TGF-b-dependent signaling pathway in the generation of each subset. By using mice with deficiencies in signaling molecules downstream of TGF-b, we found that while Smad2, Smad3 and Smad4 are required for the generation of iTreg cells, only Smad2 is indispensable for the induction of IL-17-producing cells, suggesting that TGF-b induces these T helper lineages through differential signaling pathways. Thus, our findings describe novel transcriptional regulatory mechanisms that control the generation of two T helper lineages with opposing functions. These findings could provide novel therapeutic targets to treat diseases where the balance of these T cells is dysregulated, such as in autoimmunity, chronic infectious diseases and cancer.

Dual role of tumour-infiltrating T helper 17 cells in human colorectal cancer

BACKGROUND The immune contexture predicts prognosis in human colorectal cancer (CRC). Whereas tumour-infiltrating CD8+ T cells and myeloid CD16+ myeloperoxidase (MPO)+ cells are associated with favourable clinical outcome, interleukin (IL)-17-producing cells have been reported to correlate with severe prognosis. However, their phenotypes and functions continue to be debated. OBJECTIVE To investigate clinical relevance, phenotypes and functional features of CRC-infiltrating, IL-17-producing cells. METHODS IL-17 staining was performed by immunohistochemistry on a tissue microarray including 1148 CRCs. Phenotypes of IL-17-producing cells were evaluated by flow cytometry on cell suspensions obtained by enzymatic digestion of clinical specimens. Functions of CRC-isolated, IL-17-producing cells were assessed by in vitro and in vivo experiments. RESULTS IL-17+ infiltrates were not themselves predictive of an unfavourable clinical outcome, but correlated with infiltration by CD8+ T cells and CD16+ MPO+ neutrophils. Ex vivo analysis showed that tumour-infiltrating IL-17+ cells mostly consist of CD4+ T helper 17 (Th17) cells with multifaceted properties. Indeed, owing to IL-17 secretion, CRC-derived Th17 triggered the release of protumorigenic factors by tumour and tumour-associated stroma. However, on the other hand, they favoured recruitment of beneficial neutrophils through IL-8 secretion and, most importantly, they drove highly cytotoxic CCR5+CCR6+CD8+ T cells into tumour tissue, through CCL5 and CCL20 release. Consistent with these findings, the presence of intraepithelial, but not of stromal Th17 cells, positively correlated with improved survival. CONCLUSIONS Our study shows the dual role played by tumour-infiltrating Th17 in CRC, thus advising caution when developing new IL-17/Th17 targeted treatments.

Copolymer 1 induces T cells of the T helper type 2 that crossreact with myelin basic protein and suppress experimental autoimmune encephalomyelitis

The synthetic amino acid copolymer copolymer 1 (Cop 1) suppresses experimental autoimmune encephalomyelitis (EAE) and is beneficial in multiple sclerosis. To further understand Cop 1 suppressive activity, we studied the cytokine secretion profile of various Cop 1-induced T cell lines and clones. Unlike T cell lines induced by myelin basic protein (MBP), which secreted either T cell helper type 1 (Th1) or both Th1 and Th2 cytokines, the T cell lines/clones induced by Cop 1 showed a progressively polarized development toward the Th2 pathway, until they completely lost the ability to secrete Th1 cytokines. Our findings indicate that the polarization of the Cop 1-induced lines did not result from the immunization vehicle or the in vitro growing conditions, but rather from the tendency of Cop 1 to preferentially induce a Th2 response. The response of all of the Cop 1 specific lines/clones, which were originated in the (SJL/J×BALB/c)F1 hybrids, was restricted to the BALB/c parental haplotype. Even though the Cop 1-induced T cells had not been exposed to the autoantigen MBP, they crossreacted with MBP by secretion of interleukin (IL)-4, IL-6, and IL-10. Administration of these T cells in vivo resulted in suppression of EAE induced by whole mouse spinal cord homogenate, in which several autoantigens may be involved. Secretion of anti-inflammatory cytokines by Cop 1-induced suppressor cells, in response to either Cop 1 or MBP, may explain the therapeutic effect of Cop 1 in EAE and in multiple sclerosis.

T helper 17 cells may drive neuroprogression in major depressive disorder: proposal of an integrative model

The exact pathophysiology of major depressive disorder (MDD) remains elusive. The monoamine theory, which hypothesizes that MDD emerges as a result of dysfunctional serotonergic, dopaminergic and noradrenergic pathways, has guided the therapy of this illness for several decades. More recently, the involvement of activated immune, oxidative and nitrosative stress pathways and of decreased levels of neurotrophic factors has provided emerging insights regarding the pathophysiology of MDD, leading to integrated theories emphasizing the complex interplay of these mechanisms that could lead to neuroprogression. In this review, we propose an integrative model suggesting that T helper 17 (Th17) cells play a pivotal role in the pathophysiology of MDD through (i) microglial activation, (ii) interactions with oxidative and nitrosative stress, (iii) increases of autoantibody production and the propensity for autoimmunity, (iv) disruption of the blood-brain barrier, and (v) dysregulation of the gut mucosa and microbiota. The clinical and research implications of this model are discussed.

Streptococcus pneumoniae infection suppresses allergic airways disease by inducing regulatory T cells

An inverse association exists between some bacterial infections and the prevalence of asthma. We investigated whether Streptococcus pneumoniae infection protects against asthma using mouse models of ovalbumin (OVA)-induced allergic airway disease (AAD). Mice were intratracheally infected or treated with killed S. pneumoniae before, during or after OVA sensitisation and subsequent challenge. The effects of S. pneumoniae on AAD were assessed. Infection or treatment with killed S. pneumoniae suppressed hallmark features of AAD, including antigen-specific T-helper cell (Th) type 2 cytokine and antibody responses, peripheral and pulmonary eosinophil accumulation, goblet cell hyperplasia, and airway hyperresponsiveness. The effect of infection on the development of specific features of AAD depended on the timing of infection relative to allergic sensitisation and challenge. Infection induced significant increases in regulatory T-cell (Treg) numbers in lymph nodes, which correlated with the degree of suppression of AAD. Tregs reduced T-cell proliferation and Th2 cytokine release. The suppressive effects of infection were reversed by anti-CD25 treatment. Respiratory infection or treatment with S. pneumoniae attenuates allergic immune responses and suppresses AAD. These effects may be mediated by S. pneumoniae-induced Tregs. This identifies the potential for the development of therapeutic agents for asthma from S. pneumoniae.

Chlamydia muridarum lung infection in infants alters hematopoietic cells to promote allergic airway disease in mice

Background Viral and bacterial respiratory tract infections in early-life are linked to the development of allergic airway inflammation and asthma. However, the mechanisms involved are not well understood. We have previously shown that neonatal and infant, but not adult, chlamydial lung infections in mice permanently alter inflammatory phenotype and physiology to increase the severity of allergic airway disease by increasing lung interleukin (IL)-13 expression, mucus hyper-secretion and airway hyper-responsiveness. This occurred through different mechanisms with infection at different ages. Neonatal infection suppressed inflammatory responses but enhanced systemic dendritic cell:T-cell IL-13 release and induced permanent alterations in lung structure (i.e., increased the size of alveoli). Infant infection enhanced inflammatory responses but had no effect on lung structure. Here we investigated the role of hematopoietic cells in these processes using bone marrow chimera studies. Methodology/Principal Findings Neonatal (<24-hours-old), infant (3-weeks-old) and adult (6-weeks-old) mice were infected with C. muridarum. Nine weeks after infection bone marrow was collected and transferred into recipient age-matched irradiated naïve mice. Allergic airway disease was induced (8 weeks after adoptive transfer) by sensitization and challenge with ovalbumin. Reconstitution of irradiated naïve mice with bone marrow from mice infected as neonates resulted in the suppression of the hallmark features of allergic airway disease including mucus hyper-secretion and airway hyper-responsiveness, which was associated with decreased IL-13 levels in the lung. In stark contrast, reconstitution with bone marrow from mice infected as infants increased the severity of allergic airway disease by increasing T helper type-2 cell cytokine release (IL-5 and IL-13), mucus hyper-secretion, airway hyper-responsiveness and IL-13 levels in the lung. Reconstitution with bone marrow from infected adult mice had no effects. Conclusions These results suggest that an infant chlamydial lung infection results in long lasting alterations in hematopoietic cells that increases the severity of allergic airway disease in later-life.

T helper cell cytokine profiles following endurance exercise

Endurance exercise can cause immunosuppression and increase the risk of upper respiratory illness. The present study examined changes in the secretion of T helper (Th) cell cytokines after endurance exercise. Ten highly trained road cyclists [mean±SEM: age 24.2±1.7 years; height 1.82±0.02 m; body mass 73.8±2.0 kg; peak oxygen uptake 65.9±2.3 mL/(kg•min)] performed 2 h of cycling exercise at 90% of the second ventilatory threshold. Peripheral blood mononuclear cells were isolated and stimulated with phytohemagglutinin. Plasma cortisol concentrations and the concentration of Th1/Th2/Th17 cell cytokines were examined. Data were analyzed using both traditional statistics and magnitude-based inferences. Results revealed a significant decrease in plasma cortisol at 4–24 h postexercise compared with pre-exercise values. Qualitative analysis revealed postexercise changes in concentrations of plasma cortisol, IL-2, TNF, IL-4, IL-6, IL-10, and IL-17A compared with pre-exercise values. A Th1/Th2 shift was evident immediately postexercise. Furthermore, for multiple cytokines, including IL-2 and TNF (Th1), IL-6 and IL-10 (Th2), and IL-17 (Th17), no meaningful change in concentration occurred until more than 4 h postexercise, highlighting the duration of exercise-induced changes in immune function. These results demonstrate the importance of considering “clinically” significant versus statistically significant changes in immune cell function after exercise.