987 resultados para GT-rich DNA


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Starting from a cohort of 50 NADH-oxidoreductase (complex I) deficient patients, we carried out the systematic sequence analysis of all mitochondrially encoded complex I subunits (ND1 to ND6 and ND4L) in affected tissues. This approach yielded the unexpectedly high rate of 20% mutation identification in our series. Recurrent heteroplasmic mutations included two hitherto unreported (T10158C and T14487C) and three previously reported mutations (T10191C, T12706C and A13514G) in children with Leigh or Leigh-like encephalopathy. The recurrent mutations consistently involved T-->C transitions (p<10(-4)). This study supports the view that an efficient molecular screening should be based on an accurate identification of respiratory chain enzyme deficiency.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The genetic diversity displayed by Plasmodium falciparum, the most deadly Plasmodium species, is a significant obstacle for effective malaria vaccine development. In this study, we identified genetic polymorphisms in P. falciparum glutamate-rich protein (GLURP), which is currently being tested in clinical trials as a malaria vaccine candidate, from isolates found circulating in the Brazilian Amazon at variable transmission levels. The study was performed using samples collected in 1993 and 2008 from rural villages situated near Porto Velho, in the state of Rondônia. DNA was extracted from 126 P. falciparum-positive thick blood smears using the phenol-chloroform method and subjected to a nested polymerase chain reaction protocol with specific primers against two immunodominant regions of GLURP, R0 and R2. Only one R0 fragment and four variants of the R2 fragment were detected. No differences were observed between the two time points with regard to the frequencies of the fragment variants. Mixed infections were uncommon. Our results demonstrate conservation of GLURP-R0 and limited polymorphic variation of GLURP-R2 in P. falciparum isolates from individuals living in Porto Velho. This is an important finding, as genetic polymorphisms in B and T-cell epitopes could have implications for the immunological properties of the antigen.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

CcrM is a DNA methyltransferase that methylates the adenine in GANTC motifs in the chromo-some of the bacterial model Caulobacter crescentus. The loss of the CcrM homolog is lethal in C. crescentus and in several other species of Alphaproteobacteria. In this research, we used different experimental and bioinformatic approaches to determine why CcrM is so critical to the physiology of C. crescentus. We first showed that CcrM is a resident orphan DNA methyltransferase in non-Rickettsiales Alphaproteobacteria and that its gene is strictly conserved in this clade (with only one ex¬ception among the genomes sequenced so far). In C. crescentus, cells depleted in CcrM in rich medium quickly lose viability and present an elongated phenotype characteristic of an im¬pairment in cell division. Using minimal medium instead of rich medium as selective and main¬tenance substrate, we could generate a AccrM mutant that presents a viability comparable to the wild type strain and only mild morphological defects. On the basis of a transcriptomic ap¬proach, we determined that several genes essential for cell division were downregulated in the AccrM strain in minimal medium. We offered decisive arguments to support that the efficient transcription of two of these genes, ftsZ and mipZ, coding respectively for the Z-ring forming GTPase FtsZ and an inhibitor of FtsZ polymerization needed for the correct positioning of the Z- ring at mid-cell, requires the methylation of an adenine in a conserved GANTC motif located in their core promoter region. We propose a model, according to which the genome of C. crescentus encodes a transcriptional activator that requires a methylated adenine in a GANTC context to bind to DNA and suggest that this transcriptional regulator might be the global cell-cycle regulator GcrA. In addition, combining a classic genetic approach and in vitro evolution experiments, we showed that the mortality and cell division defects of the AccrM strain in rich medium are mainly due to limiting intracellular levels of the FtsZ protein. We also studied the dynamics of GANTC methylation in C. crescentus using the SMRT technol¬ogy developed by Pacific Biosciences. Our findings support the commonly accepted model, accord¬ing to which the methylation state of GANTC motifs varies during the cell cycle of C. crescentus: before the initiation of DNA replication, the GANTC motifs are fully-methylated (methylated on both strands); when the DNA gets replicated, the GANTC motifs become hemi-methylated (methyl¬ated on one strand only) and this occurs at different times during replication for different loci along the chromosome depending on their position relative to the origin of replication; the GANTC mo¬tifs are only remethylated after DNA replication has finished as a consequence of the massive and short-lived expression of CcrM in predivisional cells. About 30 GANTC motifs in the C. crescentus chromosome were found to be undermethylated in most of the bacterial population; these might be protected from CcrM activity by DNA binding proteins and some of them could be involved in methylation-based bistable transcriptional switches. - CcrM est une ADN méthyltransférase qui méthyle les adénines dans le contexte GANTC dans le génome de la bactérie modèle Caulobacter crescentus. La perte de l'homologue de CcrM chez C. crescentus et chez plusieurs autres espèces d'Alphaproteobactéries est létale. Dans le courant de cette recherche, nous tentons de déterminer pourquoi la protéine CcrM est cruciale pour la survie de C. crescentus. Nous démontrons d'abord que CcrM est une adénine méthyltransférase orpheline résidente, dont le gène fait partie du génome minimal partagé par les Alphaprotéobactéries non-Rickettsiales (à une exception près). Lorsqu'une souche de C. crescentus est privée de CcrM, sa viabilité décroît rapi¬dement et ses cellules présentent une morphologie allongée qui suggère que la division cellulaire est inhibée. Nous sommes parvenus à créer une souche AccrM en utilisant un milieu minimum, au lieu du milieu riche classiquement employé, comme milieu de sélection et de maintenance pour la souche. Lorsque nous avons étudié le transcriptome de cette souche de C. crescentus privée de CcrM, nous avons pu constater que plusieurs gènes essentiels pour le bon déroulement de la division cellulaire bactérienne étaient réprimés. En particulier, l'expression adéquate des gènes ftsZ et mipZ - qui codent, respectivement, pour FtsZ, la protéine qui constitue, au milieu de la cellule, un anneau protéique qui initie le processus de division et pour MipZ, un inhibiteur de la polymérisation de FtsZ qui est indispensable pour le bon positionnement de l'anneau FtsZ - est dépendante de la présence d'une adénine méthylée dans un motif GANTC conservé situé dans leur région promotrice. Nous présentons un modèle selon lequel le génome de C. crescentus code pour un facteur de transcription qui exige la présence d'une adénine méthylée dans un contexte GANTC pour s'attacher à l'ADN et nous suggérons qu'il pourrait s'agir du régulateur global du cycle cellulaire GcrA. En outre, nous montrons, en combinant la génétique classique et une approche basée sur l'évolution expérimentale, que la mortalité et l'inhibition de la division cellulaire caractéristiques de la souche àccrMeη milieu riche sont dues à des niveaux excessivement bas de protéine FtsZ. Nous avons aussi étudié la dynamique de la méthylation du chromosome de C. crescentus sur la base de la technologie SMRT développée par Pacific Biosciences. Nous confirmons le modèle communément accepté, qui affirme que l'état de méthylation des motifs GANTC change durant le cycle cellulaire de C. crescentus: les motifs GANTC sont complètement méthylés (méthylés sur les deux brins) avant de début de la réplication de l'ADN; ils deviennent hémi-méthylés (méthylés sur un brin seulement) une fois répliqués, ce qui arrive à différents moments durant la réplication pour différents sites le long du chromosome en fonction de leur position par rapport à l'origine de répli-cation; finalement, les motifs GANTC sont reméthylés après la fin de la réplication du chromosome lorsque la protéine CcrM est massivement, mais très transitoirement, produite. Par ailleurs, nous identifions dans le chromosome de C. crescentus environ 30 motifs GANTC qui restent en perma-nence non-méthylés dans une grande partie de la population bactérienne; ces motifs sont probable-ment protégés de l'action de CcrM par des protéines qui s'attachent à l'ADN et certains d'entre eux pourraient être impliqués dans des mécanismes de régulation générant une transcription bistable.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Intratumoural (i.t.) injection of radio-iododeoxyuridine (IdUrd), a thymidine (dThd) analogue, is envisaged for targeted Auger electron- or beta-radiation therapy of glioblastoma. Here, biodistribution of [(125)I]IdUrd was evaluated 5 hr after i.t. injection in subcutaneous human glioblastoma xenografts LN229 after different intravenous (i.v.) pretreatments with fluorodeoxyuridine (FdUrd). FdUrd is known to block de novo dThd synthesis, thus favouring DNA incorporation of radio-IdUrd. Results showed that pretreatment with 2 mg/kg FdUrd i.v. in 2 fractions 0.5 hr and 1 hr before injection of radio-IdUrd resulted in a mean tumour uptake of 19.8% of injected dose (% ID), representing 65.3% ID/g for tumours of approx. 0.35 g. Tumour uptake of radio-IdUrd in non-pretreated mice was only 4.1% ID. Very low uptake was observed in normal nondividing and dividing tissues with a maximum concentration of 2.9% ID/g measured in spleen. Pretreatment with a higher dose of FdUrd of 10 mg/kg prolonged the increased tumour uptake of radio-IdUrd up to 5 hr. A competition experiment was performed in FdUrd pretreated mice using i.t. co-injection of excess dThd that resulted in very low tumour retention of [(125)I]IdUrd. DNA isolation experiments showed that in the mean &gt;95% of tumour (125)I activity was incorporated in DNA. In conclusion, these results show that close to 20% ID of radio-IdUrd injected i.t. was incorporated in tumour DNA after i.v. pretreatment with clinically relevant doses of FdUrd and that this approach may be further exploited for diffusion and therapy studies with Auger electron- and/or beta-radiation-emitting radio-IdUrd.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Background: Early initiation of combination antiretroviral therapy (ART) during primary HIV-1 infection may prevent the establishment of large viral reservoirs, possibly resulting in improved control of plasma viraemia rebound after ART cessation.Methods: Levels of cell-associated HIV-1 DNA and plasma HIV-1 RNA were measured longitudinally in 32 acutely and recently infected patients, who started ART <= 120 days after the estimated date of infection, and interrupted ART after 18 months (median) of continuous therapy. Averages of HIV-1 DNA and RNA concentrations present in blood 30-365 days after therapy interruption (median duration 300 days, range 195-358) were compared between patients who started ART <= 60 days after the estimated date of infection (early starters), those who started between 61 and 120 days (later starters), and, for HIV-1 RNA only, with 89 untreated participants of the Swiss HIV Cohort Study with documented sero-conversion and longitudinal measurements collected 90-455 days after the first positive HIV test.Results: In early ART starters, average levels of plasma HIV-1 RNA and cell-associated HIV-1 DNA after treatment interruption were 1 log(10) (P=0.008) and 0.4 log(10) (P=0.03) lower compared with later starters. Average post-treatment plasma HIV-1 RNA levels in early starters were significantly lower, respectively, compared with untreated controls (-1.2 log(10); P<0.0004).Conclusions: Early treatment initiation within 2 months after HIV infection compared with later therapy initiation resulted in reduced levels of plasma viraemia and proviral HIV-1 DNA for >= 1 year after subsequent ART cessation. Plasma HIV-1 RNA levels in early starters were also significantly lower than in untreated controls.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

BACKGROUND: Along the chromosome of the obligate intracellular bacteria Protochlamydia amoebophila UWE25, we recently described a genomic island Pam100G. It contains a tra unit likely involved in conjugative DNA transfer and lgrE, a 5.6-kb gene similar to five others of P. amoebophila: lgrA to lgrD, lgrF. We describe here the structure, regulation and evolution of these proteins termed LGRs since encoded by "Large G+C-Rich" genes. RESULTS: No homologs to the whole protein sequence of LGRs were found in other organisms. Phylogenetic analyses suggest that serial duplications producing the six LGRs occurred relatively recently and nucleotide usage analyses show that lgrB, lgrE and lgrF were relocated on the chromosome. The C-terminal part of LGRs is homologous to Leucine-Rich Repeats domains (LRRs). Defined by a cumulative alignment score, the 5 to 18 concatenated octacosapeptidic (28-meric) LRRs of LGRs present all a predicted alpha-helix conformation. Their closest homologs are the 28-residue RI-like LRRs of mammalian NODs and the 24-meres of some Ralstonia and Legionella proteins. Interestingly, lgrE, which is present on Pam100G like the tra operon, exhibits Pfam domains related to DNA metabolism. CONCLUSION: Comparison of the LRRs, enable us to propose a parsimonious evolutionary scenario of these domains driven by adjacent concatenations of LRRs. Our model established on bacterial LRRs can be challenged in eucaryotic proteins carrying less conserved LRRs, such as NOD proteins and Toll-like receptors.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

ABSTRACT: BACKGROUND: Many studies have been published outlining the global effects of 17 beta-estradiol (E2) on gene expression in human epithelial breast cancer derived MCF-7 cells. These studies show large variation in results, reporting between ~100 and ~1500 genes regulated by E2, with poor overlap. RESULTS: We performed a meta-analysis of these expression studies, using the Rank product method to obtain a more accurate and stable list of the differentially expressed genes, and of pathways regulated by E2. We analyzed 9 time-series data sets, concentrating on response at 3-4 hrs (early) and at 24 hrs (late). We found >1000 statistically significant probe sets after correction for multiple testing at 3-4 hrs, and >2000 significant probe sets at 24 hrs. Differentially expressed genes were examined by pathway analysis. This revealed 15 early response pathways, mostly related to cell signaling and proliferation, and 20 late response pathways, mostly related to breast cancer, cell division, DNA repair and recombination. CONCLUSIONS: Our results show that meta-analysis identified more differentially expressed genes than the individual studies, and that these genes act together in networks. These results provide new insight into E2 regulated mechanisms, especially in the context of breast cancer.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

DNA methylation is involved in a diversity of processes in bacteria, including maintenance of genome integrity and regulation of gene expression. Here, using Caulobacter crescentus as a model, we exploit genome-wide experimental methods to uncover the functions of CcrM, a DNA methyltransferase conserved in most Alphaproteobacteria. Using single molecule sequencing, we provide evidence that most CcrM target motifs (GANTC) switch from a fully methylated to a hemi-methylated state when they are replicated, and back to a fully methylated state at the onset of cell division. We show that DNA methylation by CcrM is not required for the control of the initiation of chromosome replication or for DNA mismatch repair. By contrast, our transcriptome analysis shows that >10% of the genes are misexpressed in cells lacking or constitutively over-expressing CcrM. Strikingly, GANTC methylation is needed for the efficient transcription of dozens of genes that are essential for cell cycle progression, in particular for DNA metabolism and cell division. Many of them are controlled by promoters methylated by CcrM and co-regulated by other global cell cycle regulators, demonstrating an extensive cross talk between DNA methylation and the complex regulatory network that controls the cell cycle of C. crescentus and, presumably, of many other Alphaproteobacteria.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Except for the first 2 years since July 29, 1968, Arenal volcano has continuously erupted compositionally monotonous and phenocryst-rich (similar to35%) basaltic andesites composed of plagioclase (plag), orthopyroxene (opx), clinopyroxene (cpx), spinel olivine. Detailed textural and compositional analyses of phenocrysts, mineral inclusions, and microlites reveal comparable complexities in any given sample and identify mineral components that require a minimum of four crystallization environments. We suggest three distinct crystallization environments crystallized low Mg# (<78) silicate phases from andesitic magma but at different physical conditions, such as variable pressure of crystallization and water conditions. The dominant environment, i.e., the one which accounts for the majority of minerals and overprinted all other assemblages near rims of phenocrysts, cocrystallized clinopyroxene (Mg# similar to71-78), orthopyroxene (Mg# similar to71-78), titanomagnetite and plagioclase (An(60) to An(85)). The second environment cocrystallized clinopyroxene (Mg# 71-78), olivine (<Fo(78)), titanomagnetite, and very high An (similar to90) plagioclase, while the third cocrystallized clinopyroxene (Mg# 71-78) with high (>7) Al/Ti and high (>4 wt.%) Al2O3, titanomagnetite with considerable Al2O3 (10-18 wt.%) and possibly olivine but appears to lack plagioclase. A fourth crystallization environment is characterized by clinopyroxene (e.g., Mg#=similar to78-85; Cr2O3=0.15-0.7 wt.%), Al-, Cr-rich spinel olivine (similar toFo(80)), and in some circumstances high-An (>80) plagioclase. This assemblage seems to record mafic inputs into the Arenal system and crystallization at high to low pressures. Single crystals cannot be completely classified as xenocrysts, antecrysts (cognate crystals), or phenocrysts, because they often contain different parts each representing a different crystallization environment and thus belong to different categories. Bulk compositions are mostly too mafic to have crystallized the bulk of ferromagnesian minerals and thus likely do not represent liquid compositions. On the other hand, they are the cumulative products of multiple mixing events assembling melts and minerals from a variety of sources. The driving force for this multistage mixing evolution to generate erupting basaltic andesites is thought to be the ascent of mafic magma from lower crustal levels to subvolcanic depths which at the same time may also go through compositional modification by fractionation and assimilation of country rocks. Thus, mafic magmas become basaltic andesite through mixing, fractionation and assimilation by the time they arrive at subvolcanic depths. We infer new increments of basaltic andesite are supplied nearly continuously to the subvolcanic reservoir concurrently to the current eruption and that these new increments are blended into the residing, subvolcanic magma. Thus, the compositional monotony is mostly the product of repetitious production of very similar basaltic andesite. Furthermore, we propose that this quasi-constant supply of small increments of magma is the fundamental cause for small-scale, decade-long continuous volcanic activity; that is, the current eruption of Arenal is flux-controlled by inputs of mantle magmas. (C) 2004 Elsevier B.V. All rights reserved.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Very high concentrations of uranium (up to 4000 ppm) were found in a natural soil in the Dischma valley, an alpine region in the Grisons canton in Switzerland. The goal of this study was to examine the redox state and the nature of uranium binding in the soil matrix in order to understand the accumulation mechanism. Pore water profiles collected from Dischma soil revealed the establishment of anoxic conditions with increasing soil depth. A combination of chemical extraction methods and spectroscopy was applied to characterize the redox state and binding environment of uranium in the soil. Bicarbonate extraction under anoxic conditions released most of the uranium indicating that uranium occurs predominantly in the hexavalent form. Surprisingly, the uranium redox state did not vary greatly as a function of depth. X-ray absorption near edge spectroscopy (XANES), confirmed that uranium was present as a mixture of U(VI) and U(IV) with U(VI) dominating. Sequential extractions of soil samples showed that the dissolution of solid organic matter resulted in the simultaneous release of the majority of the soil uranium content (>95%). Extended X-ray absorption fine structure (EXAFS) spectroscopy also revealed that soil-associated uranium in the soil matrix was mainly octahedrally coordinated, with an average of 1.7 axial (at about 1.76 Å) and 4.6 to 5.3 equatorial oxygen atoms (at about 2.36 Å) indicating the dominance of a uranyl-like (UO22+) structure presumably mixed with some U(IV). An additional EXAFS signal (at about 3.2 Å) identified in some spectra suggested that uranium was also bound (via an oxygen atom) to a light element such as carbon, phosphorus or silicon. Gamma spectrometric measurements of soil profiles failed to identify uranium long-life daughter products in the soil which is an indication that uranium originates elsewhere and was transported to its current location by water. Finally, it was found that the release of uranium from the soil was significantly promoted at very low pH values (pH 2) and increased with increasing pH values (between pH 5 and 9).

Relevância:

30.00% 30.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

BACKGROUND: The genome of Protochlamydia amoebophila UWE25, a Parachlamydia-related endosymbiont of free-living amoebae, was recently published, providing the opportunity to search for genomic islands (GIs). RESULTS: On the residual cumulative G+C content curve, a G+C-rich 19-kb region was observed. This sequence is part of a 100-kb chromosome region, containing 100 highly co-oriented ORFs, flanked by two 17-bp direct repeats. Two identical gly-tRNA genes in tandem are present at the proximal end of this genetic element. Several mobility genes encoding transposases and bacteriophage-related proteins are located within this chromosome region. Thus, this region largely fulfills the criteria of GIs. The G+C content analysis shows that several modules compose this GI. Surprisingly, one of them encodes all genes essential for F-like conjugative DNA transfer (traF, traG, traH, traN, traU, traW, and trbC), involved in sex pilus retraction and mating pair stabilization, strongly suggesting that, similarly to the other F-like operons, the parachlamydial tra unit is devoted to DNA transfer. A close relatedness of this tra unit to F-like tra operons involved in conjugative transfer is confirmed by phylogenetic analyses performed on concatenated genes and gene order conservation. These analyses and that of gly-tRNA distribution in 140 GIs suggest a proteobacterial origin of the parachlamydial tra unit. CONCLUSIONS: A GI of the UWE25 chromosome encodes a potentially functional F-like DNA conjugative system. This is the first hint of a putative conjugative system in chlamydiae. Conjugation most probably occurs within free-living amoebae, that may contain hundreds of Parachlamydia bacteria tightly packed in vacuoles. Such a conjugative system might be involved in DNA transfer between internalized bacteria. Since this system is absent from the sequenced genomes of Chlamydiaceae, we hypothesize that it was acquired after the divergence between Parachlamydiaceae and Chlamydiaceae, when the Parachlamydia-related symbiont was an intracellular bacteria. It suggests that this heterologous DNA was acquired from a phylogenetically-distant bacteria sharing an amoebal vacuole. Since Parachlamydiaceae are emerging agents of pneumonia, this GI might be involved in pathogenicity. In future, conjugative systems might be developed as genetic tools for Chlamydiales.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Les larves aquatiques d'éphémères (Ephemeroptera) colonisent toutes les eaux douces du monde et sont couramment utilisées comme bio-indicateurs de la qualité de l'eau. Le genre Rhithrogena (Heptageniidae) est le deuxième plus diversifié chez les éphémères, et plusieurs espèces européennes ont une distribution restreinte dans des environnements alpins sensibles. Les espèces de Rhithrogena ont été classées en "groupes d'espèces" faciles à identifier. Cependant, malgré leur importance écologique et en terme de conservation, beaucoup d'espèces présentent des différences morphologiques ambiguës, suggérant que lataxonomie actuelle ne refléterait pas correctement leur diversité évolutive. De plus, aucune information sur leurs relations, leur origine, le taux de spéciation ou les mécanismes ayant provoqué leur remarquable diversification dans les Alpes n'est disponible. Nous avons d'abord examiné le statut spécifique d'environ 50% des espèces européennes de Rhithrogena en utilisant un large échantillonnage de populations alpines incluant 22 localités typiques, ainsi qu'une analyse basée sur le modèle général mixte de Yule et de coalescence (GMYC) appliqué à un gène mitochondrial standard (coxl) et à un gène nucléaire développé spécifiquement pour cette étude. Nous avons observé un regroupement significatif des séquences coxl en 31 espèces potentielles, et nos résultats ont fortement suggéré la présence d'espèces cryptiques et de fractionnements taxonomiques excessifs chez les Rhithrogena. Nos analyses phylogénétiques ont démontré la monophylie de quatre des six groupes d'espèces reconnus présents dans notre échantillonnage. La taxonomie ADN développée dans cette étude pose les bases d'une future révision de ce genre important mais cryptique en Europe. Puis nous avons mené une étude phylogénétique multi-gènes entre les espèces européennes de Rhithrogena. Les données provenant de trois gènes nucléaires et de deux gènes mitochondriaux ont été largement concordantes, et les relations entre les espèces bien résolues au sein de la plupart des groupes d'espèces dans une analyse combinant tous les gènes. En l'absence de points de calibration extérieurs tels que des fossiles, nous avons appliqué à nos données mitochondriales une horloge moléculaire standard pour les insectes, suggérant une origine des Rhithrogena alpins à la limite Oligocène / Miocène. Nos résultats ont montré le rôle prépondérant qu'ont joué les glaciations du quaternaire dans leur diversification, favorisant la spéciation d'au moins la moitié des espèces actuelle dans les Alpes. La biodiversité et le taux d'endémisme à Madagascar, notamment au niveau de la faune des eaux douces, sont parmi les plus extraordinaires et les plus menacés au monde. On pense que beaucoup d'espèces d'éphémères sont restreintes à un seul bassin versant (microendémisme) dans les zones forestières, ce qui les rendrait particulièrement sensibles à la réduction et à la dégradation de leur habitat. Mis à part deux espèces décrites, Afronurus matitensis et Compsoneuria josettae, les Heptageniidae sont pratiquement inconnus à Madagascar. Les deux genres ont une distribution discontinue en Afrique, à Madagascar et en Asie du Sud-Est, et leur taxonomie complexe est régulièrement révisée. L'approche standard pour comprendre leur diversité, leur endémisme et leur origine requerrait un échantillonnage étendu sur plusieurs continents et des années de travaux taxonomiques. Pour accélérer le processus, nous avons utilisé des collections de musées ainsi que des individus fraîchement collectés, et appliqué une approche combinant taxonomie ADN et phylogénie. L'analyses GMYC du gène coxl a délimité 14 espèces potentielles à Madagascar, dont 70% vraisemblablement microendémiques. Une analyse phylogénique incluant des espèces africaines et asiatiques portant sur deux gènes mitochondriaux et quatre gènes nucléaires a montré que les Heptageniidae malgaches sont monophylétiques et groupe frère des Compsoneuria africains. L'existence de cette lignée unique, ainsi qu'un taux élevé de microendémisme, mettent en évidence leur importance en terme de conservation. Nos résultats soulignent également le rôle important que peuvent jouer les collections de musées dans les études moléculaires et en conservation. - Aquatic nymphs of mayflies (Ephemeroptera) colonize all types of freshwaters throughout the world and are extensively used as bio-indicators of water quality. Rhithrogena (Heptageniidae) is the second most species-rich genus of mayflies, and several European species have restricted distributions in sensitive Alpine environments and therefore are of conservation interest. The European Rhithrogena species are arranged into "species groups" that are easily identifiable. However, despite their ecological and conservation importance, ambiguous morphological differences among many species suggest that the current taxonomy may not accurately reflect their evolutionary diversity. Moreover, no information about their relationships, origin, timing of speciation and mechanisms promoting their successful diversification in the Alps is available. We first examined the species status of ca. 50% of European Rhithrogena diversity using a widespread sampling scheme of Alpine species that included 22 type localities, general mixed Yule- coalescent (GMYC) model analysis of one standard mitochondrial (coxl) and one newly developed nuclear marker. We observed significant clustering of coxl into 31 GMYC species, and our results strongly suggest the presence of both cryptic diversity and taxonomic oversplitting in Rhithrogena. Phylogenetic analyses recovered four of the six recognized species groups in our samples as monophyletic. The DNA taxonomy developed here lays the groundwork for a future revision of this important but cryptic genus in Europe. Then we conducted a species-level, multiple-gene phylogenetic study of European Rhithrogena. Data from three nuclear and two mitochondrial loci were broadly congruent, and species-level relationships were well resolved within most species groups in a combined analysis. In the absence of external calibration points like fossils, we applied a standard insect molecular clock hypothesis to our mitochondrial data, suggesting an origin of Alpine Rhithrogena in the Oligocene / Miocene boundary. Our results highlighted the preponderant role that quaternary glaciations played in their diversification, promoting speciation of at least half of the current diversity in the Alps. Madagascar's biodiversity and endemism are among the most extraordinary and endangered in the world. This includes the island's freshwater biodiversity, although detailed knowledge of the diversity, endemism, and biogeographic origin of freshwater invertebrates is lacking. Many mayfly species are thought to be restricted to single river basins (microendemic species) in forested areas, making them particularly sensitive to habitat reduction and degradation. The Heptageniidae are practically unknown in Madagascar except for two described species, Afronurus matitensis and Compsoneuria josettae. Both genera have a disjunct distribution in Africa, Madagascar and Southeast Asia, and a complex taxonomic status still in flux. The standard approach to understanding their diversity, endemism, and origin would require extensive field sampling on several continents and years of taxonomic work. Here we circumvent this using museum collections and freshly collected individuals in a combined approach of DNA taxonomy and phylogeny. The cox/-based GMYC analysis revealed 14 putative species on Madagascar, 70% of which potentially microendemics. A phylogenetic analysis that included African and Asian species and data from two mitochondrial and four nuclear loci indicated the Malagasy Heptageniidae are monophyletic and sister to African Compsoneuria. The observed monophyly and high microendemism highlight their conservation importance. Our results also underline the important role that museum collections can play in molecular studies, especially in critically endangered biodiversity hotspots like Madagascar.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Transforming growth factor beta (TGF-beta) and tumor necrosis factor alpha (TNF-alpha) often exhibit antagonistic actions on the regulation of various activities such as immune responses, cell growth, and gene expression. However, the molecular mechanisms involved in the mutually opposing effects of TGF-beta and TNF-alpha are unknown. Here, we report that binding sites for the transcription factor CTF/NF-I mediate antagonistic TGF-beta and TNF-alpha transcriptional regulation in NIH3T3 fibroblasts. TGF-beta induces the proline-rich transactivation domain of specific CTF/NF-I family members, such as CTF-1, whereas TNF-alpha represses both the uninduced as well as the TGF-beta-induced CTF-1 transcriptional activity. CTF-1 is thus the first transcription factor reported to be repressed by TNF-alpha. The previously identified TGF-beta-responsive domain in the proline-rich transcriptional activation sequence of CTF-1 mediates both transcriptional induction and repression by the two growth factors. Analysis of potential signal transduction intermediates does not support a role for known mediators of TNF-alpha action, such as arachidonic acid, in CTF-1 regulation. However, overexpression of oncogenic forms of the small GTPase Ras or of the Raf-1 kinase represses CTF-1 transcriptional activity, as does TNF-alpha. Furthermore, TNF-alpha is unable to repress CTF-1 activity in NIH3T3 cells overexpressing ras or raf, suggesting that TNF-alpha regulates CTF-1 by a Ras-Raf kinase-dependent pathway. Mutagenesis studies demonstrated that the CTF-1 TGF-beta-responsive domain is not the primary target of regulatory phosphorylations. Interestingly, however, the domain mediating TGF-beta and TNF-alpha antagonistic regulation overlapped precisely the previously identified histone H3 interaction domain of CTF-1. These results identify CTF-1 as a molecular target of mutually antagonistic TGF-beta and TNF-alpha regulation, and they further suggest a molecular mechanism for the opposing effects of these growth factors on gene expression.