Molecular View of the Interaction between iota-Carrageenan and a Phospholipid Film and Its Role in Enzyme Immobilization

Proteins incorporated into phospholipid Langmuir-Blodgett (LB) films are a good model system for biomembranes and enzyme immobilization studies. The specific fluidity of biomembranes, an important requisite for enzymatic activity, is naturally controlled by varying phospholipid compositions. In a model system, instead, LB film fluidity may be varied by covering the top layer with different substances able to interact simultaneously with the phospholipid and the protein to be immobilized. In this study, we immobilized a carbohydrate rich Neurospora crassa alkaline phosphatase (NCAP) in monolayers of the sodium salt of dihexadecylphosphoric acid (DHP), a synthetic phospholipid that provides very condensed Langmuir films. The binding of NCAP to DHP Langmuir-Blodgett (LB) films was mediated by the anionic polysaccharide iota-carrageenan (iota-car). Combining results from surface isotherms and the quartz crystal microbalance technique, we concluded that the polysaccharide was essential to promote the interaction between DHP and NCAP and also to increase the fluidity of the film. An estimate of DHP:iota-car ratio within the film also revealed that the polysaccharide binds to DHP LB film in an extended conformation. Furthermore, the investigation of the polysaccharide conformation at molecular level, using sum-frequency vibrational spectroscopy (SFG), indicated a preferential conformation of the carrageenan molecules with the sulfate groups oriented toward the phospholipid monolayer, and both the hydroxyl and ether groups interacting preferentially with the protein. These results demonstrate how interfacial electric fields can reorient and induce conformational changes in macromolecules, which may significantly affect intermolecular interactions at interfaces. This detailed knowledge of the interaction mechanism between the enzyme and the LB film is relevant to design strategies for enzyme immobilization when orientation and fluidity properties of the film provided by the matrix are important to improve enzymatic activity.

Geospatial clustering in data-rich environments: Features and issues

Geospatial clustering must be designed in such a way that it takes into account the special features of geoinformation and the peculiar nature of geographical environments in order to successfully derive geospatially interesting global concentrations and localized excesses. This paper examines families of geospaital clustering recently proposed in the data mining community and identifies several features and issues especially important to geospatial clustering in data-rich environments.

Metabolic syndrome features small, apolipoprotein A-I-poor, triglyceride-rich HDL3 particles with defective anti-apoptotic activity

The metabolic syndrome (MetS) phenotype is typically characterized by visceral obesity, insulin resistance, atherogenic dyslipidemia involving hypertriglyceridemia and subnormal levels of high density lipoprotein-cholesterol (HDL-C), oxidative stress and elevated cardiovascular risk. The potent antioxidative activity of small HDL3 is defective in MetS [Hansel B, et al. J Clin Endocrinol Metab 2004;89:4963-71]. We evaluated the functional capacity of small HDL3 particles from MetS subjects to protect endothelial cells from apoptosis induced by mildly oxidized low-density lipoprotein (oxLDL). MetS subjects presented an insulin-resistant obese phenotype, with hypertriglyceridemia, elevated apolipoprotein B and insulin levels, but subnormal HDL-C concentrations and chronic low grade inflammation (threefold elevation of C-reactive protein). When human microvascular endothelial cells (HMEC-1) were incubated with oxLDL (200 jig apolipoprotein B/ml) in the presence or absence of control HDL subfiractions (25 mu g protein/ml), small, dense HDL3b and 3c significantly inhibited cellular annexin V binding and intracellular generation of reactive oxygen species. The potent anti-apoptotic activity of small HDL3c particles was reduced (-35%; p < 0.05) in MetS subjects (n = 16) relative to normolipidemic controls (n = 7). The attenuated anti-apoptotic activity of HDL3c correlated with abdominal obesity, atherogenic dyslipidemia and systemic oxidative stress (p < 0.05), and was intimately associated with altered physicochemical properties of apolipoprotein A-I (apoA-I-poor HDL3c, involving core cholesteryl ester depletion and triglyceride enrichment. We conclude that in MetS, apoA-I-poor, small, dense HDL3c exert defective protection of endothelial cells from oxLDL-induced apoptosis, potentially reflecting functional anomalies intimately associated with abnormal neutral lipid core content. (c) 2007 Elsevier Ireland Ltd. All rights reserved.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Problems associated with spray drying of sugar-rich foods

Stickiness is a major reason that limits the spray drying of various sugar-rich food products. Higher hygroscopicity of amorphous powder, increase in solubility of sugars with temperature, and lower melting point and glass transition temperature, contribute to the stickiness problem. So far, the glass transition temperature has been widely accepted as a best indicator for stickiness. There are various manoeuvres that have been applied to spray dry such products. Some of them are the addition of drying aids, modification of drier design and use of mild drying temperature conditions. This review paper highlights the major research works that deal with the stickiness property of sugar-rich foods.

Development of a synthetic 7-ketocholesterol- rich emulsion resembling chylomicrons

Lipid emulsions that mimic natural lipoproteins help to understand the metabolism and the constitutional organization of circulating lipids. Chylomicrons synthesised by enterocyte cells usually contain oxysterols such as 7-ketocholesterol (7-KC). Here we describe the development of a 7-KC-containing emulsion as a model for oxisterol-rich chylomicron. Different amounts of 7-KC were used. Emulsion characteristics as effective diameter, lipid saturation with radiolabeled lipids was evaluated. In conclusion, the production of a synthetic 7-KC-rich emulsion resembling hylomicrons was feasible, being a model for in vivo metabolism studies.

The myosin-I-binding protein Acan125 binds the SH3 domain and belongs to the superfamily of leucine-rich repeat proteins

The SH3 domains of src and other nonreceptor tyrosine kinases have been shown to associate with the motif PXXP, where P and X stand for proline and an unspecified amino acid, but a motif that binds to the SH3 domain of myosin has thus far not been characterized. We previously showed that the SH3 domain of Acanthamoeba myosin-IC interacts with the protein Acan125. We now report that the Acan125 protein sequence contains two tandem consensus PXXP motifs near the C terminus. To test for binding, we expressed a polypeptide, AD3p, which includes 344 residues of native C-terminal sequence and a mutant polypeptide, AD3 Delta 977-994p, which lacks the sequence RPKPVPPPRGAKPAPPPR containing both PXXP motifs. The SH3 domain of Acanthamoeba myosin-IC bound AD3p and not AD3 Delta 977-994p, showing that the PXXP motifs are required for SH3 binding. The sequence of Acan125 is related overall to a protein of unknown function coded by Caenorhabditis elegans gene K07G5.1. The K07G5.1 gene product contains a proline-rich segment similar to the SH3 binding motif found in Acan125. The aligned sequences show considerable conservation of leucines and other hydrophobic residues, including the spacing of these residues, which matches a motif for leucine-rich repeats (LRRs). LRR domains have been demonstrated to be sites for ligand binding. Having an LRR domain and an SH3-binding domain, Acan125 and the C. elegans homologue define a novel family of bifunctional binding proteins.

A semi-empirical approach to optimise the quantity of drying aids required to spray dry sugar-rich foods

A semi-empirical linear equation has been developed to optimise the amount of maltodextrin additive (DE 6) required to successfully spray dry a sugar-rich product on the basis of its composition. Based on spray drying experiments, drying index values for individual sugars (sucrose, glucose, frutose) and citric acid were determined, and us;ng these index values an equation for model mixtures of these components was established. This equation has been tested with two sugar-rich natural products, pineapple juice and honey. The relationship was found to be valid for these products.

Metabolism of triglyceride-rich lipoproteins and lipid transfer to high-density lipoprotein in young obese and normal-weight patients with polycystic ovary syndrome

Objective: To clarify whether the metabolism of triglyceride-rich lipoproteins and lipid transfer to high-density lipoprotein (HDL) are altered in patients with polycystic ovary syndrome (PCOS). Design: Case control study. Setting: Endocrinology clinics. Patient(s): Eight normal-weight (NW) and 15 obese (013) patients with PCOS were compared with 10 NW and 10 Ob women without PCOS paired for age and body mass index. Intervention(s): Determination of triglyceride-rich lipoprotein metabolism and lipid transfer to HDL. Main Outcome Measure(s): Participants were injected triglyceride-rich emulsions labeled with (14)C-cholesteryl esters and (3)H-triglycerides and the fractional clearance rate (FCR, in min(-1)) of labels was determined. Lipid transfer from artificial nanoemulsions to HDL was performed by incubating radioactively labeled lipid nanoemulsions with plasma during 1 hour, followed by radioactive counting of HDL-containing supernatant after chemical precipitation. Result(s): Lipolysis estimated by triglyceride FCR was equal in PCOS groups (NW = 0.043 +/- 0.032, Ob = 0.033 +/- 0.009) and respective controls (NW = 0.039 +/- 0.015, Ob = 0.044 +/- 0.019). However, the remnant removal as estimated by cholesteryl ester FCR was reduced in both PCOS groups (NW = 0.005 +/- 0.006, Ob = 0.005 +/- 0.005) compared with controls (NW = 0.016 +/- 0.006, Ob = 0.011 +/- 0.072). Lipid transfer rates were not different among groups, but triglyceride transfer rates were positively correlated with homeostasis model assessment estimate of insulin resistance in PCOS. Conclusion(s): PCOS patients showed decreased removal of atherogenic remnants even when fasting glucose was <100 mg/dL. This reinforces the usefulness of the measures taken to prevent cardiovascular events in PCOS patients. (Fertil Steril (R) 2010;93:1948-56. (C)2010 by American Society for Reproductive Medicine.)

Immunogenicity of 23-valent pneumococcal polysaccharide vaccine in HIV-infected pregnant women and kinetics of passively acquired antibodies in young infants

Whether gestational immunization of HIV-infected mothers with the 23-valent pneumococcal polysaccharide vaccine (PPV) confers maternal and infant early life, passive protection is not known. We evaluated safety, immunogenicity and placental transfer of antibodies in 44 HIV-infected women. Pneumococcal IgG antibodies against serotypes 1, 3, 5, 613, 9V, and 14 were measured in mothers (pre-vaccination and at delivery), and infants (at birth, 1, 2, 3, and 6 months). PPV was safe and immunogenic in mothers. Newborns received 46-72% of maternal antibody titers. Overall, infants had antibody levels lower than protective by 2 months of age. Alternative pneumococcal vaccination of HIV-infected pregnant women should be explored with the aim of prolonging passive protection in their infants. (C) 2009 Elsevier Ltd. All rights reserved.

Use of cholesterol-rich nanoparticles that bind to lipoprotein receptors as a vehicle to paclitaxel in the treatment of breast cancer: pharmacokinetics, tumor uptake and a pilot clinical study

Purpose In animal experiments paclitaxel oleate associated with a cholesterol-rich nanoemulsion concentrated in the neoplastic tissues and showed reduced toxicity and increased antitumor activity compared with paclitaxel-Cremophor EL. Here, a clinical study was performed in breast cancer patients to evaluate the tumoral uptake, pharmacokinetics and toxicity of paclitaxel associated to nanoemulsions. Methods Twenty-four hours before mastectomy [(3)H]paclitaxel oleate associated with [(14)C]-cholesteryl oleatenanoemulsion or [(3)H]- paclitaxel in Cremophor EL were injected into five patients for collection of blood samples and fragments of tumor and normal breast tissue. A pilot clinical study of paclitaxel-nanoemulsion administered at 3-week intervals was performed in four breast cancer patients with refractory advanced disease at 175 and 220 mg/m(2) dose levels. Results T(1/2) of paclitaxel oleate associated to the nanoemulsion was greater than that of paclitaxel (t(1/2) = 15.4 +/- 4.7 and 3.5 +/- 0.80 h). Uptake of the [(14)C]-cholesteryl ester nanoemulsion and [(3)H]- paclitaxel oleate by breast malignant tissue was threefold greater than the normal breast tissue and toxicity was minimal at the two dose levels. Conclusions Our results suggest that the paclitaxel-nanoemulsion preparation can be advantageous for use in the treatment of breast cancer because the pharmacokinetic parameters are improved, the drug is concentrated in the neoplastic tissue and the toxicity of paclitaxel is reduced.

Fed State Protein Turnover in Healthy Older Persons under a Usual Protein-Rich Diet

The objective of this study was to verify the protein turnover rates of healthy older persons under a usual protein-rich diet and to compare values to those described in the literature. This cross-sectional study was conducted at Metabolism Unit, Univ. Hospital of the School of Medicine of Ribeirao Preto, Univ. of Sao Paulo, Brazil. In this study, 7 healthy older persons aged 65.4 +/- 2.8 y, with BMI 22.7 +/- 2.4 kg/m(2) and a mean daily protein intake of 1.34 g of protein/kg were studied. A 9-h whole-body (15)N-glycine single-dose study was performed after an overnight fast. During the study, each subject received 6 isoenergetic, isonitrogenous meals at 2-h intervals based on their average intake. Ammonium, urea, and total nitrogen were quantified and analyzed by mass spectrometry, with the determination of total protein turnover rates by the (15)N-glycine method. The results show that total nitrogen output was 3.2 +/- 0.96 g/N and intake 7.7 +/- 1 g/N, (15)N nitrogen flux was 30.6 +/- 6.3 g/9 h. Endogenous nitrogen balance was positive (4.5g +/- g/N in 9 h). In conclusion, the protein turnover of healthy older persons under a usual protein-rich diet is positive during the fed state and has synthesis and degradation rates similar to those previously described in studies involving diet adaptation periods.