Simultaneous measurement of temperature and external refractive index by use of a hybrid grating in D fiber with enhanced sensitivity by HF etching

We propose a dual-parameter optical sensor device achieved by UV inscription of a hybrid long-period grating-fiber Bragg grating structure in D fiber. The hybrid configuration permits the detection of the temperature from the latter's response and measurement of the external refractive index from the former's response. In addition, the host D fiber permits effective modification of the device's sensitivity by cladding etching. The grating sensor has been used to measure the concentrations of aqueous sugar solutions, demonstrating its potential capability to detect concentration changes as small as 0.01%.

Turning Passive Detection Systems into Field Experiments: An Application Using Wetland Fishes and Enclosures to Track Fine-Scale Movement and Habitat Choice

Understanding habitat selection and movement remains a key question in behavioral ecology. Yet, obtaining a sufficiently high spatiotemporal resolution of the movement paths of organisms remains a major challenge, despite recent technological advances. Observing fine-scale movement and habitat choice decisions in the field can prove to be difficult and expensive, particularly in expansive habitats such as wetlands. We describe the application of passive integrated transponder (PIT) systems to field enclosures for tracking detailed fish behaviors in an experimental setting. PIT systems have been applied to habitats with clear passageways, at fixed locations or in controlled laboratory and mesocosm settings, but their use in unconfined habitats and field-based experimental setups remains limited. In an Everglades enclosure, we continuously tracked the movement and habitat use of PIT-tagged centrarchids across three habitats of varying depth and complexity using multiple flatbed antennas for 14 days. Fish used all three habitats, with marked species-specific diel movement patterns across habitats, and short-lived movements that would be likely missed by other tracking techniques. Findings suggest that the application of PIT systems to field enclosures can be an insightful approach for gaining continuous, undisturbed and detailed movement data in unconfined habitats, and for experimentally manipulating both internal and external drivers of these behaviors.

Data-Driven Motion Detection and Characterization in PET Brain Scans Using List Mode

Head motion during a Positron Emission Tomography (PET) brain scan can considerably degrade image quality. External motion-tracking devices have proven successful in minimizing this effect, but the associated time, maintenance, and workflow changes inhibit their widespread clinical use. List-mode PET acquisition allows for the retroactive analysis of coincidence events on any time scale throughout a scan, and therefore potentially offers a data-driven motion detection and characterization technique. An algorithm was developed to parse list-mode data, divide the full acquisition into short scan intervals, and calculate the line-of-response (LOR) midpoint average for each interval. These LOR midpoint averages, known as “radioactivity centroids,” were presumed to represent the center of the radioactivity distribution in the scanner, and it was thought that changes in this metric over time would correspond to intra-scan motion.

Several scans were taken of the 3D Hoffman brain phantom on a GE Discovery IQ PET/CT scanner to test the ability of the radioactivity to indicate intra-scan motion. Each scan incrementally surveyed motion in a different degree of freedom (2 translational and 2 rotational). The radioactivity centroids calculated from these scans correlated linearly to phantom positions/orientations. Centroid measurements over 1-second intervals performed on scans with ~1mCi of activity in the center of the field of view had standard deviations of 0.026 cm in the x- and y-dimensions and 0.020 cm in the z-dimension, which demonstrates high precision and repeatability in this metric. Radioactivity centroids are thus shown to successfully represent discrete motions on the submillimeter scale. It is also shown that while the radioactivity centroid can precisely indicate the amount of motion during an acquisition, it fails to distinguish what type of motion occurred.

External quality assessment of BRAF molecular analysis in melanoma

The availability of BRAF inhibitors has given metastatic melanoma patients an effective new treatment choice and molecular testing to determine the presence or absence of a BRAF codon 600 mutation is pivotal in the clinical management of these patients. This molecular test must be performed accurately and appropriately to ensure that the patient receives the most suitable treatment in a timely manner. Laboratories have introduced such testing; however, some experience low sample throughput making it critical that an external quality assurance programme is available to help promote a high standard of testing, reporting and provide an educational aspect for BRAF molecular testing. Laboratories took part in three rounds of external quality assessment (EQA) during a 12-month period giving participants a measure of the accuracy of genotyping, clinical interpretation of the result and experience in testing a range of different samples. Formalin fixed paraffin embedded tissue sections from malignant melanoma patients were distributed to participants for BRAF molecular testing. The standard of testing was generally high but distribution of a mutation other than the most common, p.(Val600Glu), highlighted concerns with detection or reporting of the presence of rarer mutations. The main issues raised in the interpretation of the results were the importance of clear unambiguous interpretation of the result tailored to the patient and the understanding that the treatment is different from that given to other stratified medicine programmes. The variability in reporting and wide range of methodologies used indicate a continuing need for EQA in this field.

Real-time anomaly detection of gamma-ray bursts for the Cherenkov Telescope Array using deep learning

The Cherenkov Telescope Array (CTA) will be the next-generation ground-based observatory to study the universe in the very-high-energy domain. The observatory will rely on a Science Alert Generation (SAG) system to analyze the real-time data from the telescopes and generate science alerts. The SAG system will play a crucial role in the search and follow-up of transients from external alerts, enabling multi-wavelength and multi-messenger collaborations. It will maximize the potential for the detection of the rarest phenomena, such as gamma-ray bursts (GRBs), which are the science case for this study. This study presents an anomaly detection method based on deep learning for detecting gamma-ray burst events in real-time. The performance of the proposed method is evaluated and compared against the Li&Ma standard technique in two use cases of serendipitous discoveries and follow-up observations, using short exposure times. The method shows promising results in detecting GRBs and is flexible enough to allow real-time search for transient events on multiple time scales. The method does not assume background nor source models and doe not require a minimum number of photon counts to perform analysis, making it well-suited for real-time analysis. Future improvements involve further tests, relaxing some of the assumptions made in this study as well as post-trials correction of the detection significance. Moreover, the ability to detect other transient classes in different scenarios must be investigated for completeness. The system can be integrated within the SAG system of CTA and deployed on the onsite computing clusters. This would provide valuable insights into the method's performance in a real-world setting and be another valuable tool for discovering new transient events in real-time. Overall, this study makes a significant contribution to the field of astrophysics by demonstrating the effectiveness of deep learning-based anomaly detection techniques for real-time source detection in gamma-ray astronomy.

Determination Of Flavanones In Orange Juices Obtained From Different Sources By Hplc/dad.

Flavanones (hesperidin, naringenin, naringin, and poncirin) in industrial, hand-squeezed orange juices and from fresh-in-squeeze machines orange juices were determined by HPLC/DAD analysis using a previously described liquid-liquid extraction method. Method validation including the accuracy was performed by using recovery tests. Samples (36) collected from different Brazilian locations and brands were analyzed. Concentrations were determined using an external standard curve. The limits of detection (LOD) and the limits of quantification (LOQ) calculated were 0.0037, 1.87, 0.0147, and 0.0066 mg 100 g(-1) and 0.0089, 7.84, 0.0302, and 0.0200 mg 100 g(-1) for naringin, hesperidin, poncirin, and naringenin, respectively. The results demonstrated that hesperidin was present at the highest concentration levels, especially in the industrial orange juices. Its average content and concentration range were 69.85 and 18.80-139.00 mg 100 g(-1). The other flavanones showed the lowest concentration levels. The average contents and concentration ranges found were 0.019, 0.01-0.30, and 0.12 and 0.1-0.17, 0.13, and 0.01-0.36 mg 100 g(-1), respectively. The results were also evaluated using the principal component analysis (PCA) multivariate analysis technique which showed that poncirin, naringenin, and naringin were the principal elements that contributed to the variability in the sample concentrations.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Preservation Of The External Jugular Vein In Bilateral Radical Neck Dissections: Technique In Two Cases And Review Of The Literature.

Context. The possibility of cephalic venous hypertension with the resultant facial edema and elevated cerebrospinal fluid pressure continues to challenge head and neck surgeons who perform bilateral radical neck dissections during simultaneous or staged procedures. Case Report. The staged procedure in patients who require bilateral neck dissections allows collateral venous drainage to develop, mainly through the internal and external vertebral plexuses, thereby minimizing the risks of deleterious consequences. Nevertheless, this procedure has disadvantages, such as a delay in definitive therapy, the need for a second hospitalization and anesthesia, and the risk of cutting lymphatic vessels and spreading viable cancer cells. In this paper, we discuss the rationale and feasibility of preserving the external jugular vein. Considering the limited number of similar reports in the literature, two cases in which this procedure was accomplished are described. The relevant anatomy and technique are reviewed and the patients' outcomes are discussed. Conclusion. Preservation of the EJV during bilateral neck dissections is technically feasible, fast, and safe, with clinically and radiologically demonstrated patency.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Combined External Pressure And Cu-substitution Studies On Bafe2as2 Single Crystals.

We report a combined study of external pressure and Cu-substitution on BaFe2As2 single crystals grown by the in-flux technique. At ambient pressure, the Cu-substitution is known to suppress the spin density wave (SDW) phase in pure BaFe2As2(TSDW ≈ 140 K) and to induce a superconducting (SC) dome with a maximum transition temperature [Formula: see text]. This [Formula: see text] is much lower than the Tc ∼ 15-28 K achieved in the case of Ru, Ni and Co substitutions. Such a lower Tc is attributed to a Cu(2+) magnetic pair-breaking effect. The latter is strongly suppressed by applied pressure, as shown herein, Tc can be significantly enhanced by applying high pressures. In this work, we investigated the pressure effects on Cu(2+) magnetic pair-breaking in the BaFe2-xCuxAs2 series. Around the optimal concentration (xopd = 0.11), all samples showed a substantial increase of Tc as a function of pressure. Yet for those samples with a slightly higher doping level (over-doped regime), Tc presented a dome-like shape with maximum Tc ≃ 8 K. Remarkably interesting, the under-doped samples, e.g. x = 0.02 display a maximum pressure induced Tc ≃ 30 K which is comparable to the maximum Tc's found for the pure compound under external pressures. Furthermore, the magnetoresistance effect as a function of pressure in the normal state of the x = 0.02 sample also presented an evolution consistent with the screening of the Cu(2+) local moments. These findings demonstrate that the Cu(2+) magnetic pair-breaking effect is completely suppressed by applying pressure in the low concentration regime of Cu(2+) substituted BaFe2As2.

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Large apical periodontitis healing following root canal dressing with calcium hydroxide: a case report

PURPOSE: The objective of this paper is to report the clinical case of a patient who presented a chronic apical periodontitis, arising from internal inflammatory resorption followed by pulp necrosis, and a long-term success of a root canal therapy using calcium hydroxide as root canal dressing. CASE DESCRIPTION: A 20-year-old male patient presented for routine dental treatment. By radiographic examination we noted an extensive radioluscent area, laterally to the permanent maxillary right lateral incisor, with possibility of communication with the lateral periodontium, suggestive of a chronic apical periodontitis. Due to external root resorption detection, we used a calcium hydroxide root canal dressing, changed every 15 days, for a period of 2 months. Root canal filling was performed using gutta-percha cones by lateral condensation technique Radiographic follow up held after 19 years of treatment indicated a periodontium in conditions of normality, with the presence of lamina dura. CONCLUSION: Calcium hydroxide is a suitable material to be used as root canal dressing in teeth with apical periodontitis. Long-term evaluation demonstrated the satisfactory clinical outcome following root canal treatment.