892 resultados para Consensus Sequence


Relevância:

60.00% 60.00%

Publicador:

Resumo:

Defects in the interleukin-2 receptor gamma (IL-2R gamma) chain in the man result in an X-linked severe combined immunodeficiency, SCIDX1, characterized by an absence of T-cell differentiation. This phenotype may result from pertubations in IL-2, IL-4-, IL-7- or IL-15-mediated signaling, as the IL-2R gamma chain forms an integral component of these receptor systems. We have isolated and characterized cDNA and genomic clones for the murine IL-2R gamma. The gene (Il2rg) is well conserved between mouse and man with respect to overall structure and size, and contains regions of high conservation in the promoter region as well. Il2rg maps to mouse X chromosome region 40, in a region of synteny with human Xq12-13.1. We have also explored the expression of the IL-2R gamma during thymocyte development. IL-2R gamma transcripts are detected in the earliest thymocyte precursor cells and persist throughout intrathymic development into the mature peripheral compartment. Genomic clones for the murine IL-2R gamma will allow for further studies on the regulation and function of this gene in vivo.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Summary Cell therapy has emerged as a strategy for the treatment of various human diseases. Cells can be transplanted considering their morphological and functional properties to restore a tissue damage, as represented by blood transfusion, bone marrow or pancreatic islet cells transplantation. With the advent of the gene therapy, cells also were used as biological supports for the production of therapeutic molecules that can act either locally or at distance. This strategy represents the basis of ex vivo gene therapy characterized by the removal of cells from an organism, their genetic modification and their implantation into the same or another individual in a physiologically suitable location. The tissue or biological function damage dictates the type of cells chosen for implantation and the required function of the implanted cells. The general aim of this work was to develop an ex vivo gene therapy approach for the secretion of erythropoietin (Epo) in patients suffering from Epo-responsive anemia, thus extending to humans, studies previously performed with mouse cells transplanted in mice and rats. Considering the potential clinical application, allogeneic primary human cells were chosen for practical and safety reasons. In contrast to autologous cells, the use of allogeneic cells allows to characterize a cell lineage that can be further transplanted in many individuals. Furthermore allogeneic cells avoid the potential risk of zoonosis encountered with xenogeneic cells. Accordingly, the immune reaction against this allogeneic source was prevented by cell macro- encapsulation that prevents cell-to-cell contact with the host immune system and allows to easy retrieve the implanted device. The first step consisted in testing the survival of various human primary cells that were encapsulated and implanted for one month in the subcutaneous tissue of immunocompetent and naturally or therapeutically immunodepressed mice, assuming that xenogeneic applications constitute a stringent and representative screening before human transplantation. A fibroblast lineage from the foreskin of a young donor, DARC 3.1 cells, showed the highest mean survival score. We have then performed studies to optimize the manufacturing procedures of the encapsulation device for successful engraftment. The development of calcifications on the polyvinyl alcohol (PVA) matrix serving as a scaffold for enclosed cells into the hollow fiber devices was reported after one month in vivo. Various parameters, including matrix rinsing solutions, batches of PVA and cell lineages were assessed for their respective role in the development of the phenomenon. We observed that the calcifications could be totally prevented by using ultra-pure sterile water instead of phosphate buffer saline solution in the rinsing procedure of the PVA matrix. Moreover, a higher lactate dehydrogenase activity of the cells was found to decrease calcium depositions due to more acidic microenvironment, inhibiting the calcium precipitation. After the selection of the appropriate cell lineage and the optimization of encapsulation conditions, a retroviral-based approach was applied to DARC 3.1 fibroblasts for the transduction of the human Epo cDNA. Various modifications of the retroviral vector and the infection conditions were performed to obtain clinically relevant levels of human Epo. The insertion of a post-transcriptional regulatory element from the woodchuck hepatitis virus as well as of a Kozak consensus sequence led to a 7.5-fold increase in transgene expression. Human Epo production was further optimized by increasing the multiplicity of infection and by selecting high producer cells allowing to reach 200 IU hEpo/10E6 cells /day. These modified cells were encapsulated and implanted in vivo in the same conditions as previously described. All the mouse strains showed a sustained increase in their hematocrit and a high proportion of viable cells were observed after retrieval of the capsules. Finally, in the perspective of human application, a syngeneic model using encapsulated murine myoblasts transplanted in mice was realized to investigate the roles of both the host immune response and the cells metabolic requirements. Various loading densities and anti-inflammatory as well as immunosuppressive drugs were studied. The results showed that an immune process is responsible of cell death in capsules loaded at high cell density. A supporting matrix of PVA was shown to limit the cell density and to avoid early metabolic cell death, preventing therefore the immune reaction. This study has led to the development of encapsulated cells of human origin producing clinically relevant amounts of human EPO. This work resulted also to the optimization of cell encapsulation technical parameters allowing to begin a clinical application in end-stage renal failure patients. Résumé La thérapie cellulaire s'est imposée comme une stratégie de traitement potentiel pour diverses maladies. Si l'on considère leur morphologie et leur fonction, les cellules peuvent être transplantées dans le but de remplacer une perte tissulaire comme c'est le cas pour les transfusions sanguines ou les greffes de moelle osseuse ou de cellules pancréatiques. Avec le développement de la thérapie génique, les cellules sont également devenues des supports biologiques pour la production de molécules thérapeutiques. Cette stratégie représente le fondement de la thérapie génique ex vivo, caractérisée par le prélèvement de cellules d'un organisme, leur modification génétique et leur implantation dans le même individu ou dans un autre organisme. Le choix du type de cellule et la fonction qu'elle doit remplir pour un traitement spécifique dépend du tissu ou de la fonction biologique atteintes. Le but général de ce travail est de développer .une approche par thérapie génique ex vivo de sécrétion d'érythropoïétine (Epo) chez des patients souffrant d'anémie, prolongeant ainsi des travaux réalisés avec des cellules murines implantées chez des souris et des rats. Dans cette perpective, notre choix s'est porté sur des cellules humaines primaires allogéniques. En effet, contrairement aux cellules autologues, une caractérisation unique de cellules allogéniques peut déboucher sur de nombreuses applications. Par ailleurs, l'emploi de cellules allogéniques permet d'éviter les riques de zoonose que l'on peut rencontrer avec des cellules xénogéniques. Afin de protéger les cellules allogéniques soumises à une réaction immunitaire, leur confinement dans des macro-capsules cylindriques avant leur implantation permet d'éviter leur contact avec les cellules immunitaires de l'hôte, et de les retrouver sans difficulté en cas d'intolérance ou d'effet secondaire. Dans un premier temps, nous avons évalué la survie de différentes lignées cellulaires humaines primaires, une fois encapsulées et implantées dans le tissu sous-cutané de souris, soit immunocompétentes, soit immunodéprimées naturellement ou par l'intermédiaire d'un immunosuppresseur. Ce modèle in vivo correspond à des conditions xénogéniques et représente par conséquent un environnement de loin plus hostile pour les cellules qu'une transplantation allogénique. Une lignée fibroblastique issue du prépuce d'un jeune enfant, nommée DARC 3 .1, a montré une remarquable résistance avec un score de survie moyen le plus élevé parmi les lignées testées. Par la suite, nous nous sommes intéressés aux paramètres intervenant dans la réalisation du système d'implantation afin d'optimaliser les conditions pour une meilleure adaptation des cellules à ce nouvel environnement. En effet, en raison de l'apparition, après un mois in vivo, de calcifications au niveau de la matrice de polyvinyl alcohol (PVA) servant de support aux cellules encapsulées, différents paramètres ont été étudiés, tels que les procédures de fabrication, les lots de PVA ou encore les lignées cellulaires encapsulées, afin de mettre en évidence leur rôle respectif dans la survenue de ce processus. Nous avons montré que l'apparition des calcifications peut être totalement prévenue par l'utilisation d'eau pure au lieu de tampon phosphaté lors du rinçage des matrices de PVA. De plus, nous avons observe qu'un taux de lactate déshydrogénase cellulaire élevé était corrélé avec une diminution des dépôts de calcium au sein de la matrice en raison d'un micro-environnement plus acide inhibant la précipitation du calcium. Après sélection de la lignée cellulaire appropriée et de l'optimisation des conditions d'encapsulation, une modification génétique des fibroblastes DARC 3.1 a été réalisée par une approche rétrovirale, permettant l'insertion de l'ADN du gène de l'Epo dans le génome cellulaire. Diverses modifications, tant au niveau génétique qu'au niveau des conditions d'infection, ont été entreprises afin d'obtenir des taux de sécrétion d'Epo cliniquement appropriés. L'insertion dans la séquence d'ADN d'un élément de régulation post¬transcriptionnelle dérivé du virus de l'hépatite du rongeur (« woodchuck ») ainsi que d'une séquence consensus appelée « Kozak » ont abouti à une augmentation de sécrétion d'Epo 7.5 fois plus importante. De même, l'optimisation de la multiplicité d'infection et la sélection plus drastique des cellules hautement productrices ont permis finalement d'obtenir une sécrétion correspondant à 200 IU d'Epo/10E6 cells/jour. Ces cellules génétiquement modifiées ont été encapsulées et implantées in vivo dans les mêmes conditions que celles décrites plus haut. Toutes les souris transplantées ont montré une augmentation significative de leur hématocrite et une proportion importante de cellules présentait une survie conservée au moment de l'explantation des capsules. Finalement, dans la perspective d'une application humaine, un modèle syngénique a été proposé, basé sur l'implantation de myoblastes murins encapsulés dans des souris, afin d'investiguer les rôles respectifs de la réponse immunitaire du receveur et des besoins métaboliques cellulaires sur leur survie à long terme. Les cellules ont été encapsulées à différentes densités et les animaux transplantés se sont vus administrer des injections de molécules anti-inflammatoires ou immunosuppressives. Les résultats ont démontré qu'une réaction immunologique péri-capsulaire était à la base du rejet cellulaire dans le cas de capsules à haute densité cellulaire. Une matrice de PVA peut limiter cette densité et éviter une mort cellulaire précoce due à une insuffisance métabolique et par conséquent prévenir la réaction immunitaire. Ce travail a permis le développement de cellules encapsulées d'origine humaine sécrétant des taux d'Epo humaine adaptés à des traitements cliniques. De pair avec l'optimalisation des paramètres d'encapsulation, ces résultats ont abouti à l'initiation d'une application clinique destinée à des patients en insuffisance rénale terminale.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The ability to determine the location and relative strength of all transcription-factor binding sites in a genome is important both for a comprehensive understanding of gene regulation and for effective promoter engineering in biotechnological applications. Here we present a bioinformatically driven experimental method to accurately define the DNA-binding sequence specificity of transcription factors. A generalized profile was used as a predictive quantitative model for binding sites, and its parameters were estimated from in vitro-selected ligands using standard hidden Markov model training algorithms. Computer simulations showed that several thousand low- to medium-affinity sequences are required to generate a profile of desired accuracy. To produce data on this scale, we applied high-throughput genomics methods to the biochemical problem addressed here. A method combining systematic evolution of ligands by exponential enrichment (SELEX) and serial analysis of gene expression (SAGE) protocols was coupled to an automated quality-controlled sequence extraction procedure based on Phred quality scores. This allowed the sequencing of a database of more than 10,000 potential DNA ligands for the CTF/NFI transcription factor. The resulting binding-site model defines the sequence specificity of this protein with a high degree of accuracy not achieved earlier and thereby makes it possible to identify previously unknown regulatory sequences in genomic DNA. A covariance analysis of the selected sites revealed non-independent base preferences at different nucleotide positions, providing insight into the binding mechanism.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Accurate prediction of transcription factor binding sites is needed to unravel the function and regulation of genes discovered in genome sequencing projects. To evaluate current computer prediction tools, we have begun a systematic study of the sequence-specific DNA-binding of a transcription factor belonging to the CTF/NFI family. Using a systematic collection of rationally designed oligonucleotides combined with an in vitro DNA binding assay, we found that the sequence specificity of this protein cannot be represented by a simple consensus sequence or weight matrix. For instance, CTF/NFI uses a flexible DNA binding mode that allows for variations of the binding site length. From the experimental data, we derived a novel prediction method using a generalised profile as a binding site predictor. Experimental evaluation of the generalised profile indicated that it accurately predicts the binding affinity of the transcription factor to natural or synthetic DNA sequences. Furthermore, the in vitro measured binding affinities of a subset of oligonucleotides were found to correlate with their transcriptional activities in transfected cells. The combined computational-experimental approach exemplified in this work thus resulted in an accurate prediction method for CTF/NFI binding sites potentially functioning as regulatory regions in vivo.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Approximately 520 Wilson disease-causing mutations in the ATP7B gene have been described to date. In this study we report DNA and RNA analyses carried out for molecular characterization of a consensus sequence splicing mutation found in homozygosity in a Swiss Wilson disease patient. RNA analysis of 1946 +6 T→C in both the peripheral lymphoblasts and liver resulted in the production in the propositus of only an alternative transcript lacking exons 6, 7, and 8 resulting most likely in alterations of cell biochemistry and disease. The patient presents an early form of severe hepatic disease characterized by hepatosplenomegaly, reduced hepatic function, anemia and thrombocytopenia indicating that 1946 +6 T→C is a severe mutation. Since identical results were obtained from both peripheral lymphoblasts and liver they also suggest that RNA studies of illegitimate transcripts can be safely used for molecular characterization of ATP7B splicing mutations, thus improving genetic counseling and diagnosis of Wilson disease. Moreover these studies, contribute to reveal the exact molecular mechanisms producing Wilson disease.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

MHC class II (MHCII) genes are transactivated by the NOD-like receptor (NLR) family member CIITA, which is recruited to SXY enhancers of MHCII promoters via a DNA-binding "enhanceosome" complex. NLRC5, another NLR protein, was recently found to control transcription of MHC class I (MHCI) genes. However, detailed understanding of NLRC5's target gene specificity and mechanism of action remained lacking. We performed ChIP-sequencing experiments to gain comprehensive information on NLRC5-regulated genes. In addition to classical MHCI genes, we exclusively identified novel targets encoding non-classical MHCI molecules having important functions in immunity and tolerance. ChIP-sequencing performed with Rfx5(-/-) cells, which lack the pivotal enhanceosome factor RFX5, demonstrated its strict requirement for NLRC5 recruitment. Accordingly, Rfx5-knockout mice phenocopy Nlrc5 deficiency with respect to defective MHCI expression. Analysis of B cell lines lacking RFX5, RFXAP, or RFXANK further corroborated the importance of the enhanceosome for MHCI expression. Although recruited by common DNA-binding factors, CIITA and NLRC5 exhibit non-redundant functions, shown here using double-deficient Nlrc5(-/-)CIIta(-/-) mice. These paradoxical findings were resolved by using a "de novo" motif-discovery approach showing that the SXY consensus sequence occupied by NLRC5 in vivo diverges significantly from that occupied by CIITA. These sequence differences were sufficient to determine preferential occupation and transactivation by NLRC5 or CIITA, respectively, and the S box was found to be the essential feature conferring NLRC5 specificity. These results broaden our knowledge on the transcriptional activities of NLRC5 and CIITA, revealing their dependence on shared enhanceosome factors but their recruitment to distinct enhancer motifs in vivo. Furthermore, we demonstrated selectivity of NLRC5 for genes encoding MHCI or related proteins, rendering it an attractive target for therapeutic intervention. NLRC5 and CIITA thus emerge as paradigms for a novel class of transcriptional regulators dedicated for transactivating extremely few, phylogenetically related genes.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The calcitonin receptor-like receptor (CRLR) and receptor activity modifying protein-3 (RAMP3) can assemble into a CRLR/RAMP3 heterodimeric receptor that exhibits the characteristics of a high affinity adrenomedullin receptor. RAMP3 participates in adrenomedullin (AM) binding via its extracellular N-terminus characterized by the presence of six highly conserved cysteine residues and four N-glycosylation consensus sites. Here, we assessed the usage of these conserved residues in cotranslational modifications of RAMP3 and addressed their role in functional expression of the CRLR/RAMP3 receptor. Using a Xenopus oocyte expression system, we show that (i) RAMP3 is assembled with CRLR as a multiple N-glycosylated species in which two, three, or four consensus sites are used; (ii) elimination of all N-glycans in RAMP3 results in a significant inhibition of receptor [(125)I]AM binding and an increase in the EC(50) value for AM; (iii) several lines of indirect evidence indicate that each of the six cysteines is involved in disulfide bond formation; (iv) when all cysteines are mutated to serines, RAMP3 is N-glycosylated at all four consensus sites, suggesting that disulfide bond formation inhibits N-gylcosylation; and (v) elimination of all cysteines abolishes adrenomedullin binding and leads to a complete loss of receptor function. Our data demonstrate that cotranslational modifications of RAMP3 play a critical role in the function of the CRLR/RAMP3 adrenomedullin receptor.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Azole resistance in Candida albicans can be mediated by the upregulation of the ATP binding cassette transporter genes CDR1 and CDR2. Both genes are regulated by a cis-acting element called the drug-responsive element (DRE), with the consensus sequence 5'-CGGAWATCGGATATTTTTTT-3', and the transcription factor Tac1p. In order to analyze in detail the DRE sequence necessary for the regulation of CDR1 and CDR2 and properties of TAC1 alleles, a one-hybrid system was designed. This system is based on a P((CDR2))-HIS3 reporter system in which complementation of histidine auxotrophy can be monitored by activation of the reporter system by CDR2-inducing drugs such as estradiol. Our results show that most of the modifications within the DRE, but especially at the level of CGG triplets, strongly reduce CDR2 expression. The CDR2 DRE was replaced by putative DREs deduced from promoters of coregulated genes (CDR1, RTA3, and IFU5). Surprisingly, even if Tac1p was able to bind these putative DREs, as shown by chromatin immunoprecipitation, those from RTA3 and IFU5 did not functionally replace the CDR2 DRE. The one-hybrid system was also used for the identification of gain-of-function (GOF) mutations either in TAC1 alleles from clinical C. albicans isolates or inserted in TAC1 wild-type alleles by random mutagenesis. In all, 17 different GOF mutations were identified at 13 distinct positions. Five of them (G980E, N972D, A736V, T225A, and N977D) have already been described in clinical isolates, and four others (G980W, A736T, N972S, and N972I) occurred at already-described positions, thus suggesting that GOF mutations can occur in a limited number of positions in Tac1p. In conclusion, the one-hybrid system developed here is rapid and powerful and can be used for characterization of cis- and trans-acting elements in C. albicans.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Major histocompatibility complex (MHC) molecules are of crucial importance for the immune system to recognize and defend the body against external attacks. Foreign antigens are presented by specialized cells, called antigen presenting cells, to T lymphocytes in the context of MHC molecules, thereby inducing T cell activation. In addition, MHC molecules are essential for Natural Killer (NK) cell biology, playing a role in NK cell education and activation. Recently, the NOD-like receptor (NLR) family member NLRC5 (NLR caspase recruitment domain containing protein 5) was found to act as transcriptional regulator of MHC class I, in particular in T and NK cells. Its role in MHC class I expression is however minor in dendritic cells (DCs). This raised the question of whether inflammatory conditions, which augment the levels of NLRC5 in DCs, could increase its contribution to MHC class I expression. Our work shows that MHC class I transcript and intracellular levels depend on NLRC5, while its role in MHC class I surface expression is instead negligible. We describe however a general salvage mechanism that enables cells with low intracellular MHC class I levels to nevertheless maintain relatively high MHC class I on the cell surface. In addition, we lack a thorough understanding of NLRC5 target gene specificity and mechanism of action. Our work delineates the unique consensus sequence in MHC class I promoters required for NLRC5 recruitment and pinpoints conserved features conferring its specificity. Furthermore, through genome-wide analyses, we confirm that NLRC5 regulates classical MHC class I genes and identify novel target genes all encoding non-classical MHC class I molecules exerting an array of functions in immunity and tolerance. We finally asked why a dedicated factor co-regulates MHC class I expression specifically in T and NK lymphocytes. We show that deregulated NLRC5 expression affects the education of NK cells and alters the crosstalk between T and NK cells, leading to NK cell-mediated killing of T lymphocytes. Altogether this thesis work brings insights into molecular and physiological aspects of NLRC5 function, which might help understand certain aspects of immune responses and disorders. -- Les molécules du complexe majeur d'histocompatibilité (CMH) sont essentielles au système immunitaire pour l'initiation de la réponse immunitaire. En effet, l'activation des lymphocytes T nécessite la reconnaissance d'un antigène étranger présenté par les cellules présentatrices d'antigènes sur une molécule du CMH. Les molécules du CMH ont également un rôle fondamental pour la fonction des cellules Natural Killer (NK) puisqu'elles sont nécessaires à leur processus d'éducation et d'activation. Récemment, NLRC5 (NLR caspase recruitment domain containing protein 5), un membre de la famille des récepteurs de type NOD (NLRs), a été décrit comme un facteur de transactivation de l'expression des gènes du CMH de classe I. A l'état basai, cette fonction transcriptionnelle est essentielle dans les lymphocytes T et NK, alors que ce rôle reste mineur pour l'expression des molécules du CMH de classe I dans les cellules dendritiques (DCs). Dans des conditions inflammatoires, l'expression de NLRC5 augmente dans les DCs. Notre travail démontre que, dans ces conditions, les transcrits et les niveaux intracellulaires des molécules du CMH de classe I augmentent aussi d'une façon dépendante de NLRC5. A contrario, le rôle de NLRC5 sur les niveaux de molécules de surface reste minoritaire. Cette observation nous a conduits à l'identification d'un mécanisme général de compensation qui permet aux cellules de maintenir des niveaux relativement élevés de molécules de CMH de class I à leur surface malgré de faibles niveaux intracellulaires. De plus, il semblait nécessaire de s'orienter vers une approche plus globale afin de déterminer l'étendue de la fonction transcriptionnelle de NLRC5. Par une approche du génome entier, nous avons pu décrire une séquence consensus conservée présente dans les promoteurs des gènes du CMH de classe I, sur laquelle NLRC5 est spécifiquement recruté. Nous avons pu également identifier de nouveaux gènes cibles codant pour des molécules de CMH de classe I non classiques impliqués dans l'immunité et la tolérance. Finalement, nous nous sommes demandé quel est l'intérêt d'avoir un facteur transcriptionnel, en l'occurrence NLRC5, qui orchestre l'expression du CMH de classe I dans les lymphocytes T et NK. Nous montrons que la dérégulation de l'expression de NLRC5 affecte l'éducation des cellules NK et conduit à la mort cellulaire des lymphocytes T médiée par les cellules NK. Dans l'ensemble ce travail de thèse contribue à la caractérisation du rôle de NLRC5, tant au niveau moléculaire que physiologique, ce qui présente un intérêt dans le cadre de la compréhension de certains aspects physiopathologique de la réponse immunitaire.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Bovine coronavirus (BCoV) causes severe diarrhea in newborn calves, is associated with winter dysentery in adult cattle and respiratory infections in calves and feedlot cattle. The BCoV S protein plays a fundamental role in viral attachment and entry into the host cell, and is cleaved into two subunits termed S1 (amino terminal) and S2 (carboxy terminal). The present study describes a strategy for the sequencing of the BCoV S1 gene directly from fecal diarrheic specimens that were previously identified as BCoV positive by RT-PCR assay for N gene detection. A consensus sequence of 2681 nucleotides was obtained through direct sequencing of seven overlapping PCR fragments of the S gene. The samples did not undergo cell culture passage prior to PCR amplification and sequencing. The structural analysis was based on the genomic differences between Brazilian strains and other known BCoV from different geographical regions. The phylogenetic analysis of the entire S1 gene showed that the BCoV Brazilian strains were more distant from the Mebus strain (97.8% identity for nucleotides and 96.8% identity for amino acids) and more similar to the BCoV-ENT strain (98.7% for nucleotides and 98.7% for amino acids). Based on the phylogenetic analysis of the hypervariable region of the S1 subunit, these strains clustered with the American (BCoV-ENT, 182NS) and Canadian (BCQ20, BCQ2070, BCQ9, BCQ571, BCQ1523) calf diarrhea and the Canadian winter dysentery (BCQ7373, BCQ2590) strains, but clustered on a separate branch of the Korean and respiratory BCoV strains. The BCoV strains of the present study were not clustered in the same branch of previously published Brazilian strains (AY606193, AY606194). These data agree with the genealogical construction and suggest that at least two different BCoV strains are circulating in Brazil.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Diplonema papillatum est un organisme unicellulaire qui vit dans l’océan. Son génome mitochondrial possède une caractéristique spéciale: tous les gènes sont brisés en de multiples fragments qui s’appellent modules. Chaque module est codé par un chromosome différent. L’expression d’un gène exige des épissages-en-trans qui assemblent un ARN messager complet à partir de tous les modules du gène. Nous avons précédemment montré que le gène cox1 est encodé dans neuf modules avec six Us non encodés entre le module 4 et le module 5 de l’ARN messager mature [1]. Nous n’avons identifié aucune séquence consensus connue de site d’épissage près des modules. Nous spéculons qu’un ARN guide (gRNA) a dirigé l’épissage-en-trans du gène cox1 par un mécanisme qui est semblable à l’édition d’ARN par l’insertion/la suppression des Us chez les kinétoplastides, le groupe sœur des diplonémides. Nous avons trouvé que les six Us sont ajoutés au bout 3’ de l’ARN d’une façon semblable à ceux ajoutés par le TUTase lors de l’édition de l’insertion des Us chez les kinétoplastides. Nous avons construit des profils de gRNA de l’épissage-en-trans avec les expressions régulières basé sur notre connaissance des gRNAs dans l’édition d’ARN chez les kinétoplastides. Selon la complémentarité partielle entre le gRNA et les deux modules adjacents, nous avons généré des amorces pour RT-PCR visant à détecter des séquences qui sont assorties à un des profils de gRNA. Une expérience pilote in vitro n’a pas permis de reconstituer l’épissage-en-trans des modules 3, 4, et 5, suggérant que nous devons améliorer nos techniques.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

La toxine thermostable d’E.coli (STb) est une cause de diarrhée chez l’homme et l’animal. STb se lie au sulfatide, son récepteur, puis s’internalise. Dans le cytoplasme, par une cascade d’événements, STb déclenche l’ouverture des canaux ioniques permettant la sécrétion des ions et la perte d’eau menant à la diarrhée. Les jonctions serrées forment une barrière physique intercellulaire dans les cellules épithéliales intestinales, contrôlant ainsi le flux paracellulaire des ions et de l’eau. Les jonctions serrées sont affectées par divers pathogènes et par leurs toxines. À ce jour, l’effet de STb sur les jonctions serrées n’a pas été étudié. L’étude entreprise visait à explorer l’effet de STb sur les jonctions serrées et la barrière épithéliale des cellules intestinales. Des cellules épithéliales intestinales du colon humain (T84) ont été traitées pendant 24h soit avec la toxine STb purifiée soit avec une souche d’E.coli exprimant STb. La résistance transépithéliale (TER), le flux de marqueurs paracellulaires et la microscopie confocale ont été utilisés pour analyser les effets de STb sur les jonctions serrées. Les monocouches traitées par la souche E.coli exprimant STb et la toxine STb purifiée ont manifesté une forte réduction de TER (p<0.0001) parallèlement à une augmentation significative de la perméabilité paracellulaire à l’Albumine de Sérum Bovin marqué avec l’IsoThioCyanate Fluoroscéine, BSA-FITC (p<0.0001) comparativement aux cellules non traitées et aux cellules traitées par une souche d’E.coli commensale non-toxinogène. L’augmentation de la perméabilité paracellulaire induite par STb a été associée à une dissolution générale et une condensation des fibres de stress centrales des filaments d’actine. Le réarrangement des filaments d’actine a été accompagné par une redistribution et une fragmentation des protéines des jonctions serrées dont l’occludine, la claudine-1 et la Zonula Occludens-1. Les mêmes modifications on été observées après l’intoxication des cellules T84 avec un octapeptide synthétique retrouvé dans la séquence de STb correspondant à une séquence consensus de la toxine ZOT de Vibrio cholerae, impliquée dans la réorganisation des jonctions serrées. Cet effet n’a pas été observé lorsque les cellules ont été traitées avec un octapeptide synthétique comportant les mêmes acides aminés mais distribués de façon aléatoire ou avec la toxine mutée (D30V). Nos résultats montrent pour la première fois que STb induit le dysfonctionnement de la barrière épithéliale intestinale en modifiant la distribution des protéines des jonctions serrées. Ces résultats ouvrent une nouvelle voie pour la compréhension de la pathogenèse de diarrhée causée par la toxine STb.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Background: The hepatitis C virus (HCV) non-structural 5A protein (NS5A) contains a highly conserved C-terminal polyproline motif with the consensus sequence Pro-X-X- Pro-X-Arg that is able to interact with the Src-homology 3 (SH3) domains of a variety of cellular proteins. Results: To understand this interaction in more detail we have expressed two N-terminally truncated forms of NS5A in E. coli and examined their interactions with the SH3 domain of the Src-family tyrosine kinase, Fyn. Surface plasmon resonance analysis revealed that NS5A binds to the Fyn SH3 domain with what can be considered a high affinity SH3 domain-ligand interaction (629 nM), and this binding did not require the presence of domain I of NS5A (amino acid residues 32-250). Mutagenic analysis of the Fyn SH3 domain demonstrated the requirement for an acidic cluster at the C-terminus of the RT-Src loop of the SH3 domain, as well as several highly conserved residues previously shown to participate in SH3 domain peptide binding. Conclusion: We conclude that the NS5A: Fyn SH3 domain interaction occurs via a canonical SH3 domain binding site and the high affinity of the interaction suggests that NS5A would be able to compete with cognate Fyn ligands within the infected cell.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Unlike nuclear localization signals, there is no obvious consensus sequence for the targeting of proteins to the nucleolus. The nucleolus is a dynamic subnuclear structure which is crucial to the normal operation of the eukaryotic cell. Studying nucleolar trafficking signals is problematic as many nucleolar retention signals (NoRSs) are part of classical nuclear localization signals (NLSs). In addition, there is no known consensus signal with which to inform a study. The avian infectious bronchitis virus (IBV), coronavirus nucleocapsid (N) protein, localizes to the cytoplasm and the nucleolus. Mutagenesis was used to delineate a novel eight amino acid motif that was necessary and sufficient for nucleolar retention of N protein and colocalize with nucleolin and fibrillarin. Additionally, a classical nuclear export signal (NES) functioned to direct N protein to the cytoplasm. Comparison of the coronavirus NoRSs with known cellular and other viral NoRSs revealed that these motifs have conserved arginine residues. Molecular modelling, using the solution structure of severe acute respiratory (SARS) coronavirus N-protein, revealed that this motif is available for interaction with cellular factors which may mediate nucleolar localization. We hypothesise that the N-protein uses these signals to traffic to and from the nucleolus and the cytoplasm.