971 resultados para Chromosomal Instability
Resumo:
Background and aim: E-cadherin binds to beta-catenin to form the cadherin/catenin complex required for strong cell adhesion. Inactivation of this complex in tumors facilitates invasion into surrounding tissues. Alterations of both proteins have been reported in hepatocellular carcinomas (HCC). However, the interactions between E-cadherin and beta-catenin in HCC from different geographical groups have not been explored. The aim of the present study was to assess the role of E-cadherin and beta-catenin in Australian and South African patients with HCC. Methods: DNA was extracted from malignant and non-malignant liver tissue from 37 Australian and 24 South African patients, and from histologically normal liver from 20 transplant donors. Chromosomal instability at 16q22, promoter methylation at E-cadherin, beta-catenin mutations and E-cadherin and beta-catenin protein expression was assessed using loss of heterozygosity, methylation-specific polymerase chain reaction, denaturing high-performance liquid chromatography and immunohistochemistry, respectively. Results: Loss of heterozygosity at 16q22 was prevalent in South African HCC patients (50%vs 11%; P < 0.05, chi(2)). In contrast, E-cadherin promoter hypermethylation was common in Australian cases in both malignant (30%vs 13%; P = not significant, chi(2)) and non-malignant liver (57%vs 8%, respectively, P < 0.001, chi(2)). Methylation of non-malignant liver was more likely to be detected in patients over the age of 50 years (P < 0.001, chi(2)), the overall mean age for our cohort of patients. Only one beta-catenin mutation was identified. E-cadherin protein expression was reduced in one HCC, while abnormalities in protein expression were absent in beta-catenin. Conclusion: Contrary to previous observations in HCC from other countries, neither E-cadherin nor beta-catenin appears to play a role in hepatocarcinogenesis in Australian and South African patients with HCC. (C) 2004 Blackwell Publishing Asia Pty Ltd.
Resumo:
Dissertação (mestrado)—Universidade de Brasília, Faculdade de Ciências da Saúde, Programa de Pós-Graduação em Ciências da Saúde, 2015.
Resumo:
Colorectal cancer (CRC) is the third most common cancer in the UK with 41,000 new cases diagnosed in 2011. Despite undergoing potentially curative resection, a significant amount of patients develop recurrence. Biomarkers that aid prognostication or identify patients who are suitable for adjuvant treatments are needed. The TNM staging system does a reasonably good job at offering prognostic information to the treating clinician, but it could be better and identifying methods of improving its accuracy are needed. Tumour progression is based on a complex relationship between tumour behaviour and the hosts’ inflammatory responses. Sustained tumour cell proliferation, evading growth suppressors, resisting apoptosis, replicative immortality, sustained angiogenesis, invasion & metastasis, avoiding immune destruction, deregulated cellular energetics, tumour promoting inflammation and genomic instability & mutation have been identified as hallmarks. These hallmarks are malignant behaviors are what makes the cell cancerous and the more extreme the behaviour the more aggressive the cancer the more likely the risk of a poor outcome. There are two primary genomic instability pathways: Microsatellite Instability (MSI) and Chromosomal Instability (CI) also referred to as Microsatellite Stability (MSS). Tumours arising by these pathways have a predilection for specific anatomical, histological and molecular biological features. It is possible that aberrant molecular expression of genes/proteins that promote malignant behaviors may also act as prognostic and predictive biomarkers, which may offer superior prognostic information to classical prognostic features. Cancer related inflammation has been described as a 7th hallmark of cancer. Despite the systemic inflammatory response (SIR) being associated with more aggressive malignant disease, infiltration by immune cells, particularly CD8+ lymphocytes, at the advancing edge of the tumour have been associated with improved outcome and tumour MSI. It remains unknown if the SIR is associated with tumour MSI and this requires further study. The mechanisms by which colorectal cancer cells locally invade through the bowel remain uncertain, but connective tissue degradation by matrix metalloproteinases (MMPs) such as MMP-9 have been implicated. MMP-9 has been found in the cancer cells, stromal cells and patient circulation. Although tumoural MMP-9 has been associated with poor survival, reports are conflicting and contain relatively small sample sizes. Furthermore, the influence of high serum MMP-9 on survival remains unknown. Src family kinases (SFKs) have been implicated in many adverse cancer cell behaviors. SFKs comprise 9 family members BLK, C-SRC, FGR, FYN, HCK, LCK, LYN, YES, YRK. C-SRC has been the most investigated of all SFKs, but the role of other SFKs in cellular behaviors and their prognostic value remains largely unknown. The development of Src inhibitors, such as Dasatinib, has identified SFKs as a potential therapeutic target for patients at higher risk of poor survival. Unfortunately, clinical trials so far have not been promising but this may reflect inadequate patient selection and SFKs may act as useful prognostic and predictive biomarkers. In chapter 3, the association between cancer related inflammation, tumour MSI, clinicopathological factors and survival was tested in two independent cohorts. A training cohort consisting of n=182 patients and a validation cohort of n=677 patients. MSI tumours were associated with a raised CRP (p=0.003). Hypoalbuminaemia was independently associated with poor overall survival in TNM stage II cancer (HR 3.04 (95% CI 1.44 – 6.43);p=0.004), poor recurrence free survival in TNM stage III cancer (HR 1.86 (95% 1.03 – 3.36);p=0.040) and poor overall survival in CI colorectal cancer (HR 1.49 (95% CI 1.06 – 2.10);p=0.022). Interestingly, MSI tumours were associated with poor overall survival in TNM stage III cancer (HR 2.20 (95% CI 1.10 – 4.37);p=0.025). In chapter 4, the role of MMP-9 in colorectal cancer progression and survival was examined. MMP-9 in the tissue was assessed using IHC and serum expression quantified using ELISA. Serum MMP-9 was associated with cancer cell expression (Spearman’s Correlation Coefficient (SCC) 0.393, p<0.001)) and stromal expression (SCC 0.319, p=0.002). Serum MMP-9 was associated with poor recurrence-free (HR 3.37 (95% CI 1.20 – 9.48);p=0.021) and overall survival (HR 3.16 (95% CI 1.22 – 8.15);p=0.018), but tumour MMP-9 was not survival or MSI status. In chapter 5, the role of SFK expression and activation in colorectal cancer progression and survival was studied. On PCR analysis, although LYN, C-SRC and YES were the most highly expressed, FGR and HCK had higher expression profiles as tumours progressed. Using IHC, raised cytoplasmic FAK (tyr 861) was independently associated with poor recurrence free survival in all cancers (HR 1.48 (95% CI 1.02 – 2.16);p=0.040) and CI cancers (HR 1.50 (95% CI 1.02 – 2.21);p=0.040). However, raised cytoplasmic HCK (HR 2.04 (95% CI 1.11 – 3.76);p=0.022) was independently associated with poor recurrence-free survival in TNM stage II cancers. T84 and HT29 cell lines were used to examine the cellular effects of Dasatinib. Cell viability was assessed using WST-1 assay and apoptosis assessed using an ELISA cell death detection assay. Dasatinib increased T84 tumour cell apoptosis in a dose dependent manner and resulted in reduced expression of nuclear (p=0.008) and cytoplasmic (p=0.016) FAK (tyr 861) expression and increased nuclear FGR expression (p=0.004). The results of this thesis confirm that colorectal cancer is a complex disease that represents several subtypes of cancer based on molecular biological behaviors. This thesis concentrated on features of the disease related to inflammation in terms of genetic and molecular characterisation. MSI cancers are closely associated with systemic inflammation but despite this observation, they retain their relatively improved survival. MMP-9 is a feature of tissue remodeling during inflammation and is also associated with degradation of connective tissue, advanced T-stage and poor outcome when measured in the serum. The lack of stromal quantification due to TMA use rather than full sections makes the value of tumoural MMP-9 immunoreactivity in the prognostication and its association with MSI unknown and requires further study. Finally, SFK activation was also associated with SIR, however, only cytoplasmic HCK was independently associated with poor survival in patients with TNM stage II disease, the group of patients where identifying a novel biomarker is most needed. There is still some way to go before these biomarkers are translated into clinical practice and future work needs to focus on obtaining a reliable and robust scientific technique with validation in an adequately powered independent cohort.
Resumo:
It has been proposed that common aphidicolin-inducible fragile sites, in general, predispose to specific chromosomal breakage associated with deletion, amplification, and/or translocation in certain forms of cancer. Although this appears to be the case for the fragile site FRA3B and may be the case for FRA7G, it is not Set clear whether this association is a general property of this class of fragile site. The major aim of the present study was to determine whether the FRA16D chromosomal fragile site locus has a role to play in predisposing DNA sequences within and adjacent to the fragile site to DNA instability (such as deletion or translocation), which could lead to or be associated with neoplasia. We report the localization of FRA16D within a contig of cloned DNA and demonstrate that this fragile site coincides with a region of homozygous deletion in a gastric adenocarcinoma cell line and is bracketed by translocation breakpoints in multiple myeloma, as reported previously (Chesi, M., et al., Blood, 91: 4457-4463, 1998), Therefore, given similar findings at the FRA3B and FRA7G fragile sites, it is likely that common aphidicolin-inducible fragile sites exhibit the general property of localized DNA instability in cancer cells.
Resumo:
Microsatellites are important highly polymorphic genetic markers dispersed in the human genome. Using a panel of 22 (CA)n repeat microsatellite markers mapped to recurrent breakpoint cluster regions specifically involved in leukemia, we investigated 114 adult leukemias (25 acute lymphocytic leukemia [ALL], 32 acute myeloid leukemia [AML], 36 chronic lymphocytic leukemia [CLL], and 21 chronic myeloid leukemia [CML] in chronic phase) for somatic mutations at these loci. In each patient, DNA from fresh leukemia samples was analyzed alongside normal constitutive DNA from buccal epithelium. We detected loss of heterozygosity (LOH) in 81 of 114 patients (ALL 16/25, AML 25/32, CLL 30/36, CML 10/21). Deletions were most often seen in ALL at 11q23 and 19p13; in AML at 8q22 and 11q23; in CLL at 13q14.3, 11q13, and 11q23; and in CML at 3q26. Only six deletions were reported in 74 karyotypes analyzed, whereas in these same cases, 91 LOH events were detected by microsatellites. Of 26 leukemias with a normal karyotype, 16 nevertheless showed at least one LOH by microsatellite analysis. Replication errors were found in 10 of 114 patients (8.8%). Thus, microsatellite instability is rare in leukemia in contrast to many solid tumors. Our findings suggest that in adult leukemia, LOH may be an important genetic event in addition to typical chromosomal translocations. LOH may point to the existence of tumor suppressor genes involved in leukemogenesis to a degree that has hitherto been underestimated.
Resumo:
Contemporary anticancer therapies have largely improved the outcome for children with cancer, especially for Acute Lymphoblastic Leukemia (ALL). Actually, between 78% and 85% of patients achieve complete remission and are alive after 5 years of therapy completion. However, as cure rates increase, new concerns about the late effects of genotoxic treatment emerge, being the risk of developing secondary neoplasias, the most serious life-threatening rising problem. In the present paper, we describe and review the cytogenetic findings in peripheral lymphocytes from ALL survivors, and discuss aspects associated to the occurrence of increased chromosome rearrangements in this growing cohort.
Resumo:
Sickle cell disease (SCD) is an inherited disorder caused by a single nucleotide substitution in the P-globin gene. The clinical heterogeneity observed in SCD patients has been attributed to environmental and genetic factors. The patients are subjected to increased oxidative stress, particularly during vaso-occlusive crises and acute chest pain. Another possible cause of oxidative stress in SCD is the high concentration of iron in the patients` plasma. The increase in oxidative stress could be a relevant risk factor for mutagenesis and carcinogenesis. Studies on the frequency of basal chromosomal aberrations in cultured lymphocytes from SCD patients have not been reported so far. In order to contribute to the understanding of the role of the different biomarkers and their relationship with the extremely variable clinical manifestation of SCD, we investigated the frequency of chromosome damage in peripheral lymphocytes from sickle cells patients and healthy controls. We found an increased frequency of chromosome damage and percentage of aberrant metaphases in these patients when compared with control subjects, even at basal values (p < 0.05). In the cytogenetic sensitivity assay, the results showed that these patients presented a marked decrease in the mitotic index values compared with healthy controls. Cisplatin-induced chromosomal damage in lymphocytes from these patients was significantly higher than the frequency measured in healthy controls. The results obtained in the present study showed that more investigations are needed in order to elucidate the susceptibility to genomic instability of SCD patients.
Resumo:
A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich similar to 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded similar to 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.
Resumo:
Fluorescence in situ hybridization of a tile path of DNA subclones has previously enabled the cytogenetic definition of the minimal DNA sequence which spans the FRA16D common chromosomal fragile site, located at 16q23.2. Homozygous deletion of the FRA16D locus has been reported in adenocarcinomas of stomach, colon, lung and ovary. We have sequenced the 270 kb containing the FRA16D fragile site and the minimal homozygously deleted region in tumour cells. This sequence enabled localization of some of the tumour cell breakpoints to regions which contain AT-rich secondary structures similar to those associated with the FRA10B and FRA16B rare fragile sites. The FRA16D DNA sequence also led to the identification of an alternatively spliced gene, named FOR (fragile site FRA16D oxidoreductase), exons of which span both the fragile site and the minimal region of homozygous deletion. In addition, the complete DNA sequence of the FRA16D-containing FOR intron reveals no evidence of additional authentic transcripts. Alternatively spliced FOR transcripts (FOR I, FOR II and FOR III) encode proteins which share N-terminal WW domains and differ at their C-terminus, with FOR III having a truncated oxidoreductase domain. FRA16D-associated deletions selectively affect the FOR gene transcripts. Three out of five previously mapped translocation breakpoints in multiple myeloma are also located within the FOR gene. FOR is therefore the principle genetic target for DNA instability at 16q23.2 and perturbation of FOR function is likely to contribute to the biological consequences of DNA instability at FRA16D in cancer cells.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
Wheat, although moderately tolerant to salt, can not be cultivated in many areas. However, in the triticeae tribe, some of the wild wheat relatives are highly tolerant, e.g. Thinopyrum bessarabicum, which grows on the sea shore. Eight primary hexaploid tritipyrum lines, amphiploids between Triticum durum and Thinopyrum bessarabicum have been produced which can set seed in at least 250 mM NaCl. These tritipyrums (2n=6x=42, AABBEbEb) due to reasons such as brittle rachis, continuous production of tillers, late maturity, tall stature and meiotic instability will not fulfill the requirements of a successful commercial salt tolerant crop. To overcome such problems the substituted tritipyrum, in which selected Eb chromosomes are replaced by D genome chromosomes of 6x wheat, was produced from 6x tritipyrum x 6x wheat hybrids (F1: 2n=6x=42, AABBDEb) followed by selfing and backcrossing with 6x tritipyrum. The fertile plants among the above progenies were screened by the genomic fluorescent in situ hybridization technique to identify their Eb and D chromosome constitution. This study showed that producing tritiprum with variable numbers of Eb and D genome chromosomes is feasible and that FISH is a useful technique for determining the number of Eb chromosomes present.
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Human adult stem cells (hASCs) offer a potentially renewable source of cell types that are easily isolated and rapidly expanded for use in regenerative medicine and cell therapies without the complicating ethical problems that are associated with embryonic stem cells. However, the eventual therapeutic use of hASCs requires that these cells and their derivatives maintain their genomic stability. There is currently a lack of systematic studies that are aimed at characterising aberrant chromosomal changes in cultured ASCs over time. However, the presence of mosaicism and accumulation of karyotypic abnormalities within cultured cell subpopulations have been reported. To investigate cytogenetic integrity of cultured human dental stem cell (hDSC) lines, we analysed four expanded hDSC cultures using classical G banding and fluorescent in situ hybridisation (FISH) with X chromosome specific probe. Our preliminary results revealed that about 70% of the cells exhibited karyotypic abnormalities including polyploidy, aneuploidy and ring chromosomes. The heterogeneous spectrum of abnormalities indicates a high frequency of chromosomal mutations that continuously arise upon extended culture. These findings emphasise the need for the careful analysis of the cytogenetic stability of cultured hDSCs before they can be used in clinical therapies.