X-ray properties of the Parkes sample of flat-spectrum radio sources: dust in radio-loud quasars?

We investigate the X-ray properties of the Parkes sample of Bat-spectrum radio sources using data from the ROSAT All-Sky Survey and archival pointed PSPC observations. In total, 163 of the 323 sources are detected. For the remaining 160 sources, 2 sigma upper limits to the X-ray flux are derived. We present power-law photon indices in the 0.1-2.4 keV energy band for 115 sources, which were determined either with a hardness ratio technique or from direct fits to pointed PSPC data if a sufficient number of photons were available. The average photon index is <Gamma > = 1.95(-0.12)(+0.13) for flat-spectrum radio-loud quasars, <Gamma > = 1.70(-0.24)(+0.23) for galaxies, and <Gamma > = 2.40(-0.31)(+0.12) for BL Lac objects. The soft X-ray photon index is correlated with redshift and with radio spectral index in the sense that sources at high redshift and/or with flat (or inverted) radio spectra have flatter X-ray spectra on average. The results are in accord with orientation-dependent unification schemes for radio-loud active galactic nuclei. Webster et al. discovered many sources with unusually red optical continua among the quasars of this sample, and interpreted this result in terms of extinction by dust. Although the X-ray spectra in general do not show excess absorption, we find that low-redshift optically red quasars have significantly lower soft X-ray luminosities on average than objects with blue optical continua. The difference disappears for higher redshifts, as is expected for intrinsic absorption by cold gas associated with the dust. In addition, the scatter in log(f(x)/f(o)) is consistent with the observed optical extinction, contrary to previous claims based on optically or X-ray selected samples. Although alternative explanations for the red optical continua cannot be excluded with the present X-ray data, we note that the observed X-ray properties are consistent with the idea that dust plays an important role in some of the radio-loud quasars with red optical continua.

A mathematical model for estimating the extent of solute- and water-flux heterogeneity in multiple sample percolation experiments

Multiple sampling is widely used in vadose zone percolation experiments to investigate the extent in which soil structure heterogeneities influence the spatial and temporal distributions of water and solutes. In this note, a simple, robust, mathematical model, based on the beta-statistical distribution, is proposed as a method of quantifying the magnitude of heterogeneity in such experiments. The model relies on fitting two parameters, alpha and zeta to the cumulative elution curves generated in multiple-sample percolation experiments. The model does not require knowledge of the soil structure. A homogeneous or uniform distribution of a solute and/or soil-water is indicated by alpha = zeta = 1, Using these parameters, a heterogeneity index (HI) is defined as root 3 times the ratio of the standard deviation and mean. Uniform or homogeneous flow of water or solutes is indicated by HI = 1 and heterogeneity is indicated by HI > 1. A large value for this index may indicate preferential flow. The heterogeneity index relies only on knowledge of the elution curves generated from multiple sample percolation experiments and is, therefore, easily calculated. The index may also be used to describe and compare the differences in solute and soil-water percolation from different experiments. The use of this index is discussed for several different leaching experiments. (C) 1999 Elsevier Science B.V. All rights reserved.

The Fornax spectroscopic survey I. Survey strategy and preliminary results on the redshift distribution of a complete sample of stars and galaxies

The Fornax Spectroscopic Survey will use the Two degree Field spectrograph (2dF) of the Angle-Australian Telescope to obtain spectra for a complete sample of all 14000 objects with 16.5 less than or equal to b(j) less than or equal to 19.7 in a 12 square degree area centred on the Fornax Cluster. The aims of this project include the study of dwarf galaxies in the cluster (both known low surface brightness objects and putative normal surface brightness dwarfs) and a comparison sample of background field galaxies. We will also measure quasars and other active galaxies, any previously unrecognised compact galaxies and a large sample of Galactic stars. By selecting all objects-both stars and galaxies-independent of morphology, we cover a much larger range of surface brightness and scale size than previous surveys. In this paper we first describe the design of the survey. Our targets are selected from UK Schmidt Telescope sky survey plates digitised by the Automated Plate Measuring (APM) facility. We then describe the photometric and astrometric calibration of these data and show that the APM astrometry is accurate enough for use with the 2dF. We also describe a general approach to object identification using cross-correlations which allows us to identify and classify both stellar and galaxy spectra. We present results from the first 2dF field. Redshift distributions and velocity structures are shown for all observed objects in the direction of Fornax, including Galactic stars? galaxies in and around the Fornax Cluster, and for the background galaxy population. The velocity data for the stars show the contributions from the different Galactic components, plus a small tail to high velocities. We find no galaxies in the foreground to the cluster in our 2dF field. The Fornax Cluster is clearly defined kinematically. The mean velocity from the 26 cluster members having reliable redshifts is 1560 +/- 80 km s(-1). They show a velocity dispersion of 380 +/- 50 km s(-1). Large-scale structure can be traced behind the cluster to a redshift beyond z = 0.3. Background compact galaxies and low surface brightness galaxies are found to follow the general galaxy distribution.

Osmolarity effects on observed insect cell size after baculovirus infection are avoided using growth medium for sample dilution

Rates of cell size increase are an important measure of success during the baculovirus infection process. Batch and fed batch cultures sustain large fluctuations in osmolarity that can affect the measured cell volume if this parameter is not considered during the sizing protocol. Where osmolarity differences between the sizing diluent and the culture broth exist, biased measurements of size are obtained as a result of the cell osmometer response. Spodoptera frugiperda (Sf9) cells are highly sensitive to volume change when subjected to a change in osmolarity. Use of the modified protocol with culture supernatants for sample dilution prior to sizing removed the observed error during measurement.

The Fornax Cluster Spectroscopic Survey: a sample of confirmed cluster dwarfs

The Fornax Cluster Spectroscopic Survey (FCSS) project utilizes the Two-degree Field (2dF) multi-object spectrograph on the Anglo-Australian Telescope (AAT). Its aim is to obtain spectra for a complete sample of all 14 000 objects with 16 5 less than or equal to b(j) less than or equal to 19 7 irrespective of their morphology in a 12 deg(2) area centred on the Fornax cluster. A sample of 24 Fornax cluster members has been identified from the first 2dF field (3.1 deg(2) in area) to be completed. This is the first complete sample of cluster objects of known distance with well-defined selection limits. Nineteen of the galaxies (with -15.8 < M-B < 12.7) appear to be conventional dwarf elliptical (dE) or dwarf S0 (dS0) galaxies. The other five objects (with -13.6 < M-B < 11.3) are those galaxies which were described recently by Drinkwater et al. and labelled 'ultracompact dwarfs' (UCDs). A major result is that the conventional dwarfs all have scale sizes alpha greater than or similar to 3 arcsec (similar or equal to300 pc). This apparent minimum scale size implies an equivalent minimum luminosity for a dwarf of a given surface brightness. This produces a limit on their distribution in the magnitude-surface brightness plane, such that we do not observe dEs with high surface brightnesses but faint absolute magnitudes. Above this observed minimum scale size of 3 arcsec, the dEs and dS0s fill the whole area of the magnitude-surface brightness plane sampled by our selection limits. The observed correlation between magnitude and surface brightness noted by several recent studies of brighter galaxies is not seen with our fainter cluster sample. A comparison of our results with the Fornax Cluster Catalog (FCC) of Ferguson illustrates that attempts to determine cluster membership solely on the basis of observed morphology can produce significant errors. The FCC identified 17 of the 24 FCSS sample (i.e. 71 per cent) as being 'cluster' members, in particular missing all five of the UCDs. The FCC also suffers from significant contamination: within the FCSS's field and selection limits, 23 per cent of those objects described as cluster members by the FCC are shown by the FCSS to be background objects.

EDD, the human orthologue of the hyperplastic discs tumour suppressor gene, is amplified and overexpressed in cancer

EDD (E3 isolated by differential display), located at chromosome 8q22.3, is the human orthologue of the Drosophila melanogaster tumour suppressor gene 'hyperplastic discs' and encodes a HECT domain E3 ubiquitin protein-ligase. To investigate the possible involvement of EDD in human cancer, several cancers from diverse tissue sites were analysed for allelic gain or loss (allelic imbalance, AI) at the EDD locus using an EDD-specific microsatellite, CEDD, and other polymorphic microsatellites mapped in the vicinity of the 8q22.3 locus. Of 143 cancers studied, 38 had AI at CEDD (42% of 90 informative cases). In 14 of these cases, discrete regions of imbalance encompassing 8q22.3 were present, while the remainder had more extensive 8q aberrations. AI of CEDD was most frequent in ovarian cancer (22/47 informative cases, 47%), particularly in the serous subtype (16/22, 73%), but was rare in benign and borderline ovarian tumours. AI was also common in breast cancer (31%), hepatocellular carcinoma (46%), squamous cell carcinoma of the tongue (50%) and metastatic melanoma (18%). AI is likely to represent amplification of the EDD gene locus rather than loss of heterozygosity, as quantitative RT-PCR and immunohistochemistry showed that EDD mRNA and protein are frequently overexpressed in breast and ovarian cancers, while among breast cancer cell lines EDD overexpression and increased gene copy number were correlated. These results demonstrate that AI at the EDD locus is common in a diversity of carcinomas and that the EDD gene is frequently overexpressed in breast and ovarian cancer, implying a potential role in cancer progression.

Process development for a recombinant Chinese Hamster Ovary (CHO) cell line utilizing a metal induced and amplified metallothionein expression system

The suspension Chinese Hamster Ovary cell line, 13-10-302, utilizing the metallothionein (MT) expression system producing recombinant human growth hormone (hGH) was studied in a serum-free and cadmium-free medium at different fermentation scales and modes of operation. Initial experiments were carried out to optimize the concentration of metal addition to induce the MT promoter. Subsequently, the cultivation of the 13-10-302 cell line was scaled up from spinner flasks into bioreactors, and the cultivation duration was extended with fed-batch and perfusion strategies utilizing 180 muM zinc to induce the promoter controlling expression of recombinant hGH. It was shown that a fed-batch process could increase the maximum cell numbers twofold, from 3.3 to 6.3 x 10(6) cell/mL, over those obtained in normal batch fermentations, and this coupled with extended fermentation times resulted in a fourfold increase in final hGH titer, from 135 +/- 15 to 670 +/- 70 mg/L at a specific productivity q(hGH) value of 12 pg cell(-1)d(-1). The addition of sodium butyrate increased the specific productivity of hGH in cells to a value of approximately 48 pg cell(-1)d(-1), resulting in a final hGH titer of over a gram per liter during fed-batch runs. A BioSep acoustic cell recycler was used to retain the cells in the bioreactor during perfusion operation. It was necessary to maintain the specific feeding rates (SFR) above a value of 0.2 vvd/(10(6) cell/mL) to maintain the viability and productivity of the 13-10-302 cells; under these conditions the viable cell number increased to over 107 cell/mL and resulted in a volumetric productivity of over 120 mg(hGH) L(-1)d(-1). Process development described in this work demonstrates cultivation at various scales and sustained high levels of productivity under cadmium free condition in a CHO cell line utilizing an inducible metallothionein expression system. (C) 2004 Wiley Periodicals, Inc.

Estimate of Dementia Prevalence in a Community Sample from Sao Paulo, Brazil

Aims: To estimate dementia prevalence and describe the etiology of dementia in a community sample from the city of Sao Paulo, Brazil. Methods: A sample of subjects older than 60 years was screened for dementia in the first phase. During the second phase, the diagnostic workup included a structured interview, physical and neurological examination, laboratory exams, a brain scan, and DSM-IV criteria diagnosis. Results: Mean age was 71.5 years (n = 1,563) and 58.3% had up to 4 years of schooling (68.7% female). Dementia was diagnosed in 107 subjects with an observed prevalence of 6.8%. The estimate of dementia prevalence was 12.9%, considering design effect, nonresponse during the community phase, and positive and negative predictive values. Alzheimer`s disease was the most frequent cause of dementia (59.8%), followed by vascular dementia (15.9%). Older age and illiteracy were significantly associated with dementia. Conclusions: The estimate of dementia prevalence was higher than previously reported in Brazil, with Alzheimer`s disease and vascular dementia being the most frequent causes of dementia. Dementia prevalence in Brazil and in other Latin American countries should be addressed by additional studies to confirm these higher dementia rates which might have a sizable impact on countries` health services. Copyright (C) 2008 S. Karger AG, Basel

The Parkes half-jansky flat-spectrum sample

We present a new sample of Parkes half-jansky flat-spectrum radio sources, having made a particular effort to find any previously unidentified sources. The sample contains 323 sources selected according to a flux limit of 0.5 Jy at 2.7 GHz, a spectral index measured between 2.7 and 5.0 GHz of alpha(2.7/5.0) > -0.5, where S(nu) proportional to nu(alpha), Galactic latitude \b\ > 20 degrees and -45 degrees < declination (B1950) < +10 degrees. The sample was selected from a region 3.90 steradians in area. We have obtained accurate radio positions for all the unresolved sources in this sample, and combined these with accurate optical positions from digitized photographic sky survey data to check all the optical identifications. We report new identifications based on R- and Kn-band imaging and new spectroscopic measurements of many of the sources. We present a catalogue of the 323 sources, of which 321 now have identified optical counterparts and 277 have measured spectral redshifts.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Sample-induced RF perturbations in high-field, high-resolution NMR spectroscopy

Conducting dielectric samples are often used in high-resolution experiments at high held. It is shown that significant amplitude and phase distortions of the RF magnetic field may result from perturbations caused by such samples. Theoretical analyses demonstrate the spatial variation of the RF field amplitude and phase across the sample, and comparisons of the effect are made for a variety of sample properties and operating field strengths. Although the effect is highly nonlinear, it tends to increase with increasing field strength, permittivity, conductivity, and sample size. There are cases, however, in which increasing the conductivity of the sample improves the homogeneity of the amplitude of the RF field across the sample at the expense of distorted RF phase. It is important that the perturbation effects be calculated for the experimental conditions used, as they have the potential to reduce the signal-to-noise ratio of NMR experiments and may increase the generation of spurious coherences. The effect of RF-coil geometry on the coherences is also modeled, with the use of homogeneous resonators such as the birdcage design being preferred, Recommendations are made concerning methods of reducing sample-induced perturbations. Experimental high-field imaging and high-resolution studies demonstrate the effect. (C) 1997 Academic Press.

Infrared seeded parametric four-wave mixing for sensitive detection of molecules

We have developed a sensitive resonant four-wave mixing technique based on two-photon parametric four-wave mixing with the addition of a phase matched ''seeder'' field. Generation of the seeder field via the same four-wave mixing process in a high pressure cell enables automatic phase matching to be achieved in a low pressure sample cell. This arrangement facilitates sensitive detection of complex molecular spectra by simply tuning the pump laser. We demonstrate the technique with the detection of nitric oxide down to concentrations more than 4 orders of magnitude below the capability of parametric four-wave mixing alone, with an estimated detection threshold of 10(12) molecules/cm(3).