Hypoxia-induced transcriptional regulation through chromatin modifications and NC2 function

In response to tumor hypoxia, specific genes that promote angiogenesis, proliferation, and survival are induced. Globally, I find that hypoxia induces a mixed pattern of histone modifications that are typically associated with either transcriptional activation or repression. Furthermore, I find that selective activation of hypoxia-inducible genes occurs simultaneously with widespread repression of transcription. I analyzed histone modifications at the core promoters of hypoxia-repressed and -activated genes and find that distinct patterns of histone modifications correlate with transcriptional activity. Additionally, I discovered that trimethylated H3-K4, a modification generally associated with transcriptional activation, is induced at both hypoxia-activated and repressed genes, suggesting a novel pattern of histone modifications induced during hypoxia. ^ In order to determine the mechanism of hypoxia-induced widespread repression of transcription, I focused my studies on negative cofactor 2 (NC2). Previously, we found that hypoxia-induced repression of the alpha-fetoprotein (AFP) gene occurs during preinitiation complex (PIC) assembly, and I find that NC2, an inhibitor of PIC assembly, is induced during hypoxia. Moreover, I find that the beta subunit of NC2 is essential for hypoxia-mediated repression of AFP, as well as the widespread repression of transcription observed during hypoxia. Previous data in Drosophila and S. cerevisiae indicate that NC2 functions as either an activator or a repressor of transcription. The mechanism of NC2-mediated activation remains unclear; although, Drosophila NC2 function correlates with specific core promoter elements. I tested if NC2 activates transcription in mammalian cells using this core promoter-specific model as a guide. Utilizing site-specific mutagenesis, I find that NC2 function in mammalian cells is not dependent upon specific core promoter elements; however, I do find that mammalian NC2 does function in a gene-specific manner as either an activator or repressor of transcription during hypoxia. Furthermore, I find that binding of the alpha subunit of NC2 specifically correlates with NC2-mediated transcriptional activation. NC2α and NC2β are both required for NC2-mediated transcriptional activation; whereas, NC2β alone is required for hypoxia-induced transcriptional repression. Together, these data indicate that hypoxia mediates changes in gene expression through both chromatin modifications and NC2 function. ^

Downstream targets of the Rhox5 homeobox gene

The X-linked mouse Rhox gene cluster contains over 30 homeobox genes that are candidates to regulate multiple steps in male and female gametogenesis. The founding member of the Rhox gene cluster, Rhox5, is an androgen-dependent gene expressed in Sertoli cells that promotes the survival and differentiation of the adjacent male germ cells. To decipher downstream signaling pathways of Rhox5, I used in vivo and in vitro microarray profiling to identify and characterize downstream targets of Rhox5 in the testis. This led to the identification of many Rhox5 -regulated genes, two of which I focused on in more detail. One of them, Unc5c, encodes a pro-apoptotic receptor with tumor suppressor activity that I found is negatively regulated by Rhox5 through a Rhox5-response element in the Unc5c 5' untranslated region (5' UTR). Examination of other mouse Rhox family members revealed that Rhox2 and Rhox3 also have the ability to downregulate Unc5c expression. The human RHOX protein RHOXF2 also had this ability, indicating that Unc5c repression is a conserved Rhox-dependent response. The repression of Unc5c expression by Rhox5 may, in part, mediate Rhox5's pro-survival function in the testis, as I found that Unc5c mutant mice have decreased germ cell apoptosis in the testis. This along with my other data leads me to propose a model in which Rhox5 is a negative regulator upstream of Unc5c in a Sertoli-cell pathway that promotes germ-cell survival. The other Rhox5-regulated gene that I studied in detail is insulin II (Ins2). Several lines of evidence, including electrophoretic mobility shift anaylsis, promoter mutagenesis, and chromatin immuoprecipitation analysis indicated that Ins2 is a direct target of Rhox5. Structure-function analysis identified homeodomain residues and the RHOX5 amino-terminal domain crucial for conferring Ins2 inducibility. Rhox5 regulates not only the Ins2 gene but also genes encoding other secreted proteins regulating metabolism (adiponectin and resistin), the rate-liming enzyme for monosaturated fatty acid biosynthesis (SCD-1), and transcription factors crucial for regulating metabolism (the nuclear hormone receptor PPARγ). I propose that the regulation of some or all of these molecules in Sertoli cells is responsible for the Rhox5-dependent survival of the adjacent germ cells. ^

The regulation of JAB1 and its role in herceptin resistance

The Jun activation domain-binding protein (JAB1) is a c-Jun co-activator and a member of the COP9 signalosome. Additionally, it has recently been named a key negative regulator of the cyclin-dependent kinase inhibitor, p27. JAB1 overexpression has been observed in breast cancer and correlates with low p27 levels as well as poor prognosis, yet the mechanism of JAB1 deregulation is unknown. Data from our laboratory suggest that constitutive transcriptional activation of the jab1 gene is responsible for JAB1 protein overexpression. Therefore, we hypothesized that overexpression of JAB1 in breast cancer can be attributed to increased transcriptional activity. To identify potential positive regulators of JAB1, we characterized the promoter and found a 128 bp region that was critical for jab1 transcriptional activation. Our studies show that two oncogenic transcription factors, C/EBPβ and STAT3, play an important role in modulating jab1 transcription. Further, we have identified jab1 as a direct target gene of the SRC/STAT3 pathway. These studies provide insight to the mechanism of JAB1 overexpression in breast cancer and open up possibilities for therapies to inhibit its expression. ^ The development of the humanized monoclonal antibody, Herceptin (trastuzumab) targeting the HER2 (ErbB2) receptor has provided promising treatment to patients with aggressive HER2 positive breast cancer. However, many patients are resistant to Herceptin and additional therapies are needed to overcome resistance. Recent findings indicate that one mechanism of resistance involves AKT phosphorylation and subsequent mislocalization of the cyclin dependent kinase inhibitor, p27. We examined whether JAB1 facilitated degradation of p27 may be another mechanism of resistance to Herceptin. Our studies show that overexpression of JAB1 inhibited Herceptin induced G1-arrest and p27 accumulation. Interestingly, increased JAB1 levels were observed in two BT-474 Herceptin resistant clones. Targeted silencing of JAB1 increased p27 protein levels, reinstated a G1 checkpoint, and reduced cellular proliferation in the resistant clones. Our studies have demonstrated that inhibition of JAB1 sensitizes Herceptin resistant cells to treatment. Therefore, inhibition of JAB1 could provide a novel method of sensitizing resistant tumors to Herceptin-induced tumor growth arrest. ^

The critical role and regulation of transcription factor FoxM1 in gastric cancer development and progression

The mammalian Forkhead Box (Fox) transcription factor (FoxM1) is implicated in tumorgenesis. However, the role and regulation of FoxM1 in gastric cancer remain unknown.^ I examined FoxM1 expression in 86 cases of primary gastric cancer and 57 normal gastric tissue specimens. I found weak expression of FoxM1 protein in normal gastric mucosa, whereas I observed strong staining for FoxM1 in tumor-cell nuclei in various gastric tumors and lymph node metastases. The aberrant FoxM1 expression is associated with VEGF expression and increased angiogenesis in human gastric cancer. A Cox proportional hazards model revealed that FoxM1 expression was an independent prognostic factor in multivariate analysis. Furthermore, overexpression of FoxM1 by gene transfer significantly promoted the growth and metastasis of gastric cancer cells in orthotopic mouse models, whereas knockdown of FoxM1 expression by small interfering RNA did the opposite. Next, I observed that alteration of tumor growth and metastasis by elevated FoxM1 expression was directly correlated with alteration of VEGF expression and angiogenesis. In addition, promotion of gastric tumorigenesis by FoxM1 directly and significantly correlated with transactivation of vascular endothelial growth factor (VEGF) expression and elevation of angiogenesis. ^ To further investigate the underlying mechanisms that result in FoxM1 overexpression in gastric cancer, I investigated FoxM1 and Krüppel-like factor 4 (KLF4) expressions in primary gastric cancer and normal gastric tissue specimens. Concomitance of increased expression of FoxM1 protein and decreased expression of KLF4 protein was evident in human gastric cancer. Enforced KLF4 expression suppressed FoxM1 protein expression. Moreover, a region within the proximal FoxM1 promoter was identified to have KLF4-binding sites. Finally, I found an increased FoxM1 expression in gastric mucosa of villin-Cre -directed tissue specific Klf4-null mice.^ In summary, I offered both clinical and mechanistic evidence that dysregulated expression of FoxM1 play an important role in gastric cancer development and progression, while KLF4 mediates negative regulation of FoxM1 expression and its loss significantly contributes to FoxM1 dysregulation. ^

Regulation of estrogen receptor alpha by the tumor suppressor p53 in breast cancer cells

Estrogen receptor (ER) and the tumor suppressor p53 are key prognostic indicators in breast cancer. Estrogen signaling through its receptor (ER) controls proliferation of normal as well as transformed mammary epithelial cells, and the presence of ER is established as a marker of good prognosis and response to therapy. The p53 tumor suppressor gene is often referred to as the "cellular gatekeeper" due to its extensive control of cell proliferation and apoptosis. Loss of functional p53 is a negative prognostic indicator and is correlated with lack of response to antiestrogens, reduced disease-free interval and increased chance of disease recurrence. Clinical studies have demonstrated that tumors with mutated p53 tend to be ER negative, while ER positive tumors tend to have wild type p53. ^ Recent studies from our lab indicate that p53 genotype correlates with estrogen receptor expression in mammary tumors in vivo. We therefore hypothesized that p53 regulates ER expression in mammary cancer cells by recruitment of specific cofactors to the ER promoter. To test this, MCF-7 cells were treated with doxorubicin or ionizing radiation, both of which stimulated significant increases in p53 expression, as expected, but also increased ER expression in a p53-dependent manner. Furthermore, in cells treated with siRNA targeting p53, both p53 and ER protein levels were significantly reduced. P53 was also demonstrated to transcriptionally regulate the ER promoter in luciferase assays and chromatin immunoprecipitation assays showed that p53 was recruited to the ER promoter along with CARM1, CBP, c-Jun and Sp1 and that this multifactor complex was formed in a p53-dependent manner. The regulation of ER by p53 has therapeutic implications, as the treatment of breast cancer cells with doxorubicin sensitized these cells to tamoxifen treatment. Furthermore, response to tamoxifen as well as to estrogen was dependent on p53 expression in ER positive human breast cancer cells. Taken together, these data demonstrate that p53 regulates ER expression through transcriptional control of the ER promoter, accounting for their concordant expression in human breast cancer and identifying potentially beneficial therapeutic strategies for the treatment of ER positive breast cancers. ^

Post-transcriptional Regulation of Mammalian Gene Expression in Non-coding Region of Target RNA

Tumor Suppressor Candidate 2 (TUSC2) is a novel tumor suppressor gene located in the human chromosome 3p21.3 region. TUSC2 mRNA transcripts could be detected on Northern blots in both normal lung and some lung cancer cell lines, but no endogenous TUSC2 protein could be detected in a majority of lung cancer cell lines. Mechanisms regulating TUSC2 protein expression and its inactivation in primary lung cancer cells are largely unknown. We investigated the role of the 5’- and 3’-untranslated regions (UTRs) of the TUSC2 gene in the regulation of TUSC2 protein expression. We found that two small upstream open-reading frames (uORFs) in the 5’UTR of TUSC2 could markedly inhibit the translational initiation of TUSC2 protein by interfering with the “scanning” of the ribosome initiation complexes. Site-specific stem-loop array reverse transcription-polymerase chain reaction (SLA-RT-PCR) verified several micoRNAs (miRNAs) targeted at 3’UTR and directed TUSC2 cleavage and degradation. In addition, we used the established let-7-targeted high mobility group A2 (Hmga2) mRNA as a model system to study the mechanism of regulation of target mRNA by miRNAs in mammalian cells under physiological conditions. There have been no evidence of direct link between mRNA downregulation and mRNA cleavages mediated by miRNAs. Here we showed that the endonucleolytic cleavages on mRNAs were initiated by mammalian miRNA in seed pairing style. Let-7 directed cleavage activities among the eight predicted potential target sites have varied efficiency, which are influenced by the positional and the structural contexts in the UTR. The 5’ cleaved RNA fragments were mostly oligouridylated at their 3’-termini and accumulated for delayed 5’–3’ degradation. RNA fragment oligouridylation played important roles in marking RNA fragments for delayed bulk degradation and in converting RNA degradation mode from 3’–5’ to 5’–3’ with cooperative efforts from both endonucleolytic and non-catalytic miRNA-induced silencing complex (miRISC). Our findings point to a mammalian miRNA-mediated mechanism for the regulation of mRNA that miRNA can decrease target mRNA through target mRNA cleavage and uridine addition

MUTATIONS IN STAT3 ASSOCIATED WITH HUMAN HYPER IgE SYNDROME ENHANCE NFκB AND MAPK-MEDIATED GENE EXPRESSION

Hyper IgE syndrome (HIES) is a multisystem disorder resulting in bone and immune system abnormalities. It is associated with mutations in STAT3, which disrupt protein domains responsible for transcriptional function. Patients with HIES display osteoporosis and enhanced inflammatory cytokine production similar to hematopoietic Stat3-deficient mice. Since osteoclast and inflammatory cytokine genes are NFκB targets, these observations indicate a possible deregulation of NFκB signaling in both mice and humans with STAT3-deficiency. Here, we sought to examine the role of STAT3 in the regulation of NFκB-mediated gene expression through analysis of three HIES STAT3 point mutations in both hematopoietic and non- hematopoietic cells. We found that IL-6-induced tyrosine phosphorylation of STAT3 was partially or completely abrogated by HIES mutations in the transactivation domain (V713L) or SH2 domain (V637M), respectively, in both hematopoietic and non- hematopoietic cells. By contrast, IL-6-induced tyrosine phosphorylation of an HIES mutant in the STAT3 DNA-binding domain (R382W) was intact. The R382W and V713L mutants significantly reduced IL-6-dependent STAT3 transcriptional activity in reporter gene assays. Moreover, the R382W and V637M mutants significantly diminished IL-6-responsive expression of the endogenous STAT3 target gene, Socs3, as assessed by quantitative real-time PCR (qPCR) in the RAW macrophage cell line. These observations indicate the HIES mutants dominantly suppress the transcriptional activity of wild type STAT3, albeit to varying degrees. All three HIES mutants enhanced LPS-induced expression of the NFκB target genes IL6 (IL-6), Cxcl10 (IP- 10), and Tnf (TNFα) in RAW cells, as indicated by qPCR. Furthermore, overexpression of wild type STAT3 in Stat3-deficient murine embryonic fibroblasts significantlyreduced LPS-stimulated expression of IL6, Cxcl10, and IL12p35. In addition, in aprimary murine osteoclast differentiation assay, a STAT3-specific SH2 domain inhibitor led to significantly increased levels of osteoclast-specific gene expression. These results suggest that STAT3 serves as a negative regulator of NFκB-mediated gene expression, and furthermore imply that STAT3 mutations associated with HIES contribute to the osteopenia and inflammation observed in HIES patients.

ROLE OF MIR-19A RELEASED BY INFLAMMATORY BREAST CANCER CELLS IN THE REGULATION OF DENDRITIC CELL FUNCTIONS: IN VITRO MODEL OF CROSSTALK IN THE TUMOR MICROENVIRONMENT OF INFLAMMATORY BREAST CANCER

Inflammatory breast cancer (IBC) is a rare but very aggressive form of locally advanced breast cancer (1-6% of total breast cancer patients in United States), with a 5-year overall survival rate of only 40.5%, compared with 85% of the non-IBC patients. So far, a unique molecular signature for IBC able to explain the dramatic differences in the tumor biology between IBC and non-IBC has not been identified. As immune cells in the tumor microenvironment plays an important role in regulating tumor progression, we hypothesized that tumor-associated dendritic cells (TADC) may be responsible for regulating the development of the aggressive characteristics of IBC. MiRNAs can be released into the extracellular space and mediate the intercellular communication by regulating target gene expression beyond their cells of origin. We hypothesized that miRNAs released by IBC cells can induce an increased activation status, secretion of pro-inflammatory cytokines and migration ability of TADC. In an in vitro model of IBC tumor microenvironment, we found that the co-cultured of the IBC cell line SUM-149 with immature dendritic cells (iDCSUM-149) induced a higher degree of activation and maturation of iDCSUM-149 upon stimulation with lipopolysaccharide (LPS) compared with iDCs co-cultured with the non-IBC cell line SUM-159 (iDCSUM-159), resulting in: increased expression of the costimulatory and activation markers; higher production of pro-inflammatory cytokines (TNF-a, IL-6); and 3) higher migratory ability. These differences were due to the exosome-mediated transfer of miR-19a and miR-146a from SUM-149 and SUM-159, respectively, to iDCs, causing the downregulation of the miR-19a target genes PTEN, SOCS-1 and the miR-146a target genes IRAK1, TRAF6. PTEN, SOCS-1 and IRAK1, TRAF6 are important negative and positive regulator of cytokine- and TLR-mediated activation/maturation signaling pathway in DCs. Increased levels of IL-6 induced the upregulation of miR-19a synthesis in SUM-149 cells that was associated with the induction of CD44+CD24-ALDH1+ cancer stem cells (CSCs) with epithelial-to-mesenchymal transition (EMT) characteristics. In conclusion, in IBC tumor microenvironment IL-6/miR-19a axis can represent a self-sustaining loop able to maintain a pro-inflammatory status of DCs, leading to the development of tumor cells with high metastatic potential (EMT CSCs) responsible of the poor prognosis in IBC patients.

Regulation of {\it neu\/} gene expression by the simian virus 40 large T antigen and tumor suppressors Rb and p53

The neu gene (also c-erbB-2 or HER2) encodes a 185 kilodalton protein that is frequently overexpressed in breast, ovarian and non-small cell lung cancers. Study of the regulation of neu indicates that neu gene expression can be modulated by c-myc or by the adenovirus 5 E1a gene product. This study demonstrates that the transforming protein, large T antigen, of the simian virus 40 represses neu promoter activity. Repression of neu by large T antigen is mediated through the region $-$172 to $-$79 (relative to first ATG) of the neu promoter--unlike through $-$312 to $-$172 for c-myc or E1a. This suggests a different pathway for repression of neu by large T antigen. The 10 amino acid region of large T required for binding the tumor suppressor, retinoblastoma gene product, Rb, is not necessary for repression of neu. Moreover, the tumor suppressors, Rb and p53 can independently inhibit neu promoter activity. Rb inhibits neu through a 10 base pair G-rich enhancer (GTG element) ($-$243 to $-$234) and also through regions close to transcription initiation sites ($-$172 to $-$79). Mutant Rb unable to complex large T is able to repress the region close to transcription initiation but not the GTG enhancer. Thus, Rb inhibits the two regulatory domains of the neu gene by different mechanisms. Both Rb and p53 can repress the transforming activity of activated neu in focus forming assays. These data provide evidence that tumor suppressors regulate expression of growth stimulatory genes such as neu. Therefore, one reason for the overexpression of neu that is frequently seen in breast cancer cells may be due to functional inactivation of Rb and p53 which is also a common occurrence in breast cancer cells. ^

Regulation of the {\it neu\/} oncogene by the GTG element binding proteins

A previous study in our lab has shown that the transforming neu oncogene ($neu\sp\*$) was able to initiate signals that lead to repression of the neu promoter activity. Further deletion mapping of the neu promoter identified that the GTG element (GGTGGGGGGG), located between $-$243 and $-$234 relative to the translation initiation codon, mediates such a repression effect. I have characterized the four major protein complexes that interact with this GTG element. In situ UV-crosslinking indicated that each complex contains proteins of different molecular weights. The slowest migrating complex (S) contain Sp1 or Sp1-related proteins, as indicated by the data that both have similar molecular weights, similar properties in two affinity chromatographies, and both are antigenically related in gel shift analysis. Methylation protection and interference experiments demonstrated these complexes bind to overlapping regions of the GTG element. Mutations within the GTG element that either abrogate or enhance complex S binding conferred on the neu promoter with lower activity, indicating that positive factors other than Sp1 family proteins also contribute to neu promoter activity. A mutated version (mutant 4) of the GTG element, which binds mainly the fastest migrating complex that contains a very small protein of 26-kDa, can repress transcription when fused to a heterologous promoter. Further deletion and mutation studies suggested that this GTG mutant and its binding protein(s) may cooperate with some DNA element within a heterologous promoter to lock the basal transcription machinery; such a repressor might also repress neu transcription by interfering with the DNA binding of other transactivators. Our results suggest that both positive and negative trans-acting factors converge their binding sites on the GTG element and confer combinatorial control on the neu gene expression. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Creation of a retinoblastoma mutant with dominant -negative activity

The Retinoblastoma tumor suppressor gene (RB) plays a role in a variety of human cancers. Experimental analyses have indicated that the protein product of the RB gene (pRb) plays a role in cell cycle regulation, and that this protein is required in cellular differentiation, senescence, and cell survival. pRb function is dependent on its ability to bind to cellular factors. There are multiple protein binding domains within pRb. Mutations within these domains which eliminate the ability of pRb to bind its targets result in loss of function. Loss of pRb function leads to tumorigenesis, although uncontrolled cellular proliferation is not a universal response to pRb inactivation. The ultimate response to the loss of pRb is influenced by both the genetic and epigenetic environments. Targeted disruption of RB in mice results in embryonic lethality, demonstrating the requirement for functional pRb in development. Close examination of various tissues from the embryos which lack wildtype RB shows problems in differentiation as well as showing induction of apoptosis. Although disruption of RB has provided useful information, complete inactivation of a gene precludes the possibility of discovering the functions that separate domains may have within the system. Creation of a dominant negative mutant by domain deletion whose phenotype is expressed in the presence of the wildtype may provide information about the intermediate functions of the protein. In addition, tissue specific targeting of a dominant negative mutant of pRb allows for comprehensive analysis of pRb function in organogenesis. In this thesis, a series of RB deletion mutants were created and tested for dominant negative activity as well as cellular localization. A tissue culture assay for dominant negative activity was developed which screens for the phenotype of apoptosis due to loss of pRb function. Two mutants from this series scored positive for dominant negative activity in this assay. The effect of these mutants within the assay environment can be explained by a model in which pRb acts as a facilitator of cell fate pathway decisions. ^

Transcriptional regulation of the rat {\it mdr1b\/} gene

The expression of P-glycoproteins encoded by the mdr gene family is associated with the emergence of multidrug-resistance phenotype in animal cells. This gene family includes two members, MDR1 and MDR2, in humans, and three members, mdr1a, mdr1b, and mdr2, in rodents. Among them, the rat mdr1b is known to be highly activated during hepatocarcinogenesis, and its expression is sensitive to the treatment with growth factors, cytotoxic drugs, as well as other physical or chemical stresses. It is believed that the transcriptional regulation plays an important role in above events, however little has been known about mechanisms involved.^ To elucidate how mdr1b expression is regulated, we isolated the genomic sequence of the rat mdr1b and functionally dissected its 5$\prime$ promoter region. Our results demonstrated that: (1) the transcription start site of the rat mdr1b is identical to that of the murine mdr1b homologue; (2) a palindromic sequence from bp $-$189 to $-$180 bp is essential for the basal promoter function of the rat mdr1b, and binds to a specific protein that appears to be a novel transcription factor implicated in the regulation of the rat mdr1b expression; (3) a NF-$\kappa$B-binding site from bp $-$167 to $-$159 is also involved in the basal promoter function. The p65/p50 subunits of the NF-$\kappa$B and raf-1 kinase are implicated in the insulin-inducible promoter activity of the mdr1b, suggesting the important role of NF-$\kappa$B in the regulation of the mdr1b by growth factors; (4) a p53-binding site from bp $-$199 to $-$180 is not only essential for the basal promoter activity but also responsible for the induction of mdr1b by cytotoxic agents. In addition, we provided evidence showing that endogenous mdr1b expression can be modulated by wild-type p53. On the basis of these findings, a model of transcriptional regulation of the rat mdr1b was proposed. ^

Mechanism of molecular regulation of nuclear -encoded mitochondrial gene expression by electrical stimulation in the cultured neonatal rat cardiac myocytes

To answer the question whether increased energy demand resulting from myocyte hypertrophy and enhanced $\beta$-myosin heavy chain mRNA, contractile protein synthesis and assembly leads to mitochondrial proliferation and differentiation, we set up an electrical stimulation model of cultured neonatal rat cardiac myocytes. We describe, as a result of increased contractile activity, increased mitochondrial profiles, cytochrome oxidase mRNA, and activity, as well as a switch in mitochondrial carnitine palmitoyltransferase-I (CPT-I) from the liver to muscle isoform. We investigate physiological pathways that lead to accumulation of gene transcripts for nuclear encoded mitochondrial proteins in the heart. Cardiomyocytes were stimulated for varying times up to 72 hr in serum-free culture. The mRNA contents for genes associated with transcriptional activation (c-fos, c-jun, junB, nuclear respiratory factor 1 (Nrf-1)), mitochondrial proliferation (cytochrome c (Cyt c), cytochrome oxidase), and mitochondrial differentiation (carnitine palmitonyltransferase I (CPT-I) isoforms) were measured. The results establish a temporal pattern of mRNA induction beginning with c-fos (0.25-3 hr) and followed by c-jun (0.5-3 hr), junB (0.5-6 hr), NRF-1 (1-12 hr), Cyt c (12-72 hr), cytochrome c oxidase (12-72 hr). Induction of the latter was accompanied by a marked decrease in the liver-specific CPT-I mRNA. Electrical stimulation increased c-fos, $\beta$-myosin heavy chain, and Cyt c promoter activities. These increases coincided with a rise in their respective endogenous gene transcripts. NRF-1, cAMP response element (CRE), and Sp-1 site mutations within the Cyt c promoter reduced luciferase expression in both stimulated and nonstimulated myocytes. Mutations in the Nrf-1 and CRE sites inhibited the induction by electrical stimulation or by transfection of c-jun into non-paced cardiac myocytes whereas mutation of the Sp-1 site maintained or increased the fold induction. This is consistent with the appearance of NRF-1 and fos/jun mRNAs prior to that of Cyt c. Overexpression of c-jun by transfection also activates the Nrf-1 and Cyt c mRNA sequentially. Electrical stimulation of cardiac myocytes activates the c-Jun-N-terminal kinase so that the fold-activation of the cyt c promoter is increased by pacing when either c-jun or c-fos/c-jun are cotransfected. We have identified physical association of Nrf-1 protein with the Nrf-1 enhancer element and of c-Jun with the CRE binding sites on the Cyt c promoter. This is the first demonstration that induction of Nrf-1 and c-Jun by pacing of cardiac myocytes directly mediates Cyt c gene expression and mitochondrial proliferation in response to hypertrophic stimuli in the heart.^ Subsequent to gene activation pathways that lead to mitochondrial proliferation, we observed an isoform switch in CPT-I from the liver to muscle mRNA. We have found that the half-life for the muscle CPT-I is not affected by electrical stimulation, but electrical decrease the T1/2 in the liver CPT-I by greater than 50%. This suggests that the liver CPT-I switch to muscle isoform is due to (1) a decrease in T1/2 of liver CPT-I and (2) activation of muscle CPT-Itranscripts by electrical stimulation. (Abstract shortened by UMI.) ^

Signaling pathways in the transcriptional and post-translational regulation of the human glutathione S -transferase P1 gene

The human glutathione S-transferase P1 (GSTP1) protein is an endogenous inhibitor of c-jun N-terminal kinases (JNKs) and an important phase II detoxification enzyme. ^ Recent identification of a cAMP response element (CRE) in the 5 ′-region of the human GSTP1 gene and several putative phosphorylation sites for the Ser/Thr protein kinases, including, cAMP-dependent protein kinases (PKAs), protein kinases C (PKCs), and JNKs in the GSTP1 protein raised the possibility that signaling pathways may play an important role in the transcriptional and post-translational regulation of GSTP1 gene. This study examined (a) whether the signaling pathway mediated by CAMP, via the GSTP1 CRE, is involved in the transcriptional regulation of the GSTP1 gene, (b) whether signaling pathways mediated by the Ser/Thr protein kinases (PKAs, PKCs, and JNKs) induce post-translational modification, viz. phosphorylation of the GSTP1 protein, and (c) whether such phosphorylation of the GSTP1 protein alters its functions in metabolism and in JNK signaling. ^ The first major finding in this study is the establishment of the human GSTP1 gene as a novel CAMP responsive gene in which transcription is activated via an interaction between PKA activated CRE binding protein-1 (CREB-1) and the CRE in the 5′-regulatory region. ^ The second major finding in this study is the observation that the GSTP1 protein undergoes phosphorylation and functionally activated by second messenger-activated protein kinases, PKA and PKC, in tumor cells with activated signaling pathways. Following phosphorylation by PKA or PKC, the catalytic activity of the GSTP1 protein was significantly enhanced, as indicated by a decrease in its Km (2- to 3.6-fold) and an increase in Kcat/ Km (1.6- to 2.5-fold) for glutathione. Given the frequent over-expression of GSTP1 and the aberrant PKA/PKC signaling cascade observed in tumors, these findings suggest that phosphorylation of GSTP1 may contribute to the malignant progression and drug-resistant phenotype of these tumors. ^ The third major finding in this study is that the GSTP1 protein, an inhibitor of JNKs, undergoes significant phosphorylation in tumor cells with activated JNK signaling pathway and in those under oxidative stress. Following phosphorylation by JNK, the ability of GSTP1 to inhibit JNK downstream function, i.e. c-jun phosphorylation, was significantly enhanced, suggesting a feedback mechanism of regulation of JNK-mediated cellular signaling. (Abstract shortened by UMI.) ^