914 resultados para audição normal
Resumo:
Thromboelastography (TEG®) provides a functional evaluation of coagulation. It has characteristics of an ideal coagulation test for trauma, but is not frequently used, partially due to lack of both standardized techniques and normal values. We determined normal values for our population, compared them to those of the manufacturer and evaluated the effect of gender, age, blood type, and ethnicity. The technique was standardized using citrated blood, kaolin and was performed on a Haemoscope 5000 device. Volunteers were interviewed and excluded if pregnant, on anticoagulants or having a bleeding disorder. The TEG® parameters analyzed were R, K, α, MA, LY30, and coagulation index. All volunteers outside the manufacturer’s normal range underwent extensive coagulation investigations. Reference ranges for 95% for 118 healthy volunteers were R: 3.8-9.8 min, K: 0.7-3.4 min, α: 47.8-77.7 degrees, MA: 49.7-72.7 mm, LY30: -2.3-5.77%, coagulation index: -5.1-3.6. Most values were significantly different from those of the manufacturer, which would have diagnosed coagulopathy in 10 volunteers, for whom additional investigation revealed no disease (81% specificity). Healthy women were significantly more hypercoagulable than men. Aging was not associated with hypercoagulability and East Asian ethnicity was not with hypocoagulability. In our population, the manufacturer’s normal values for citrated blood-kaolin had a specificity of 81% and would incorrectly identify 8.5% of the healthy volunteers as coagulopathic. This study supports the manufacturer’s recommendation that each institution should determine its own normal values before adopting TEG®, a procedure which may be impractical. Consideration should be given to a multi-institutional study to establish wide standard values for TEG®.
Resumo:
Micro-ribonucleic acids (microRNAs) are small molecules containing 20-23 nucleotides. Despite their small size, it is likely that almost every cellular process is regulated by them. Moreover, aberrant microRNA expression has been involved in the development of various diseases, including cancer. Although many data are available about the role of microRNAs in various lymphoproliferative disorders, their impact on the development of acute lymphoblastic leukemia of T-cell progenitors is largely unknown. In this review, we present recent information about how specific microRNAs are expressed and regulated during malignant T-lymphopoiesis and about their role during normal hematopoiesis.
Resumo:
Basic fibroblast growth factor (bFGF) regulates skin wound healing; however, the underlying mechanism remains to be defined. In the present study, we determined the effects of bFGF on the regulation of cell growth as well as collagen and fibronectin expression in fibroblasts from normal human skin and from hypertrophic scars. We then explored the involvement of mitochondria in mediating bFGF-inducedeffects on the fibroblasts. We isolated and cultivated normal and hypertrophic scar fibroblasts from tissue biopsies of patients who underwent plastic surgery for repairing hypertrophic scars. The fibroblasts were then treated with different concentrations of bFGF (ranging from 0.1 to 1000 ng/mL). The growth of hypertrophic scar fibroblasts became slower with selective inhibition of type I collagen production after exposure to bFGF. However, type III collagen expression was affected in both normal and hypertrophic scar fibroblasts. Moreover, fibronectin expression in the normal fibroblasts was up-regulated after bFGF treatment. bFGF (1000 ng/mL) also induced mitochondrial depolarization in hypertrophic scar fibroblasts (P < 0.01). The cellular ATP level decreased in hypertrophic scar fibroblasts (P < 0.05), while it increased in the normal fibroblasts following treatment with bFGF (P < 0.01). These data suggest that bFGF has differential effects and mechanisms on fibroblasts of the normal skin and hypertrophic scars, indicating that bFGF may play a role in the early phase of skin wound healing and post-burn scar formation.
Resumo:
Disturbances of the microcirculation and abnormal hemorheological properties are important factors that play an important role in disseminated intravascular coagulation (DIC) and result in organ dysfunction or failure. In the present study, we established an animal model of DIC using intravenous Dextran 500 in rats, and used exogenous normal lymph corresponding to 1/15 of whole blood volume for injection through the left jugular vein. We found that normal lymph could improve the blood pressure and survival time of rats with DIC. The results regarding the mesenteric microcirculation showed that the abnormality of the diameter of mesenteric microvessels and micro-blood flow speed in the DIC+lymph group was significantly less than in the DIC+saline group. Whole blood viscosity, relative viscosity, plasma viscosity, hematocrit (Hct), erythrocyte sedimentation rate (ESR), and electrophoresis time of erythrocytes were significantly increased in the DIC+saline group compared to the control group. The electrophoretic length and migration of erythrocytes from the DIC+saline and DIC+lymph groups were significantly slower than the control group. Blood relative viscosity, Hct, ESR, and electrophoretic time of erythrocytes were significantly increased in the DIC+lymph group compared to the control group. Whole blood viscosity, relative viscosity and reduced viscosity were significantly lower in the DIC+lymph group than in the DIC+saline group, and erythrocyte deformability index was also significantly higher than in the DIC+saline and control groups. These results suggest that exogenous normal lymph could markedly improve the acute microcirculation disturbance and the abnormal hemorheological properties in rats with DIC induced by Dextran 500.
Resumo:
The liver is one of the target organs damaged by septic shock, wherein the spread of endotoxins begins. This study aimed to investigate the effects of exogenous normal lymph (ENL) on lipopolysaccharide (LPS)-induced liver injury in rats. Male Wistar rats were randomly divided into sham, LPS, and LPS+ENL groups. LPS (15 mg/kg) was administered intravenously via the left jugular vein to the LPS and LPS+ENL groups. At 15 min after the LPS injection, saline or ENL without cell components (5 mL/kg) was administered to the LPS and LPS+ENL groups, respectively, at a rate of 0.5 mL/min. Hepatocellular injury indices and hepatic histomorphology, as well as levels of P-selectin, intercellular adhesion molecule 1 (ICAM-1), myeloperoxidase (MPO), and Na+-K+-ATPase, were assessed in hepatic tissues. Liver tissue damage occurred after LPS injection. All levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in plasma as well as the wet/dry weight ratio of hepatic tissue in plasma increased. Similarly, P-selectin, ICAM-1, and MPO levels in hepatic tissues were elevated, whereas Na+-K+-ATPase activity in hepatocytes decreased. ENL treatment lessened hepatic tissue damage and decreased levels of AST, ALT, ICAM-1, and MPO. Meanwhile, the treatment increased the activity of Na+-K+-ATPase. These results indicated that ENL could alleviate LPS-induced liver injury, thereby suggesting an alternative therapeutic strategy for the treatment of liver injury accompanied by severe infection or sepsis.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
Visando obter informações a respeito da estrutura dos grânulos, amidos de milho normal e ceroso foram isolados e submetidos à ação da a-amilase e amiloglucosidase. Para elucidar a estrutura dos grânulos, os resíduos desta hidrólise foram submetidos à cromatografia de permeção em gel Sephadex G-50, diretamente e após sucessivas digestões enzimáticas com pululanase e b-amilase. Os resultados mostraram que existem diferenças nos resíduos dos amidos de milho ceroso e normal, tratados com a-amilase e amiloglucosidase. No resíduo do amido de milho ceroso, os perfis de eluição mostraram duas frações a 290 e 350 ml (picos I e II) respectivamente, que não eram suscetíveis ao ataque da a-amilase e amiloglucosidase, indicando que estas frações faziam parte das zonas cristalinas do amido. Estas frações também faziam parte das áreas cristalinas no amido normal. A presença do pico V à 390 ml na a-glucana do amido de milho normal sugeriu que além das duas frações não suscetíveis à hidrólise existia outra que também participava das zonas cristalinas deste amido como regiões não suscetíveis às enzimas formando, consequentemente, rede cristalina fortemente associada. A presença deste pico a 390 ml sugeriu arranjo cristalino distinto entre o amido de milho ceroso e o normal.
Resumo:
O objetivo do presente trabalho foi estudar os efeitos das gomas guar e xantana sobre a estabilidade dos géis de amido de milho normal, ceroso e com alto teor de amilose submetidos aos processos de congelamento e descongelamento. Os géis desses amidos, com concentração total de sólidos de 10% e adicionados das gomas (0,15; 0,50; 0,85 e 1%), foram submetidos a 5 ciclos de congelamento (20 horas a -18 °C) e descongelamento (4 horas a 25 °C), com exceção dos géis com alto teor de amilose, que foram submetidos a apenas 1 ciclo, devido à perda da estrutura de gel. A determinação da sinérese (porcentagem de água liberada) foi realizada pela diferença entre a massa inicial e a massa final das amostras. O gel de amido de milho normal liberou 74,45% de água, sendo que a adição de 1% da goma xantana reduziu significativamente a sinérese para 66,43%. A adição de 0,85 e 1% da goma xantana também reduziu a sinérese dos géis de amido ceroso. O menor teor de sinérese foi obtido com a utilização de 1% de goma xantana ao gel de amido de milho com alto teor de amilose, evidenciando a ação crioprotetora desta goma.
Resumo:
Foram elaborados hambúrgueres e filés empanados com peitos de frango pálidos e normais e foram realizadas as seguintes análises de qualidade: cor, Perda de Peso por Cozimento (PPC), cisalhamento, Encolhimento por Fritura (EF), TBA, avaliação microbiológica e sensorial para os hambúrgueres, e TBA, análise microbiológica e análise sensorial para os filés empanados. As amostras de hambúrgueres elaboradas não diferiram significativamente (p > 0,05) nos parâmetros de coloração, EF, PPC e análise microbiológica e sensorial. Para análise de força de cisalhamento, houve diferença significativa (p < 0,05) entre os hambúrgueres no período de 7, 60 e 120 dias, sendo que os hambúrgueres elaborados com carne pálida (1,92; 1,31 e 1,46, respectivamente) apresentaram as menores médias quando comparados com os de carne normal (2,34; 1,85 e 1,73, respectivamente). Na análise de TBA, as amostras elaboradas com carne pálida também tiveram os maiores resultados com 90 a 180 dias de estocagem (5,28; 7,78; 8,89; 5,02) quando comparadas às de carne normal (2,62; 7,05; 8,08; 3,89). Para os filés empanados, não foram encontradas diferenças significativas (p > 0,05) entre a elaboração com carne de coloração normal e pálida para os parâmetros avaliados. Estes resultados demonstram que a carne pálida pode ser utilizada para a elaboração de produtos industrializados sem causar prejuízos em sua qualidade.
Resumo:
O objetivo do presente estudo foi avaliar os amidos de milho normal, ceroso e com alto teor de amilose, fabricados pela National Starch, por meio da determinação das suas características físico-químicas, morfológicas, térmicas e reológicas. O amido de milho com alto teor de amilose (AM) apresentou teor de amilose igual a 71%, sendo que os valores obtidos para o amido de milho normal (M) e o amido de milho ceroso (AP) foram de 27,8 e 1,8%, respectivamente. Traços de proteína e lipídios foram encontrados nas amostras. O amido de milho ceroso apresentou maior viscosidade máxima e uma menor tendência à retrogradação, se comparado ao amido de milho normal. O amido AP apresentou menor entalpia de gelatinização, como pode ser observado nas análises de calorimetria exploratória diferencial (DSC), na qual a temperatura de gelatinização foi de 75 °C e o ΔH de 3,34 J.g-1, e também na análise de RVA (Rapid Visco Analyser), em que a temperatura de pasta foi de 71 °C. Apresentando, dessa forma, valores inferiores aos verificados para os outros amidos. O valor do ΔH de retrogradação do amido AP, mostrou-se 25,8% inferior ao ΔH do amido M. O amido AM apresentou o valor de 26,38 J.g-1, demonstrando o maior envolvimento da molécula de amilose no processo de retrogradação. Isso também foi evidenciado pela medida da força dos géis: o gel de AM apresentou força 99,18% superior, retrogradando mais que os outros amidos. As análises de difração de raio X mostraram que os amidos de milho normal e ceroso apresentaram um padrão de difração do tipo A e o amido de milho com alto teor de amilose apresentou padrão do tipo B.
Retenção de aroma na secagem em atmosferas normal e modificada: desenvolvimento do sistema de estudo
Resumo:
Na secagem de determinados alimentos, como frutas, juntamente com a água há também a evaporação de outras substâncias voláteis presentes em quantidades menores. Por isso, torna-se interessante considerar nos estudos de secagem a evaporação, além da água, desses outros componentes voláteis. A modificação da atmosfera tem sido utilizada em armazenamento, principalmente de vegetais, mas pode também ser estendida à secagem, pois pode influenciar a perda de voláteis responsáveis pelas características sensoriais do produto final. No presente trabalho, é apresentado um sistema de secagem previamente desenvolvido, no qual a atmosfera de secagem pode ser modificada pela adição de gases ou líquidos. Desenvolveu-se um sistema-modelo a partir da composição química básica do abacaxi e da adição de outros compostos, contendo um dos principais componentes do aroma desta fruta (hexanoato de etila). Além disso, também foi desenvolvida a metodologia analítica de determinação do aroma no sistema-modelo e no abacaxi, a partir dos estudos de extração de aromas e de análise cromatográfica gasosa. O aroma presente no sistema-modelo foi extraído em hexano e os componentes voláteis do aroma do abacaxi foram extraídos em éter etílico
Resumo:
[Ecole polytechnique]