Opposite Effects of Insulin on Focal Adhesion Proteins in 3T3-L1 Adipocytes and in Cells Overexpressing the Insulin Receptor

Insulin can regulate the abundance and organization of filamentous actin within cells in culture. Early studies using cell lines that overexpress the insulin receptor demonstrated that insulin caused a rapid reversible disassembly of actin filaments that coincided with the rapid tyrosine dephosphorylation of focal adhesion kinase. We have extended these studies by demonstrating that paxillin, another focal adhesion protein, and Src undergo tyrosine dephosphorylation in response to insulin in Chinese hamster ovary (CHO) and rat hepatoma (HTC) cells that overexpress the insulin receptor. This contrasted with the effect of insulin in parental CHO and HTC cells in which focal adhesion proteins were not dephosphorylated in response to the hormone. In addition, insulin caused a dispersion of focal adhesion proteins and disruption of actin filament bundles only in cells that overexpressed the insulin receptor. Moreover, in 3T3-L1 adipocytes, which are considered prototypic insulin-responsive cells, actin filament assembly was stimulated, and focal adhesion protein tyrosine phosphorylation was not altered. 3T3-L1 cells have more insulin receptors than either parental CHO or HTC cells but have fivefold less insulin receptors than the overexpressing cell lines. We hypothesize that a threshold may exist in which the overexpression of insulin receptors determines how insulin signaling pathways regulate the actin cytoskeleton.

Activation and Functional Analysis of Janus Kinase 2 in BA/F3 Cells Using the Coumermycin/Gyrase B System

Janus kinase 2 (Jak2) protein tyrosine kinase plays an important role in interleukin-3– or granulocyte–macrophage colony-stimulating factor–mediated signal transduction pathways leading to cell proliferation, activation of early response genes, and inhibition of apoptosis. However, it is unclear whether Jak2 can activate these signaling pathways directly without the involvement of cytokine receptor phosphorylation. To investigate the specific role of Jak2 in the regulation of signal transduction pathways, we generated gyrase B (GyrB)–Jak2 fusion proteins, dimerized through the addition of coumermycin. Coumermycin induced autophosphorylation of GyrB–Jak2 fusion proteins, thus bypassing receptor activation. Using different types of chimeric Jak2 molecules, we observed that although the kinase domain of Jak2 is sufficient for autophosphorylation, the N-terminal regions are essential for the phosphorylation of Stat5 and for the induction of short-term cell proliferation. Moreover, coumermycin-induced activation of Jak2 can also lead to increased levels of c-myc and CIS mRNAs in BA/F3 cells stably expressing the Jak2 fusion protein with the intact N-terminal region. Conversely, activation of the chimeric Jak2 induced neither phosphorylation of Shc or SHP-2 nor activation of the c-fos promoter. Here, we showed that the GyrB–Jak2 system can serve as an excellent model to dissect signals of receptor-dependent and -independent events. We also obtained evidence indicating a role for the N-terminal region of Jak2 in downstream signaling events.

Aberrant B cell receptor signaling from B29 (Igβ, CD79b) gene mutations of chronic lymphocytic leukemia B cells

Chronic lymphocytic leukemia (CLL) B cells characteristically exhibit low or undetectable surface B cell receptor (BCR) and diminished responses to BCR-mediated signaling. These features suggest that CLL cells may have sustained mutations affecting one or more of the BCR proteins required for receptor surface assembly and signal transduction. Loss of expression and mutations in the critical BCR protein B29 (Igβ, CD79b), are prevalent in CLL and could produce the hallmark features of these leukemic B cells. Because patient CLL cells are intractable to manipulation, we developed a model system to analyze B29 mutations. Jurkat T cells stably expressing μ, κ, and mb1 efficiently assembled a functional BCR when infected with recombinant vaccinia virus bearing wild-type B29. In contrast, a B29 CLL mutant protein truncated in the transmembrane domain did not associate with μ or mb1 at the cell surface. Another B29 CLL mutant lacking the C-terminal immunoreceptor tyrosine activation motif tyrosine and distal residues brought the receptor to the surface as well as wild-type B29 but showed significant impairment in anti-IgM-stimulated signaling events including mitogen-activated protein kinase activation. These findings demonstrate that B29 mutations previously identified in CLL patients can affect BCR-dependent signaling and may contribute to the unresponsive B cell phenotype in CLL. Finally, the features of the B29 mutations in CLL predict that they may be generated by somatic hypermutation.

Myogenic signaling of phosphatidylinositol 3-kinase requires the serine-threonine kinase Akt/protein kinase B

The oncogene p3k, coding for a constitutively active form of phosphatidylinositol 3-kinase (PI 3-kinase), strongly activates myogenic differentiation. Inhibition of endogenous PI 3-kinase activity with the specific inhibitor LY294002, or with dominant-negative mutants of PI 3-kinase, interferes with myotube formation and with the expression of muscle-specific proteins. Here we demonstrate that a downstream target of PI 3-kinase, serine-threonine kinase Akt, plays an important role in myogenic differentiation. Expression of constitutively active forms of Akt dramatically enhances myotube formation and expression of the muscle-specific proteins MyoD, creatine kinase, myosin heavy chain, and desmin. Transdominant negative forms of Akt inhibit myotube formation and the expression of muscle-specific proteins. The inhibition of myotube formation and the reduced expression of muscle-specific proteins caused by the PI 3-kinase inhibitor LY294002 are completely reversed by constitutively active forms of Akt. Wild-type cellular Akt effects a partial reversal of LY294002-induced inhibition of myogenic differentiation. This result suggests that Akt can substitute for PI 3-kinase in the stimulation of myogenesis; Akt may be an essential downstream component of PI 3-kinase-induced muscle differentiation.

Inhibition of Stat1-mediated gene activation by PIAS1

STAT (signal transducer and activator of transcription) proteins are latent cytoplasmic transcription factors that become activated by tyrosine phosphorylation in response to cytokine stimulation. Tyrosine phosphorylated STATs dimerize and translocate into the nucleus to activate specific genes. Different members of the STAT protein family have distinct functions in cytokine signaling. Biochemical and genetic analysis has demonstrated that Stat1 is essential for gene activation in response to interferon stimulation. Although progress has been made toward understanding STAT activation, little is known about how STAT signals are down-regulated. We report here the isolation of a family of PIAS (protein inhibitor of activated STAT) proteins. PIAS1, but not other PIAS proteins, blocked the DNA binding activity of Stat1 and inhibited Stat1-mediated gene activation in response to interferon. Coimmunoprecipitation analysis showed that PIAS1 was associated with Stat1 but not Stat2 or Stat3 after ligand stimulation. The in vivo PIAS1–Stat1 interaction requires phosphorylation of Stat1 on Tyr-701. These results identify PIAS1 as a specific inhibitor of Stat1-mediated gene activation and suggest that there may exist a specific PIAS inhibitor in every STAT signaling pathway.

Ric1p and the Ypt6p GTPase Function in a Common Pathway Required for Localization of Trans-Golgi Network Membrane Proteins

In Saccharomyces cerevisiae, clathrin is necessary for localization of trans-Golgi network (TGN) membrane proteins, a process that involves cycling of TGN proteins between the TGN and endosomes. To characterize further TGN protein localization, we applied a screen for mutations that cause severe growth defects in combination with a temperature-sensitive clathrin heavy chain. This screen yielded a mutant allele of RIC1. Cells carrying a deletion of RIC1 (ric1Δ) mislocalize TGN membrane proteins Kex2p and Vps10p to the vacuole. Delivery to the vacuole occurs in ric1Δ cells also harboring end3Δ to block endocytosis, indicative of a defect in retrieval to the TGN rather than sorting to endosomes. SYS1, originally discovered as a multicopy suppressor of defects caused by the absence of the Rab GTPase YPT6, was identified as a multicopy suppressor of ric1Δ. Further comparison of ric1Δ and ypt6Δ cells demonstrated identical phenotypes. Multicopy plasmids expressing v-SNAREs Gos1p or Ykt6p, but not other v- and t-SNAREs, partially suppressed phenotypes of ric1Δ and ypt6Δ cells. SLY1–20, a dominant activator of the cis-Golgi network t-SNARE Sed5p, also functioned as a multicopy suppressor. Because Gos1p and Ykt6p interact with Sed5p, these results raise the possibility that TGN membrane protein localization requires Ric1p- and Ypt6p-dependent retrieval to the cis-Golgi network.

Raft-partitioning of the ubiquitin ligases Cbl and Nedd4 upon IgE-triggered cell signaling

The high affinity receptor for IgE, FcɛRI on mast cells and basophils plays an essential role in immunological defense. Upon multivalent antigen binding, FcɛRI becomes phoshorylated by the protein-tyrosine kinase Lyn, as a result of receptor clustering in lipid rafts. FcɛRI has been shown to be ubiquitinated. Ubiquitination can lead to degradation by proteasomes, but it can also act as a sorting signal to internalize proteins destined to the endosomal/lysosomal pathway. We have analyzed whether FcɛRI ubiquitination takes place within rafts. We report biochemical and imaging evidence in rat basoleukemia cells for the presence of ubiquitinated FcɛRI in clustered rafts upon receptor activation. Moreover, we demonstrated that the ubiquitin ligases Cbl and Nedd4 colocalize with FcɛRI patches and showed that both ligases become associated with lipid rafts after activation of IgE signaling. Because Cbl is known to interact with the FcɛRI signaling complex, ubiquitination is likely to be an important parameter regulating IgE-triggered signaling occurring in rafts.

neuralized is essential for a subset of Notch pathway-dependent cell fate decisions during Drosophila eye development

neuralized (neur) is a neurogenic mutant of Drosophila in which many signaling events mediated by the Notch (N) receptor are disrupted. Here, we analyze the role of neur during eye development. Neur is required in a cell-autonomous fashion to restrict R8 and other photoreceptor fates and is involved in lateral inhibition of interommatidial bristles but is not required for induction of the cone cell fate. The latter contrasts with the absolute requirement for Suppressor of Hairless and the Enhancer of split-Complex for cone cell induction. Using gain-of-function experiments, we further demonstrate that ectopic wild-type and truncated Neur proteins can interfere with multiple N-controlled aspects of eye development, including both neur-dependent and neur-independent processes.

SMART, a simple modular architecture research tool: Identification of signaling domains

Accurate multiple alignments of 86 domains that occur in signaling proteins have been constructed and used to provide a Web-based tool (SMART: simple modular architecture research tool) that allows rapid identification and annotation of signaling domain sequences. The majority of signaling proteins are multidomain in character with a considerable variety of domain combinations known. Comparison with established databases showed that 25% of our domain set could not be deduced from SwissProt and 41% could not be annotated by Pfam. SMART is able to determine the modular architectures of single sequences or genomes; application to the entire yeast genome revealed that at least 6.7% of its genes contain one or more signaling domains, approximately 350 greater than previously annotated. The process of constructing SMART predicted (i) novel domain homologues in unexpected locations such as band 4.1-homologous domains in focal adhesion kinases; (ii) previously unknown domain families, including a citron-homology domain; (iii) putative functions of domain families after identification of additional family members, for example, a ubiquitin-binding role for ubiquitin-associated domains (UBA); (iv) cellular roles for proteins, such predicted DEATH domains in netrin receptors further implicating these molecules in axonal guidance; (v) signaling domains in known disease genes such as SPRY domains in both marenostrin/pyrin and Midline 1; (vi) domains in unexpected phylogenetic contexts such as diacylglycerol kinase homologues in yeast and bacteria; and (vii) likely protein misclassifications exemplified by a predicted pleckstrin homology domain in a Candida albicans protein, previously described as an integrin.

Induction of primordial germ cells from murine epiblasts by synergistic action of BMP4 and BMP8B signaling pathways

Extraembryonic ectoderm-derived factors instruct the pluripotent epiblast cells to develop toward a restricted primordial germ cell (PGC) fate during murine gastrulation. Genes encoding Bmp4 of the Dpp class and Bmp8b of the 60A class are expressed in the extraembryonic ectoderm and targeted mutation of either results in severe defects in PGC formation. It has been shown that heterodimers of DPP and 60A classes of bone morphogenetic proteins (BMPs) are more potent than each homodimers in bone and mesoderm induction in vitro, suggesting that BMP4 and BMP8B may form heterodimers to induce PGCs. To investigate how BMP4 and BMP8B interact and signal for PGC induction, we cocultured epiblasts of embryonic day 6.0–6.25 embryos with BMP4 and BMP8B proteins produced by COS cells. Our data show that BMP4 or BMP8B homodimers alone cannot induce PGCs whereas they can in combination, providing evidence that two BMP pathways are simultaneously required for the generation of a given cell type in mammals and also providing a prototype method for PGC induction in vitro. Furthermore, the PGC defects of Bmp8b mutants can be rescued by BMP8B homodimers whereas BMP4 homodimers cannot mitigate the PGC defects of Bmp4 null mutants, suggesting that BMP4 proteins are also required for epiblast cells to gain germ-line competency before the synergistic action of BMP4 and BMP8B.

Inhibition of cytokines and JAK-STAT activation by distinct signaling pathways.

An important component of cytokine regulation of cell growth and differentiation is rapid transcriptional activation of genes by the JAK-STAT (signal transducer and activator of transcription) signaling pathway. Ligation of cytokine receptors results in tyrosine phosphorylation and activation of receptor-associated Jak protein tyrosine kinases and cytoplasmic STAT transcription factors, which then translocate to the nucleus. We describe the interruption of cytokine triggered JAK-STAT signals by cAMP, the calcium ionophore ionomycin, and granulocyte/macrophage colony-stimulating factor. Jak1 kinase activity, interleukin 6-induced gene activation, Stat3 tyrosine phosphorylation, and DNA-binding were inhibited, as was activation of Jak1 and Stat1 by interferon gamma. The kinetics and requirement for new RNA and protein synthesis for inhibition of interleukin 6 by ionomycin and GM-CSF differed, but both agents increased the association of Jak1 with protein tyrosine phosphatase ID (SH2-containing phosphatase 2). Our results demonstrate that crosstalk with distinct signaling pathways can inhibit JAK-STAT signal transduction, and suggest approaches for modulating cytokine activity during immune responses and inflammatory processes.

The control of hematopoiesis and leukemia: from basic biology to the clinic.

Hematopoiesis gives rise to blood cells of different lineages throughout normal life. Abnormalities in this developmental program lead to blood cell diseases including leukemia. The establishment of a cell culture system for the clonal development of hematopoietic cells made it possible to discover proteins that regulate cell viability, multiplication and differentiation of different hematopoietic cell lineages, and the molecular basis of normal and abnormal blood cell development. These regulators include cytokines now called colony-stimulating factors (CSFs) and interleukins (ILs). There is a network of cytokine interactions, which has positive regulators such as CSFs and ILs and negative regulators such as transforming growth factor beta and tumor necrosis factor (TNF). This multigene cytokine network provides flexibility depending on which part of the network is activated and allows amplification of response to a particular stimulus. Malignancy can be suppressed in certain types of leukemic cells by inducing differentiation with cytokines that regulate normal hematopoiesis or with other compounds that use alternative differentiation pathways. This created the basis for the clinical use of differentiation therapy. The suppression of malignancy by inducing differentiation can bypass genetic abnormalities that give rise to malignancy. Different CSFs and ILs suppress programmed cell death (apoptosis) and induce cell multiplication and differentiation, and these processes of development are separately regulated. The same cytokines suppress apoptosis in normal and leukemic cells, including apoptosis induced by irradiation and cytotoxic cancer chemotherapeutic compounds. An excess of cytokines can increase leukemic cell resistance to cytotoxic therapy. The tumor suppressor gene wild-type p53 induces apoptosis that can also be suppressed by cytokines. The oncogene mutant p53 suppresses apoptosis. Hematopoietic cytokines such as granulocyte CSF are now used clinically to correct defects in hematopoiesis, including repair of chemotherapy-associated suppression of normal hematopoiesis in cancer patients, stimulation of normal granulocyte development in patients with infantile congenital agranulocytosis, and increase of hematopoietic precursors for blood cell transplantation. Treatments that decrease the level of apoptosis-suppressing cytokines and downregulate expression of mutant p53 and other apoptosis suppressing genes in cancer cells could improve cytotoxic cancer therapy. The basic studies on hematopoiesis and leukemia have thus provided new approaches to therapy.

Eradication of human hepatic and pulmonary melanoma metastases in SCID mice by antibody-interleukin 2 fusion proteins.

Antibody-cytokine fusion proteins combine the unique targeting ability of antibodies with the multifunctional activity of cytokines. Here, we demonstrate the therapeutic efficacy of such constructs for the treatment of hepatic and pulmonary metastases of different melanoma cell lines. Two antibody-interleukin 2 (IL-2) fusion proteins, ch225-IL2 and ch14.18-IL2, constructed by fusion of a synthetic sequence coding for human IL-2 to the carboxyl end of the Cgamma1 gene of the corresponding antibodies, were tested for their therapeutic efficacy against xenografted human melanoma in vivo. Tumor-specific fusion proteins completely inhibited the growth of hepatic and pulmonary metastases in C.B-17 scid/scid mice previously reconstituted with human lymphokine-activated killer cells, whereas treatment with combinations of the corresponding antibodies plus recombinant IL-2 only reduced the tumor load. Even when treatment with fusion proteins was delayed up to 8 days after inoculation of tumor cells, it still resulted in complete eradication of micrometastases that were established at that time point. Selection of tumor cell lines expressing or lacking the targeted antigen of the administered fusion protein proved the specificity of the observed antitumor effect. Biodistribution analysis demonstrated that the tumor-specific fusion protein accumulated not only in subcutaneous tumors but also in lungs and livers affected with micrometastases. Survival times of animals treated with the fusion protein were more than doubled as compared to those treated with the combination of the corresponding antibody plus IL-2. Our data demonstrate that an immunotherapeutic approach using cytokines targeted by antibodies to tumor sites has potent effects against disseminated human melanoma.

Fc epsilon RI-mediated recruitment of p53/56lyn to detergent-resistant membrane domains accompanies cellular signaling.

Detergent-resistant plasma membrane structures, such as caveolae, have been implicated in signalling, transport, and vesicle trafficking functions. Using sucrose gradient ultracentrifugation, we have isolated low-density, Triton X-100-insoluble membrane domains from RBL-2H3 mucosal mast cells that contain several markers common to caveolae, including a src-family tyrosine kinase, p53/56lyn. Aggregation of Fc epsilon RI, the high-affinity IgE receptor, causes a significant increase in the amount of p53/56lyn associated with these low-density membrane domains. Under our standard conditions for lysis, IgE-Fc epsilon RI fractionates with the majority of the solubilized proteins, whereas aggregated receptor complexes are found at a higher density in the gradient. Stimulated translocation of p53/56lyn is accompanied by increased tyrosine phosphorylation of several proteins in the low-density membrane domains as well as enhanced in vitro tyrosine kinase activity toward these proteins and an exogenous substrate. With a lower detergent-to-cell ratio during lysis, significant Fc epsilon RI remains associated with these membrane domains, consistent with the ability to coimmunoprecipitate tyrosine kinase activity with Fc epsilon RI under similar lysis conditions [Pribluda, V. S., Pribluda, C. & Metzger, H. (1994) Proc. Natl. Acad. Sci. USA 91, 11246-11250]. These results indicate that specialized membrane domains may be directly involved in the coupling of receptor aggregation to the activation of signaling events.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.