Which anatomical sites should be sampled for screening of methicillin-resistant Staphylococcus aureus carriage by culture or by rapid PCR test?

The nose is the anatomical site usually recommended for methicillin-resistant Staphylococcus aureus (MRSA) screening. Other sites are also recommended, but are more controversial. We showed that the sensitivities of MRSA detection from nasal swabs alone were 48% and 62% by culture or by rapid PCR test, respectively. These percentages increased to 79% and 92% with the addition of groin swabs, and to 96% and 99% with the addition of groin and throat swabs. In conclusion, neither by culture nor by rapid PCR test is nose sampling alone sufficient for MRSA detection. Additional anatomical sites should include at least the groin and throat.

Evaluation of the Duggan Test for Concretes Made of Different Types of Cements, MLR-97-8, 2000

In searching for simple and reliable test methods to evaluate the quality of Iowa portland cement concrete (PCC) pavements, the Duggan test was conducted for concretes made of twenty-six types of cements in this laboratory research. The influence of some factors, such as chemical composition and type of cements, use of air-entraining agent and water reducer, and water to cement ratio, on the result of the Duggan test was examined. It was found that the expansion increases with increasing values of potassium alkali (K2O) and sulfur trioxide (SO3) in cements. It was also found that the Type I cements generally produce higher expansion than the Type II, IP and IS cements. Since it is difficult to identify the major mechanism leading to the expansion observed in the Duggan test, more studies are certainly needed before it can be used as a reliable test method for evaluating the service life of concrete pavement.

Phosphorus in Finnish soils in the 1900s with particular reference to the acid ammonium acetate soil test

Selostus: Suomen maaperän fosforin tutkiminen 1900-luvulla ja viljavuustutkimuksen kehittäminen

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Soil Tracking Paint Test, MLR-89-13, 1989

A new paint testing device was built to determine the resistance of paints to darkening due to road grime being tracked onto them. The device consists of a tire rotating on a sample drum. Soil was applied to the tire and then tracked onto paint samples which were attached to the drum. A colorimeter was used to measure the lightness of the paints after being tracked. Lightness is measured from 0 (absolute black) to 100 (absolute white). Four experiments were run to determine the optimum time length to track a sample, the reproducibility, the effects of different soils, and the maximum acceptable level for darkening of a paint. The following conclusions were reached: 1) the optimum tracking time was 10 minutes; 2) the reproducibility had a standard deviation of 1.5 lightness units; 3) different soils did not have a large effect on the amount of darkening on the paints; 4) a maximum acceptable darkness could not be established based on the limited amount of data; and 5) a correlation exists between the paints which were darkening in the field and the paints which were turning the darkest on the tracking wheel.

Variation in virulence in the rice blast fungus Magnaporthe grisea in São Paulo State

Resistant varieties have been the preferred means to control Magnaporthe grisea, the causal organism of the rice blast disease. The objective of this study was to examine the degree of diversity of the pathogen in different rice growing regions of São Paulo State, Brazil. Blast samples collected from rice varieties in three different regions (Tremembé, Mococa and José Bonifácio) were analyzed for race structure employing the Japanese rice differentials. The highest degree of virulence diversity was observed in Tremembé with 22 different races in three different varieties. Furthermore, no resistance gene in the Japanese differentials was effective to all isolates of M. grisea from São Paulo State.

Cultivar response to fungicide application in relation to rice blast control, productivity and sustainability

Four field trials were conducted, from 1995 to 1997, with the objective of studying the response of four upland cultivars to foliar fungicide application in relation to panicle blast control, grain yield and sustainability. Differential disease control and yield response of cultivars to fungicide treatment were obtained. Losses in grain yield of cultivars IAC 202, Caiapó, Rio Paranaíba and Araguaia due to panicle blast were 44.8%, 27.4%, 24.4% and 18.2%, respectively. Two applications of tricyclazole or benomyl controlled panicle blast, as indicated by lower values of disease progress curve and relative panicle blast severity, and increased grain yield of the cultivar IAC 202. The losses in 100 panicle grain weight and grain yield were significantly reduced by 22.3% and 25.1% in IAC 202 and 23.6% and 20.5% in Caiapó, respectively, with two sprays of tricyclazole. Sustainable value index for yield was maximum with two applications of tricyclazole (0.59), followed by one application at booting (0.46) and at heading (0.40) in cultivar IAC 202. Results showed no yield response of the cultivars Rio Paranaíba and Araguaia to fungicide applications for panicle blast control.

Resistance spectra of six elite breeding lines of upland rice to Pyricularia grisea

The objective of this work was to evaluate the resistance spectra of six elite breeding lines of rice, developed for improved yield and grain quality, in inoculation tests in the greenhouse and in the field. Forty-six isolates of Pyricularia grisea collected from the cultivar Primavera, 31 from the cultivar Maravilha and 19 from six elite breeding lines, totaling 96 were utilized for inoculations. Out of 11 international and 15 Brazilian pathotypes, IC-1, IB-9, and BD-16, respectively, were identified as most frequent isolates collected from the cultivar Primavera. The isolates retrieved from Maravilha belong to four international and 11 Brazilian pathotypes, the predominant ones being IB-9 and IB-49 and BB-1 and BB-21, respectively. Lines CNAs 8711 and CNAs 8983 showed resistant reaction to all test isolates from Maravilha, while CNAs 8983 was susceptible to three isolates of Primavera pertaining to the pathotype IC-1. A majority of isolates exhibiting compatible reaction to Primavera were incompatible to Maravilha and vice-versa.Field assessment of rice blast utilizing the area under disease progress curve as a criterion for measuring disease severity showed significant differences among the six breeding lines. The isolates of P. grisea exhibiting differential reaction on breeding lines can be utilized in pyramiding resistance genes in new upland rice cultivars.

On homology searches by protein Blast and the characterization of the age of genes

Background: It has been shown in a variety of organisms, including mammals, that genes that appeared recently in evolution, for example orphan genes, evolve faster than older genes. Low functional constraints at the time of origin of novel genes may explain these results. However, this observation has been recently attributed to an artifact caused by the inability of Blast to detect the fastest genes in different eukaryotic genomes. Distinguishing between these two possible explanations would be of great importance for any studies dealing with the taxon distribution of proteins and the origin of novel genes. Results: Here we used simulations of protein sequences to examine the capacity of Blast to detect proteins of diverse evolutionary rates in the different species of an eukaryotic phylogenetic tree that included metazoans, fungi and plants. We simulated the evolution of protein genes with the same evolutionary rates than those observed in functional mammalian genes and with among-site rate heterogeneity. Under these conditions, we found that only a very small percentage of simulated ancestral eukaryotic proteins was affected by the Blast artifact. We show that the good detectability of Blast is due to the heterogeneity of protein evolutionary rates at different sites, since only a small conserved motif in a sequence suffices to detect its homologues. Our results indicate that Blast, at least when applied within eukaryotes, only misses homologues of extremely fast-evolving sequences, which are rare in the mammalian genome, as well as sequences evolving homogeneously or pseudogenes.Conclusion: Although great care should be exercised in the recognition of remote homologues, most functional mammalian genes can be detected in eukaryotic genomes by Blast. That is, the majority of functional mammalian genes are not as fast as for not being detected in other metazoans, fungi or plants, if they had been present in these organisms. Thus, the correlation previously found between age and rate seems not to be due to a pure Blast artifact, at least for mammals. This may have important implications to understand the mechanisms by which novel genes originate.

Development of a Durability Test for Asphalts, May 1972

Research Project HR-124, "Development of a Laboratory Durability Test for Asphalts," was initiated in 1966 as a long-range comprehensive program. Its ultimate objective was to develop a simple, rapid laboratory test that could be used by highway engineers to select paving asphalt according to quality, to identify inferior asphalts, and to reasonably predict the useful life of asphalts once they were incorporated in the pavements.

Effects of alternative sets of climatic predictors on species distribution models and associated estimates of extinction risk: a test with plants in an arid environment

Aim To evaluate the effects of using distinct alternative sets of climatic predictor variables on the performance, spatial predictions and future projections of species distribution models (SDMs) for rare plants in an arid environment. . Location Atacama and Peruvian Deserts, South America (18º30'S - 31º30'S, 0 - 3 000 m) Methods We modelled the present and future potential distributions of 13 species of Heliotropium sect. Cochranea, a plant group with a centre of diversity in the Atacama Desert. We developed and applied a sequential procedure, starting from climate monthly variables, to derive six alternative sets of climatic predictor variables. We used them to fit models with eight modelling techniques within an ensemble forecasting framework, and derived climate change projections for each of them. We evaluated the effects of using these alternative sets of predictor variables on performance, spatial predictions and projections of SDMs using Generalised Linear Mixed Models (GLMM). Results The use of distinct sets of climatic predictor variables did not have a significant effect on overall metrics of model performance, but had significant effects on present and future spatial predictions. Main conclusion Using different sets of climatic predictors can yield the same model fits but different spatial predictions of current and future species distributions. This represents a new form of uncertainty in model-based estimates of extinction risk that may need to be better acknowledged and quantified in future SDM studies.

Bruce Treadmill Test in Children : First Normal Values for Children from Western Europe : P67

Introduction: One of the main goals for exereise testing in children is evaluation of exercise capacity. There are many testing protocols, but the Bruce treadmill protocol is widely used among pediatrie cardiology centers. Thirty years ago, Cuming et al. were the first to establish normal values for children from North America (Canada) aged 4 to 18 years old. No data was ever published for children from Western Europe. Our study aimed to assess the validity of the normal values from Cuming et al. for children from Western Europe in the 21 st century. Methods: It is a retrospective cohort study in a tertiary care children's hospital. 144 children referred to our institution but finally diagnosed as having a normal heart underwent exercise stress testing using the Bruce protocol between 1999 and 2006. Data from 59 girls and 85 boys aged 6 to 18 were reviewed. Mean endurance time (ET) for each age category and gender was compared with the mean normal values fram Cumming et al by an unpaired t-test. Results: Mean ET increases with age until 15 years old in girls and then decreases. Mean endurance time increases continuouslY'from 6 to 18 years old in boys. The increase is more pronounced in boys than girls. In our study, a significant higher mean ET was found for boys in age categories 10 to 12, 13 to 15 and 16 to 18. No significant difference was found in any other groups. Conclusions: Some normal values from Cuming et al. established in 1978 for ET with the Bruce protocol are probably not appropriate any more today for children from Western Europe. Our study showed that mean ET is higher for boys from 10 to 18 years old. Despite common beliefs, cardiovascular conditioning doesn't seem yet reduced in children from Western Europe. New data for Bruce treadmill exercise. testing for healthy children, 4 to 18 years old, living in Western Europe are required. .

Développement d'un Test Sérologique Contre le Virus de la Chorioméningite Lymphocytaire

Les Arenavirus sont une famille de virus à ARN très diversifiée avec plus de 23 espèces recensées dans le monde, divisées en deux Clades majeures (Emonet et al., 2009). Ils sont classifiés en Arenavirus du Nouveau Monde versus de l'Ancien Monde (Buchmeier, de la Torre, and Peters, 2007) (Fig. 1). Parmi les Arenavirus, sept sont connus pour être les agents causales de fièvres hémorragiques foudroyantes : Les virus Lassa, Junin, Machupo, Guanarito, Sabia, Chapare et Lujo. Les Arenavirus infectent, de façon spécifique, des espèces de rongeurs qui sont le réservoir naturel déterminant ainsi leur distribution géographique (Clegg, 2002). On retrouve le virus de la chorioméningite lymphocytaire (LCMV) à la fois en Europe et aux Amériques. Le rongeur infecté est le vecteur de transmission à l'Homme. Les maladies associées aux infections par les Arenavirus hémorragiques ont un haut taux de mortalité allant de 15 à 30% et sont à haut risque épidémiologique en raison de l'absence de vaccin et de traitement efficace. Pour ces raisons, ces Arenavirus sont classifiés comme pathogènes à haut risque par le centre pour le contrôle des maladies (CDC) (Borio et al., 2002).