Selective separation of the major whey proteins using ion exchange membranes

Synthetic microporous membranes with functional groups covalently attached were used to selectively separate beta-lactoglobulin, BSA, and alpha-lactalbumin from rennet whey. The selectivity and membrane performance of strong (quaternary ammonium) and weak (diethylamine) ion-exchange membranes were studied using breakthrough curves, measurement of binding capacity, and protein composition of the elution fraction to determine the binding behavior of each membrane. When the weak and strong anion exchange membranes were saturated with whey, they were both selective primarily for beta-lactoglobulin with less than 1% of the eluate consisting of alpha-lactalbumin or BSA. The binding capacity of a pure alpha-lactoglobulin solution was in excess of 1.5 mg/cm(2) of membrane. This binding capacity was reduced to approximately 1.2 mg/cm(2) when using a rennet whey solution (pH 6.4). This reduction in protein binding capacity can be explained by both the competitive effects of other whey proteins and the effect of ions present in whey. Using binary solution breakthrough curves and rennet whey breakthrough curves, it was shown that alpha-lactalbumin and BSA were displaced from the strong and weak anion exchange membranes by beta-lactoglobulin. Finally, the effect of ionic strength on the binding capacity of individual proteins for each membrane was determined by comparing model protein solutions in milk permeate (pH 6.4) and a 10 mM sodium phosphate buffer (pH 6.4). Binding capacities of beta-lactoglobulin, alpha-lactalbumin, and BSA in milk permeate were reduced by as much as 50%. This reduction in capacity coupled with the low binding capacity of current ion exchange membranes are 2 serious considerations for selectively separating complex and concentrated protein solutions.

Changes in the antioxidant properties of protein solutions in the presence of epigallocatechin gallate

beta-Casein and alpha-casein showed radical-scavenging activities in aqueous solution, whereas bovine serum albumin (BSA), alpha-lactalbumin and P-lactoglobulin showed much weaker antioxidant activity, when assessed by the 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS) radical-scavenging assay. However, beta-casein and alpha-casein showed reduced antioxidant activity after storage at 30 degrees C. An increase in radical- scavenging activity and a fall in fluorescence of the protein component were evident after 6 h, when BSA, beta-lactoglobulin or casein were mixed with EGCG, and excess EGCG was removed, indicating the formation of a complex with this protein on mixing. Storage of all the proteins with EGCG at 30 degrees C caused an increase in the antioxidant activity of the isolated protein component after separation from excess EGCG. This showed that EGCG was reacting with the proteins and that the protein-bound catechin had antioxidant properties. The reaction of EGCG with BSA, casein and beta-lactoglobulin was confirmed by the loss of fluorescence of the protein on storage, and the increase in UV absorbance between 250 and 400 nm. The increase in antioxidant activity of BSA after storage with EGCG was confirmed by the ferric reducing antioxidant potential (FRAP) and the oxygen radical antioxidant capacity (ORAC) assays. (c) 2006 Elsevier Ltd. All rights reserved.

Miscibility studies in poly(methyl vinyl ether)/hydroxypropylcellulose binary system in aqueous solutions and solid state

The phase separation behaviour in aqueous mixtures of poly(methyl vinyl ether) and hydroxypropylcellulose has been studied by cloud points method and viscometric measurements. The miscibility of these blends in solid state has been assessed by infrared spectroscopy; methanol vapours sorption experiments and scanning electron microscopy. The values of Gibbs energy of mixing of the polymers and their blends with methanol as well as between each other were calculated. It was found that in solid state the polymers can interact with methanol very well but the polymer-polymer interactions are unfavourable. Although in aqueous solutions the polymers exhibit some intermolecular interactions their solid blends are not completely miscible. (C) 2005 Elsevier Ltd. All rights reserved.

Interpolymer complexes of hydroxy-propylmethylcellulose with polycarboxylic acids in aqueous solutions

The interactions between hydroxypropylmethylcellulose (HPMC) and poly(acrylic acid) (PAA) as well as poly(methacrylic acid) (PMMA) resulting in formation of hydrophobic interpolymer complexes (IPC) via hydrogen bonding have been studied in aqueous solutions in acidic medium. The formation of IPC of two different compositions (2:1 and 4:1) has been detected for complexes of PAA and HPMC. The critical pH values for complexation of HPMC with PAA and PMAA were determined by the turbidimetric method. It was found that PAA shows the lower complexation ability compared to PMAA due to the more hydrophobic nature of the latter polyacid. The temperature-induced phase separation in HPMC-PAA solution mixtures depends greatly on the components ratio and PAA molecular weight. The complexation ability of hydroxypropylmethylcellulose with respect to poly(acrylic acid) was found to be similar to the complexation ability of methylcellulose, lower than that of hydroxypropylcellulose and higher than that of hydroxyethylcellulose. (c) 2006 Society of Chemical Industry.

The geometry of optimal control solutions on some six dimensional lie groups

This paper examines optimal solutions of control systems with drift defined on the orthonormal frame bundle of particular Riemannian manifolds of constant curvature. The manifolds considered here are the space forms Euclidean space E-3, the spheres S-3 and the hyperboloids H-3 with the corresponding frame bundles equal to the Euclidean group of motions SE(3), the rotation group SO(4) and the Lorentz group SO(1,3). The optimal controls of these systems are solved explicitly in terms of elliptic functions. In this paper, a geometric interpretation of the extremal solutions is given with particular emphasis to a singularity in the explicit solutions. Using a reduced form of the Casimir functions the geometry of these solutions are illustrated.

Approximate Riemann solutions of the two-dimensional shallow-water equations

A finite-difference scheme based on flux difference splitting is presented for the solution of the two-dimensional shallow-water equations of ideal fluid flow. A linearised problem, analogous to that of Riemann for gasdynamics, is defined and a scheme, based on numerical characteristic decomposition, is presented for obtaining approximate solutions to the linearised problem. The method of upwind differencing is used for the resulting scalar problems, together with a flux limiter for obtaining a second-order scheme which avoids non-physical, spurious oscillations. An extension to the two-dimensional equations with source terms, is included. The scheme is applied to a dam-break problem with cylindrical symmetry.

Similarity solutions of the shallow water equations

A one-dimensional shock (bore) reflection problem is discussed for the two-dimensional shallow water equations with cylindrical symmetry. The differential equations for a similarity solution are derived and solved numerically in conjunction with the Rankine-Hugoniot shock relations.

Solutions of a two-dimensional dam-break problem

Solutions of a two-dimensional dam break problem are presented for two tailwater/reservoir height ratios. The numerical scheme used is an extension of one previously given by the author [J. Hyd. Res. 26(3), 293–306 (1988)], and is based on numerical characteristic decomposition. Thus approximate solutions are obtained via linearised problems, and the method of upwind differencing is used for the resulting scalar problems, together with a flux limiter for obtaining a second order scheme which avoids non-physical, spurious oscillations.

Similarity solutions for multicomponent flows

A one-dimensional shock-reflection test problem in the case of slab, cylindrical or spherical symmetry is discussed for multi-component flows. The differential equations for a similarity solution are derived and then solved numerically in conjunction with the Rankine-Hugoniot shock relations.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Hydrogelation and self-assembly of Fmoc-tripeptides: unexpected influence of sequence on self-assembled fibril structure, and hydrogel modulus and anisotropy

The self-assembly and hydrogelation properties of two Fmoc-tripeptides [Fmoc = N-(fluorenyl-9-methoxycarbonyl)] are investigated, in borate buffer and other basic solutions. A remarkable difference in self-assembly properties is observed comparing Fmoc-VLK(Boc) with Fmoc-K(Boc)LV, both containing K protected by N(epsilon)-tert-butyloxycarbonate (Boc). In borate buffer, the former peptide forms highly anisotropic fibrils which show local alignment, and the hydrogels show flow-aligning properties. In contrast, Fmoc-K(Boc)LV forms highly branched fibrils that produce isotropic hydrogels with a much higher modulus (G' > 10(4) Pa), and lower concentration for hydrogel formation. The distinct self-assembled structures are ascribed to conformational differences, as revealed by secondary structure probes (CD, FTIR, Raman spectroscopy) and X-ray diffraction. Fmoc-VLK(Boc) forms well-defined beta-sheets with a cross-beta X-ray diffraction pattern, whereas Fmoc-KLV(Boc) forms unoriented assemblies with multiple stacked sheets. Interchange of the K and V residues when inverting the tripeptide sequence thus leads to substantial differences in self-assembled structures, suggesting a promising approach to control hydrogel properties.

The implications of service-dominant logic and integrated solutions on the sales function

This study explores the implications of an organization moving toward service-dominant logic (S-D logic) on the sales function. Driven by its customers’ needs, a service orientation by its nature requires personal interaction and sales personnel are in an ideal position to develop offerings with the customer. However, the development of S-D logic may require sales staff to develop additional skills. Employing a single case study, the study identified that sales personnel are quick to appreciate the advantages of S-D logic for customer satisfaction and six specific skills were highlighted and explored. Further, three propositions were identified: in an organization adopting S-D logic, the sales process needs to elicit needs at both embedded-value and value-in-use levels. In addition, the sales process needs to coproduce not just goods and service attributes but also attributes of the customer’s usage processes. Further, the sales process needs to coproduce not just goods and service attributes but also attributes of the customer’s usage processes.