957 resultados para regulatory DN T cells
Resumo:
Transcription factor CREM (cAMP-responsive element modulator) plays a pivotal role in the nuclear response to cAMP in neuroendocrine cells. We have previously shown that follicle-stimulating hormone (FSH) directs CREM expression in male germ cells. The physiological importance of FSH in Sertoli cell function prompted us to analyze its effect on CREM expression in these cells. We observed a dramatic and specific increase in the CREM isoform ICER (inducible cAMP early repressor) expression, with a peak 4 h after FSH treatment of primary Sertoli cells. Interestingly, induced levels of ICER protein persist for a considerably longer time. Induction of the repressor ICER accompanies early down-regulation of the FSH receptor transcript, which leads to long-term desensitization. Here we show that ICER represses FSH receptor expression by binding to a CRE-like sequence in the regulatory region of the gene. Our results confirm the crucial role played by CREM in hormonal control and suggest its role in the long-term desensitization phenomenon of peptide membrane receptors.
Resumo:
Microtubules have been proposed to function as rigid struts which oppose cellular contraction. Consistent with this hypothesis, microtubule disruption strengthens the contractile force exerted by many cell types. We have investigated alternative explanation for the mechanical effects of microtubule disruption: that microtubules modulate the mechanochemical activity of myosin by influencing phosphorylation of the myosin regulatory light chain (LC20). We measured the force produced by a population of fibroblasts within a collagen lattice attached to an isometric force transducer. Treatment of cells with nocodazole, an inhibitor of microtubule polymerization, stimulated an isometric contraction that reached its peak level within 30 min and was typically 30-45% of the force increase following maximal stimulation with 30% fetal bovine serum. The contraction following nocodazole treatment was associated with a 2- to 4-fold increase in LC20 phosphorylation. The increases in both force and LC20 phosphorylation, after addition of nocodazole, could be blocked or reversed by stabilizing the microtubules with paclitaxel (former generic name, taxol). Increasing force and LC20 phosphorylation by pretreatment with fetal bovine serum decreased the subsequent additional contraction upon microtubule disruption, a finding that appears inconsistent with a load-shifting mechanism. Our results suggest that phosphorylation of LC20 is a common mechanism for the contractions stimulated both by microtubule poisons and receptor-mediated agonists. The modulation of myosin activity by alterations in microtubule assembly may coordinate the physiological functions of these cytoskeletal components.
Resumo:
The mechanisms by which insulin-like growth factors (IGFs) can be both mitogenic and differentiation-promoting in skeletal myoblasts are unclear because these two processes are believed to be mutually exclusive in this tissue. The phosphorylation state of the ubiquitous nuclear retinoblastoma protein (Rb) plays an important role in determining whether myoblasts proliferate or differentiate: Phosphorylated Rb promotes mitogenesis, whereas un- (or hypo-) phosphorylated Rb promotes cell cycle exit and differentiation. We hypothesized that IGFs might affect the fate of myoblasts by regulating the phosphorylation of Rb. Although long-term IGF treatment is known to stimulate differentiation, we find that IGFs act initially to inhibit differentiation and are exclusively mitogenic. These early effects of IGFs are associated with maintenance of Rb phosphorylation typical of proliferating cells; upregulation of the gene expression of cyclin-dependent kinase 4 and cyclin D1, components of a holoenzyme that plays a principal role in mediating Rb phosphorylation; and marked inhibition of the gene expression of myogenin, a member of the MyoD family of skeletal muscle-specific transcription factors that is essential in muscle differentiation. We also find that IGF-induced inhibition of differentiation occurs through a process that is independent of its mitogenic effects. We demonstrate, thus, that IGFs regulate Rb phosphorylation and cyclin D1 and cyclin-dependent kinase 4 gene expression; together with their biphasic effects on myogenin expression, these results suggest a mechanism by which IGFs are initially mitogenic and subsequently differentiation-promoting in skeletal muscle.
Resumo:
Chronic exposure of HIT-T15 beta cells to elevated glucose concentrations leads to decreased insulin gene transcription. The reduction in expression is accompanied by diminished binding of a glucose-sensitive transcription factor (termed GSTF) that interacts with two (A+T)-rich elements within the 5' flanking control region of the insulin gene. In this study we examined whether GSTF corresponds to the recently cloned insulin gene transcription factor STF-1, a homeodomain protein whose expression is restricted to the nucleus of endodermal cells of the duodenum and pancreas. We found that an affinity-purified antibody recognizing STF-1 supershifted the GSTF activator complex formed from HIT-T15 extracts. In addition, we demonstrated a reduction in STF-1 mRNA and protein levels that closely correlated with the change in GSTF binding in HIT-T15 cells chronically cultured under supraphysiologic glucose concentrations. The reduction in STF-1 expression in these cells could be accounted for by a change in the rate of STF-1 gene transcription, suggesting a posttranscriptional control mechanism. In support of this hypothesis, no STF-1 mRNA accumulated in HIT-T15 cells passaged in 11.1 mM glucose. The only RNA species detected was a 6.4-kb STF-1 RNA species that hybridized with 5' and 3' STF-1-specific cDNA probes. We suggest that the 6.4-kb RNA represents an STF-1 mRNA precursor and that splicing of this RNA is defective in these cells. Overall, this study suggests that reduced expression of a key transcriptional regulatory factor, STF-1, contributes to the decrease in insulin gene transcription in HIT-T15 cells chronically cultured in supraphysiologic glucose concentration.
Resumo:
beta zero-Thalassemia is an inherited disorder characterized by the absence of beta-globin polypeptides derived from the affected allele. The molecular basis for this deficiency is a mutation of the adult beta-globin structural gene or cis regulatory elements that control beta-globin gene expression. A mouse model of this disease would enable the testing of therapeutic regimens designed to correct the defect. Here we report a 16-kb deletion that includes both adult beta-like globin genes, beta maj and beta min, in mouse embryonic stem cells. Heterozygous animals derived from the targeted cells are severely anemic with dramatically reduced hemoglobin levels, abnormal red cell morphology, splenomegaly, and markedly increased reticulocyte counts. Homozygous animals die in utero; however, heterozygous mice are fertile and transmit the deleted allele to progeny. The anemic phenotype is completely rescued in progeny derived from mating beta zero-thalassemic animals with transgenic mice expressing high levels of human hemoglobin A. The beta zero-thalassemic mice can be used to test genetic therapies for beta zero-thalassemia and can be bred with transgenic mice expressing high levels of human hemoglobin HbS to produce an improved mouse model of sickle cell disease.
Resumo:
Granzyme B serine protease is found in the granules of activated cytotoxic T cells and in natural and lymphokine-activated killer cells. This protease plays a critical role in the rapid induction of target cell DNA fragmentation. The DNA regulatory elements that are responsible for the specificity of granzyme B gene transcription in activated T-cells reside between nt -148 and +60 (relative to the transcription start point at +1) of the human granzyme B gene promoter. This region contains binding sites for the transcription factors Ikaros, CBF, Ets, and AP-1. Mutational analysis of the human granzyme B promoter reveals that the Ikaros binding site (-143 to -114) and the AP-1/CBF binding site (-103 to -77) are essential for the activation of transcription in phytohemagglutinin-activated peripheral blood lymphocytes, whereas mutation of the Ets binding site does not affect promoter activity in these cells.
Resumo:
The c-myb protooncogene encodes a highly conserved transcription factor that functions as both an activator and a repressor of transcription. The v-myb oncogenes of E26 leukemia virus and avian myeloblastosis virus encode proteins that are truncated at both the amino and the carboxyl terminus, deleting portions of the c-Myb DNA-binding and negative regulatory domains. This has led to speculation that the deleted regions contain important regulatory sequences. We previously reported that the 42-kDa mitogen-activated protein kinase (p42mapk) phosphorylates chicken and murine c-Myb at multiple sites in the negative regulatory domain in vitro, suggesting that phosphorylation might provide a mechanism to regulate c-Myb function. We now report that three tryptic phosphopeptides derived from in vitro phosphorylated c-Myb comigrate with three tryptic phosphopeptides derived from metabolically labeled c-Myb immunoprecipitated from murine erythroleukemia cells. At least two of these peptides are phosphorylated on serine-528. Replacement of serine-528 with alanine results in a 2- to 7-fold increase in the ability of c-Myb to transactivate a Myb-responsive promoter/reporter gene construct. These findings suggest that phosphorylation serves to regulate c-Myb activity and that loss of this phosphorylation site from the v-Myb proteins may contribute to their transforming potential.
Resumo:
The developmental stage- and erythroid lineage-specific activation of the human embryonic zeta- and fetal/adult alpha-globin genes is controlled by an upstream regulatory element [hypersensitive site (HS)-40] with locus control region properties, a process mediated by multiple nuclear factor-DNA complexes. In vitro DNase I protection experiments of the two G+C-rich, adult alpha-globin promoters have revealed a number of binding sites for nuclear factors that are common to HeLa and K-562 extracts. However, genomic footprinting analysis has demonstrated that only a subset of these sites, clustered between -130 and +1, is occupied in an erythroid tissue-specific manner. The function of these in vivo-occupied motifs of the alpha-globin promoters, as well as those previously mapped in the HS-40 region, is assayed by site-directed mutagenesis and transient expression in embryonic/fetal erythroid K-562 cells. These studies, together with our expression data on the human embryonic zeta-globin promoter, provide a comprehensive view of the functional roles of individual nuclear factor-DNA complexes in the final stages of transcriptional activation of the human alpha-like globin promoters by the HS-40 element.
Resumo:
Many studies have characterized the transmembrane signaling events initiated after T-cell antigen receptor recognition of major histocompatibility complex (MHC)-bound peptides. Yet, little is known about signal transduction from a set of MHC class I recognizing receptors on natural killer (NK) cells whose ligation dramatically inhibits NK cell-mediated killing. In this study we evaluated the influence of MHC recognition on the proximal signaling events in NK cells binding tumor targets. We utilized two experimental models where NK cell-mediated cytotoxicity was fully inhibited by the recognition of specific MHC class I molecules. NK cell binding to either class I-deficient or class I-transfected target cells initiated rapid protein tyrosine kinase activation. In contrast, whereas NK cell binding to class I-deficient targets led to inositol phosphate release and increased intracellular free calcium ([Ca2+]i), NK recognition of class I-bearing targets did not induce the activation of these phospholipase C-dependent signaling events. The recognition of class I by NK cells clearly had a negative regulatory effect since blocking this interaction using anti-class I F(ab')2 fragments increased inositol 1,4,5-trisphosphate release and [Ca2+]i and increased the lysis of the targets. These results suggest that one of the mechanisms by which NK cell recognition of specific MHC class I molecules can block the development of cell-mediated cytotoxicity is by inhibiting specific critical signaling events.
Resumo:
The present study was undertaken to define the 5' and 3' regulatory sequences of human von Willebrand factor gene that confer tissue-specific expression in vivo. Transgenic mice were generated bearing a chimeric construct that included 487 bp of 5' flanking sequence and the first exon fused in-frame to the Escherichia coli lacZ gene. In situ histochemical analyses in independent lines demonstrated that the von Willebrand factor promoter targeted expression of LacZ to a subpopulation of endothelial cells in the yolk sac and adult brain. LacZ activity was absent in the vascular beds of the spleen, lung, liver, kidney, testes, heart, and aorta, as well as in megakaryocytes. In contrast, in mice containing the lacZ gene targeted to the thrombomodulin locus, the 5-bromo-4-chloro-3-indolyl beta-D-galactopyranoside reaction product was detected throughout the vascular tree. These data highlight the existence of regional differences in endothelial cell gene regulation and suggest that the 733-bp von Willebrand factor promoter may be useful as a molecular marker to investigate endothelial cell diversity.
Resumo:
Acetylcholine, one of the main neurotransmitters in the nervous system, is synthesized by the enzyme choline acetyltransferase (ChAT; acetyl-CoA:choline O-acetyltransferase, EC 2.3.1.6). The molecular mechanisms controlling the establishment, maintenance, and plasticity of the cholinergic phenotype in vivo are largely unknown. A previous report showed that a 3800-bp, but not a 1450-bp, 5' flanking segment from the rat ChAT gene promoter directed cell type-specific expression of a reporter gene in cholinergic cells in vitro. Now we have characterized a distal regulatory region of the ChAT gene that confers cholinergic specificity on a heterologous downstream promoter in a cholinergic cell line and in transgenic mice. A 2342-bp segment from the 5' flanking region of the ChAT gene behaved as an enhancer in cholinergic cells but as a repressor in noncholinergic cells in an orientation-independent manner. Combined with a heterologous basal promoter, this fragment targeted transgene expression to several cholinergic regions of the central nervous system of transgenic mice, including basal forebrain, cortex, pons, and spinal cord. In eight independent transgenic lines, the pattern of transgene expression paralleled qualitatively and quantitatively that displayed by endogenous ChAT mRNA in various regions of the rat central nervous system. In the lumbar enlargement of the spinal cord, 85-90% of the transgene expression was targeted to the ventral part of the cord, where cholinergic alpha-motor neurons are located. Transgene expression in the spinal cord was developmentally regulated and responded to nerve injury in a similar way as the endogenous ChAT gene, indicating that the 2342-bp regulatory sequence contains elements controlling the plasticity of the cholinergic phenotype in developing and injured neurons.
Resumo:
Mast cells are multifunctional bone marrow-derived cells found in mucosal and connective tissues and in the nervous system, where they play important roles in tissue inflammation and in neuroimmune interactions. Very little is known about endogenous molecules and mechanisms capable of modulating mast cell activation. Palmitoylethanolamide, found in peripheral tissues, has been proposed to behave as a local autacoid capable of downregulating mast cell activation and inflammation. A cognate N-acylamide, anandamide, the ethanolamide of arachidonic acid, occurs in brain and is a candidate endogenous agonist for the central cannabinoid receptor (CB1). As a second cannabinoid receptor (CB2) has been found in peripheral tissues, the possible presence of CB2 receptors on mast cells and their interaction with N-acylamides was investigated. Here we report that mast cells express both the gene and a functional CB2 receptor protein with negative regulatory effects on mast cell activation. Although both palmitoylethanolamide and anandamide bind to the CB2 receptor, only the former downmodulates mast cell activation in vitro. Further, the functional effect of palmitoylethanolamide, as well as that of the active cannabinoids, was efficiently antagonized by anandamide. The results suggest that (i) peripheral cannabinoid CB2 receptors control, upon agonist binding, mast cell activation and therefore inflammation; (ii) palmitoylethanolamide, unlike anandamide, behaves as an endogenous agonist for the CB2 receptor on mast cells; (iii) modulatory activities on mast cells exerted by the naturally occurring molecule strengthen a proposed autacoid local inflammation antagonism (ALIA) mechanism; and (iv) palmitoylethanolamide and its derivatives may provide antiinflammatory therapeutic strategies specifically targeted to mast cells ("ALIAmides").
Resumo:
Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.
Resumo:
Parcela considerável de pacientes com distúrbios de crescimento não têm a causa de seus quadros clínicos estabelecida, incluindo aproximadamente 50% dos pacientes com diagnóstico clínico de síndrome de Silver−Russell (SRS) e 10-20% dos pacientes com síndrome de Beckwith-Wiedemann (BWS). O objetivo deste estudo foi investigar as causas genéticas e epigenéticas de distúrbios de crescimento, de etiologia desconhecida, numa contribuição para o entendimento de mecanismos que regulam o crescimento. O estudo compreendeu: (1) a investigação de microdesequilíbrios cromossômicos, por aCGH; (2) a análise do perfil de expressão alelo-específica de genes sujeitos a imprinting (IG), por pirossequenciamento (PSQ) ou sequenciamento de Sanger; (3) a investigação do padrão de metilação global em pacientes com restrição de crescimento, utilizando microarray de metilação. A casuística constituiu-se de 41 pacientes não aparentados, com distúrbios de crescimento, de etiologia desconhecida: (1) 25, com hipótese diagnóstica de SRS; (2) seis, com restrição de crescimento intrauterino e peso ao nascimento abaixo do 10º percentil, associados a outros sinais clínicos; (3) sete, com hipótese diagnóstica de BWS; e (4) três, com macrossomia pré-natal ou pós-natal, associada a outros sinais. A investigação de microdesequilíbrios cromossômicos foi realizada em 40 pacientes. Foram detectadas 58 variantes raras em 30/40 pacientes (75%): 40 foram consideradas provavelmente benignas (18 pacientes, 45%), 12, com efeito patogênico desconhecido (11 pacientes, 27,5%), duas, provavelmente patogênicas (um paciente, 2,5%) e quatro, patogênicas (três pacientes, 7,5%). Essas frequências são comparáveis àquelas descritas em estudos que investigaram CNV em grupos de pacientes com distúrbios de crescimento e outras alterações congênitas, incluindo SRS, e mostram a importância da investigação de microdesequilíbrios cromossômicos nesses pacientes. A diversidade dos microdesequilíbrios cromossômicos identificados é reflexo da heterogeneidade clínica das casuísticas. Neste estudo, muitos dos pacientes com hipótese diagnóstica de SRS e BWS apresentavam sinais clínicos atípicos, explicando a ausência neles das alterações (epi)genéticas que causam essas síndromes. A identificação de CNV características de outras síndromes reflete a sobreposição de sinais clínicos com BWS e SRS. A análise do perfil de expressão alelo-específica de IG foi realizada em um subgrupo de 18 pacientes com restrição de crescimento. Trinta IG com função em proliferação celular, crescimento fetal ou neurodesenvolvimento foram inicialmente selecionados. Após seleção de SNP transcritos com alta frequência na população, genotipagem de pacientes, genitores e indivíduos controle, determinação da expressão dos IG em sangue periférico e seu padrão de expressão (mono ou bialélico), 13 IG, expressos no sangue, tiveram a expressão alelo-específica avaliada, sete deles por PSQ e seis por sequenciamento de Sanger. Alterações no perfil de expressão de dois genes, de expressão normalmente paterna, foram detectadas em 4/18 pacientes (22%). Este estudo é o primeiro a utilizar pirossequenciamento e sequenciamento de Sanger na avaliação do perfil de expressão alelo-específica de IG, em pacientes com restrição de crescimento. Apesar de terem limitações, ambas as técnicas mostraram-se robustas e revelaram alterações de expressão alélica interessantes; entretanto, a relação dessas alterações com o quadro clínico dos pacientes permanece por esclarecer. A investigação da metilação global do DNA foi realizada em subgrupo de 21 pacientes com restrição de crescimento e em 24 indivíduos controle. Dois tipos de análise foram realizados: (1) análise diferencial de grupo e (2) análise diferencial individual. Na primeira análise, em que foi comparado o padrão de metilação do grupo de pacientes com quadro clínico sugestivo de SRS (n=16) com o do grupo controle (n=24), não houve indicação de hipo ou hipermetilação global no grupo SRS. Na segunda análise, foi comparado o padrão de metilação de cada um dos 21 pacientes com restrição de crescimento e dos 24 indivíduos controle, com o padrão de metilação do grupo controle. O número médio de CpG hipermetilados e de segmentos diferencialmente metilados (SDM) foi significativamente maior nos pacientes. Foram identificados 82 SDM hipermetilados, estando 57 associados a gene(s) (69,5%), em 16 pacientes, e 51 SDM hipometilados, 41 deles associados a gene(s) (80,4%), em 10 pacientes. A análise de ontologia genética dos 61 genes associados aos SDM hipo ou hipermetilados nos pacientes destacou genes que atuam no desenvolvimento e na morfogênese do sistema esquelético e de órgãos fetais, e na regulação da transcrição gênica e de processos metabólicos. Alterações de metilação em genes que atuam em processos de proliferação e diferenciação celulares e crescimento foram identificadas em 9/20 dos pacientes (45%), sugerindo implicação clínica. Não foi detectada alteração epigenética comum aos pacientes com diagnóstico clínico de SRS, explicável provavelmente pela heterogeneidade clínica. A investigação de metilação global, utilizando microarray, produziu novos dados que podem contribuir para a compreensão de mecanismos moleculares que influenciam o crescimento pré- e pós-natal. Na translocação aparentemente equilibrada - t(5;6)(q35.2;p22.3)dn, detectada em paciente com suspeita clínica de SRS, a interrupção de um gene, pela quebra no cromossomo 6, pode ser a causa do quadro clínico; alternativamente, a translocação pode ter impactado a regulação de genes de desenvolvimento localizados próximos aos pontos de quebra. A análise de expressão em sangue periférico mostrou que os níveis de cDNA do gene, interrompido pelo ponto de quebra da translocação, estavam reduzidos à metade. Além de sinais típicos da SRS, a paciente apresentava algumas características clínicas sugestivas de displasia cleidocraniana. Assim, a translocação t(5;6) pode ter alterado a interação de genes de desenvolvimento e seus elementos reguladores, levando à desregulação de sua expressão espaço-temporal, e resultando num fenótipo atípico, com características sobrepostas de mais de uma síndrome genética
Resumo:
This paper reviews the current EU policy framework in view of its impact on hydrogen and fuel cell development. It screens EU energy policies, EU regulatory policies and EU spending policies. Key questions addressed are as follows: To what extent is the current policy framework conducive to hydrogen and fuel cell development? What barriers and inconsistencies can be identified? How can policies potentially promote hydrogen and fuel cells in Europe, taking into account the complex evolution of such a disruptive technology? How should the EU policy framework be reformed in view of a strengthened and more coherent approach? The paper concludes that the current EU policy framework does not hinder hydrogen development. Yet it does not constitute a strong push factor either. EU energy policies have the strongest impact on hydrogen and fuel cell development even though their potential is still underexploited. Regulatory policies have a weak but positive impact on hydrogen. EU spending policies show some inconsistencies. However, the large scale market development of hydrogen and fuel cells will require a new policy approach which comprises technology specific support as well as a supportive policy framework with a special regional dimension.