878 resultados para expectations gaps


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Arbuscular mycorrhizae are symbiotic associations among glomalean fungi and plant roots that often lead to enhanced water and nutrient uptake and plant growth. We describe experiments to test whether inoculum potential of arbuscular mycorrhizal (AM) fungal communities varies spatially within a broadleaf temperate forest, and also whether there is variability in the effectiveness of AM fungal communities in enhancing seedling growth. Inoculum potential of arbuscular mycorrhizal fungi in a temperate broad-leaved forest did not vary significantly among sites. Inoculum potential, measured as the extent to which the roots of red maple seedlings that had been germinated on sterile sand and then transplanted into the forest, were colonized by AM fungi, was similar in floodplain and higher elevation sites. It was as similar under ectomycorrhizal oaks as it was under red maples and other AM tree species. It was also similar among sites with deciduous understory shrubs with arbuscular mycorrhizae (spicebush, Lindera benzoin) and those with evergreen vegetation with ericoid mycorrhizae (mountain laurel, Kalmia latifolia). Where spicebush was the dominant understory shrub, inoculum potential was greater under gaps in the canopy than within the understory. Survivorship of transplanted red maple seedlings varied significantly over sites but was not strongly correlated with measures of inoculum potential. In a greenhouse growth experiment, arbuscular mycorrhizal fungal communities obtained from tree roots from the forest had different effects on plant growth. Seedlings inoculated with roots of red maple had twice the leaf area after 10 wk of growth compared to the AM community obtained from roots of southern red oaks. Thus, although there appears to be little heterogeneity in inoculum potential in the forest, there are differences in the effectiveness of different inocula. These effects have the potential to affect tree species diversity in forests by modifying patterns of seedling recruitment.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Medication errors are a leading cause of unintended harm to patients in Australia and internationally. Research in this area has paid relatively little attention to the interactions between organisational factors and violations of procedures in producing errors, although violations have been found to increase the likelihood of these errors. This study investigated the role of organisational factors in contributing to violations by nurses when administering medications. Data were collected using a self-report questionnaire completed by 506 nurses working in either rural or remote areas in Queensland, Australia. This instrument was used to develop a path model wherein organisational variables predicted 21% of the variance in self-reported violations. Expectations of medical officers mediated the relationship between working conditions of nursing staff and violation behaviour.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Paul Anthony Samuelson proposed and practiced a program for the Whig history of economics. One such example is his account of Frank Ramsey`s contribution to optimal taxation in 1927. For him, and mainly for the public finance economists who rediscovered later Ramsey`s contribution, Ramsey was a genius ahead of his time who used a mathematics too advanced for his contemporaries and was thus rediscovered only in the 1970S, when economists became more mathematically literate. In such rediscovery, a memorandum that Samuelsom wrote in 1951 for the us Treasury became central. I examine Samuelson`s account and challenge it in some respects and explore the historical context of the emergence of the optimal taxation literature in the 1970S. Additional, I analyze the canonization of Ramsey in this field, stressing Samuelson`s role in this process as a professor who liked telling stories about economists, especially about Ramsey, to his graduate students.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Consumers worldwide are increasingly concerned with sustainable production and consumption. Recently, a comprehensive study ranked 17 countries in regard to their environmentally friendly behaviour among consumers. Brazil was one of the top countries in the list. Yet, several studies highlight significant differences between consumers` intentions to consume ethically, and their actual purchase behaviour: the so-called `Attitude-Behaviour Gap`. In developing countries, few studies have been conducted on this issue. The objective of this study is therefore to investigate the gap between citizens` sustainability-related attitudes and food purchasing behaviour using empirical data from Brazil. To this end, Brazilian citizens` attitudes towards pig production systems were mapped through conjoint analysis and their coexistence with relevant pork product-related purchasing behaviour of consumers was investigated through cluster analysis. The conjoint experiment was carried Out with empirical data collected from 475 respondents surveyed in the South and Center-West regions of Brazil. The results of the conjoint analysis were used for a subsequent cluster analysis in order to identify clusters of Brazilian citizens with diversified attitudes towards pig production systems, using socio-demographics, attitudes towards sustainability-related themes that are expected to influence the way they evaluate pig production systems, and consumption frequency of various pork products as clusters` background information. Three clusters were identified as `indifferent`, `environmental conscious` and `sustainability-oriented` citizens. Although attitudes towards environment and nature had indeed an influence on citizens` specific attitudes towards pig farming at the cluster level, the relationship between `citizenship` and consumption behaviour was found to be weak. This finding is similar to previous research conducted with European consumers: what people (in their role of citizens) think about pig production systems does not appear to significantly influence their pork consumption choices. Improvements in the integrated management of this chain would better meet consumers` sustainability-related expectations towards pig production systems.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

To attend and obtain the systems and. internal controls mechanisms proposed by Sarbanes-Oxley certifications is actually a big challenge,for most of the multinational companies registered in SEC (US Securities and Exchange Commission). This work has the objective of contributing to the analysis of this methodology, not only to attend the law but to reduce cost and generate value through the strengthen of the internal control systems, turning them into animating value generation process mechanisms. So, the idea is to identify the main gaps in the theory through the literature revision and a case study in order to put a question to the main deficiencies, strong points or contributions through the evaluation of the noticed practices. Finally, we can say that a a result of the research and the analyses made in. this case, the vast majority of executives and other employees recognize the benefit that Sarbanes-Oxley Act has brought to the company searched. Also recognize that, although there is still necessity for systemic adequacy and infrastructure, it helps and reinforce reducing and controlling the risks. the system of internal controls in all areas of expertise. They approach and understand that there is the need for a change in the other employees` culture to be inserted in the day-today routine as internal controls, attention to Sarbanes-Oxley and Corporate Governance, making the control cost smaller when compared to the benefits generated.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Discussion opposing the Theory of the Firm to the Theory of Stakeholders are contemporaneous and polemical. One focal point of such debates refers to which objective-function companies, should choose, whether that of the shareholders or that of the stakeholders, and whether it is possible to opt for both simultaneously. Several empirical studies. have attempted-to test a possible correlation between both functions, and there has not been any consensus-so far. The objective of the present research is to examine a gap in such discussions: is there (or not) a subordination of the stakeholders` objective-function to that of the shareholders? The research is empirical,and analytical and employs quantitative methods. Hypotheses were tested and data analyzed by using non-parametrical (chi-square test) and parametrical procedures (frequency. correlation `coefficient). Secondary data was collected from he Economitica database and from the Brazilian Institute of Social and-Economic Analyses (IBASE) website, relative to public companies that have published their Social Balance Statements following the IBASE model from 1999 to 2006, whose sample amounted to 65 companies; In order to assess the objective-function of shareholders a proxy was created based on the following three indices: ROE (return on equity), EnterpriseValue and Tobin`s Q. In order to assess the objective-function of stakeholders a proxy was created by employing the following IBASE social balance indices: internal ones (ISI), external ones (ISE), and environmental ones (IAM). The results have shown no evidence of subordination of stakeholders` objective-function to that of the shareholders in analyzed companies, negating initial expectations and calling for deeper investigation of results. Its main conclusion, which states that the attempted subordination does not take place, is limited to the sample herein investigated and calls for ongoing research aiming at improvements which may lead to sample enlargement and, as a consequence, may make feasible the application of other statistical techniques which may yield a more thorough, analysis of the studied phenomehon.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

An important segmentation basis used by firms is related to consumers` personal values which are investigated in this study. It was used a descriptive research with the survey method of data collection in a sample of executives from Sao Paulo who are considered to be potential buyers of high value and innovative goods. An exploratory factor analysis was employed in order to reduce the values scale used and a cluster analysis was performed to identify the groups of executives according to the importance attached to different person values. Concluding, it was observed that there was a similarity among the three personal values dimensions, named as Civility (concerns about having a good conduct before society according to social rules of interaction), Self-Direction (intellectual aspects and practical orientation in their conducts) and Conformity (restriction of actions, inclinations and impulses, that are likely to harm others and would violate expectations) and the ones reported in the theory Rokeach`s theory about instrumental personal values. Furthermore, three groups of executives were identified (good conduct group, low restriction group and high restriction group). The differences observed in the importance of personal values here presented by the dimensions called Civility, Self-Direction and Conformity can lead to different buying behaviors and product preferences. From the results found in this study the companies could adapt their current and new products offers, as well as their communication in order to better serve these segments of executives from Sao Paulo.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Background There are few population-based data on long-term management of patients after coronary artery bypass graft (CABG), despite the high risk for future major vascular events among this group. We assessed the prevalence and correlates of pharmacotherapy for prevention of new cardiac events in a large population-based series. Methods A postal survey was conducted of 2500 randomly selected survivors from a state population of patients 6 to 20 years after first CABG. Results Response was 82% (n = 2061). Use of antiplatelet agents (80%) and statins (64%) declined as age increased. Other independent predictors of antiplatelet use included statin use (odds ratio [OR] 1.6, 95% CI 1.26-2.05) and recurrent angina (OR 1.6, CI 1.17-2.06). Current smokers were less likely to use aspirin (OR 0.59, CI 0.4-0.89). Statin use was associated with reported high cholesterol (OR 24.4, CI 8.4-32.4), management by a cardiologist (OR 2.3, CI 1.8-3.0), and the use of calcium channel-blockers. Patients reporting hypertension or heart failure, in addition to high cholesterol, were less likely to use statins. Angiotensin-converting enzyme inhibitors were the most commonly prescribed agents for management of hypertension (59%) and were more frequently used among patients with diabetes and those with symptoms of heart failure. Overall 42% of patients were on angiotensin-converting enzyme inhibitors and 36% on beta-blockers. Conclusions Gaps exist in the use of-recommended medications after CABG. Lower anti-platelet and statin use was associated with older age, freedom from angina, comorbid heart failure or hypertension, and not regularly visiting a cardiologist. Patients who continue to smoke might be less likely to adhere to prescribed medications.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The experiment examined the influence of memory for prior instances on aircraft conflict detection. Participants saw pairs of similar aircraft repeatedly conflict with each other. Performance improvements suggest that participants credited the conflict status of familiar aircraft pairs to repeated static features such as speed, and dynamic features such as aircraft relative position. Participants missed conflicts when a conflict pair resembled a pair that had repeatedly passed safely. Participants either did not attend to, or interpret, the bearing of aircraft correctly as a result of false memory-based expectations. Implications for instance models and situational awareness in dynamic systems are discussed.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

In studies of mirror-self-recognition subjects are usually surreptitiously marked on their head, and then presented with a mirror. Scores of studies have established that by 18 to 24 months, children investigate their own head upon seeing the mark in the mirror. Scores of papers have debated what this means. Suggestions range from rich interpretations (e.g., the development of self-awareness) to lean accounts (e.g., the development of proprioceptivevisual matching), and include numerous more moderate proposals (e.g., the development of a concept of one's face). In Study 1, 18-24-monthold toddlers were given the standard test and a novel task in which they were marked on their legs rather than on their face. Toddlers performed equivalently on both tasks, suggesting that passing the test does not rely on information specific to facial features. In Study 2, toddlers were surreptitiously slipped into trouser legs that were prefixed to a highchair. Toddlers failed to retrieve the sticker now that their legs looked different from expectations. This finding, together with the findings from a third study which showed that self-recognition in live video feedback develops later than mirror selfrecognition, suggests that performance is not solely the result of proprioceptive-visual matching.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This work investigated listeners` sense of the temporal expression of tonal modulation. One experiment described the effects on retrospective reproductions of sudden and gradual modulations to close and distant keys. The results showed that modulations elicit time underestimations as an inverse function of interkey distances, with a major impact for sudden modulations. A proposed vectorial model - ""Expected Development Fraction"" (EDF) - describes the development of expectations when an interkey distance is traversed during a certain time interval. This expected development is longer than the perceived duration, leading to underestimation of the time.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The Strength of Weak Parties The aim of this article is to fill some gaps in research on the Brazilian electoral arena. The current literature, by neglecting the study of party organization, ends up overlooking fundamental questions for understanding how the electoral process works. This study addressed two questions: How do Brazilian parties work? What is the impact of party organization on a party`s decision to launch or withhold a candidate in a given election? We intend to show that the parties have more life than many studies on our political system tend to show. This partisan life helps understand one of the central aspects of the electoral arena, that is, how pre-election coordination occurs.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

BACKGROUND: Studies have shown that human immunodeficiency virus (HIV) residual risk is higher in Brazilian than in US and European blood donors, probably due to failure to defer at-risk individuals in Brazil. This study assessed the impact of an educational brochure in enhancing blood donors` knowledge about screening test window phase and reducing at-risk individuals from donating. STUDY DESIGN AND METHODS: This trial compared an educational intervention with a blood center`s usual practice. The brochure was distributed in alternating months to all donors. After donating, sampled participants completed two questions about their HIV window period knowledge. The impact on HIV risk deferral, leaving without donation, confidential unit exclusion (CUE) use, and test positivity was also analyzed. RESULTS: From August to November 2007 we evaluated 33,940 donations in the main collection center of Fundacao Pro-Sangue/Hemocentro de Sao Paulo in Sao Paulo, Brazil. A significant (p < 0.001) pamphlet effect was found on correct responses to both questions assessing HIV window phase knowledge (68.1% vs. 52.9%) and transfusion risk (91.1% vs. 87.2%). After adjusting for sex and age, the pamphlet effect was strongest for people with more than 8 years of education. There was no significant pamphlet effect on HIV risk deferral rate, leaving without donation, use of CUE, or infectious disease rates. CONCLUSION: While the educational pamphlet increased window period knowledge, contrary to expectations this information alone was not enough to make donors self-defer or acknowledge their behavioral risk.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).