Mycobacterium ulcerans persistence at a village water source of Buruli ulcer patients

Buruli ulcer (BU), a neglected tropical disease of the skin and subcutaneous tissue, is caused by Mycobacterium ulcerans and is the third most common mycobacterial disease after tuberculosis and leprosy. While there is a strong association of the occurrence of the disease with stagnant or slow flowing water bodies, the exact mode of transmission of BU is not clear. M. ulcerans has emerged from the environmental fish pathogen M. marinum by acquisition of a virulence plasmid encoding the enzymes required for the production of the cytotoxic macrolide toxin mycolactone, which is a key factor in the pathogenesis of BU. Comparative genomic studies have further shown extensive pseudogene formation and downsizing of the M. ulcerans genome, indicative for an adaptation to a more stable ecological niche. This has raised the question whether this pathogen is still present in water-associated environmental reservoirs. Here we show persistence of M. ulcerans specific DNA sequences over a period of more than two years at a water contact location of BU patients in an endemic village of Cameroon. At defined positions in a shallow water hole used by the villagers for washing and bathing, detritus remained consistently positive for M. ulcerans DNA. The observed mean real-time PCR Ct difference of 1.45 between the insertion sequences IS2606 and IS2404 indicated that lineage 3 M. ulcerans, which cause human disease, persisted in this environment after successful treatment of all local patients. Underwater decaying organic matter may therefore represent a reservoir of M. ulcerans for direct infection of skin lesions or vector-associated transmission.

Hierarchical self-assembly of nucleotide-appended oligopyrenotides into defined supramolecular objects

Supramolecular DNA assembly blends DNA building blocks with synthetic organic and inorganic molecules giving structural and functional advantages both to the initial self-assembly process and to the final construct. Synthetic molecules can bring a number of additional interactions into DNA nanotechnology. Incorporating extended aromatic molecules as connectors of DNA strands allows folding of these strands through π-π stacking (DNA “foldamers”). In previous work it was shown that short oligopyrenotides (phosphodiester-linked pyrene oligomers) behave as staircase-like foldamers, which cooperatively self-assemble into two-dimensional supramolecular polymers in aqueous medium. Herein, we demonstrate that a 10-mer DNA-sequence modified with 7 pyrene units (see illustration) forms dimensionally-defined supramolecular polymers under thermodynamic conditions in water. We present the self-assembly behavior, morphological studies, and the spectroscopic properties of the investigated DNA-sequences (illustrative AFM picture shown below).

Identification of Clostridium chauvoei in cultures and clinical material from blackleg using PCR.

An identification system for Clostridium chauvoei, using PCR amplification of the 16S rRNA gene (rrs) with specific oligonucleotide primers and subsequent restriction digestion of the amplification product is described. The specific oligonucleotide primers were designed based on the rrs gene sequences of C. chauvoei by comparing it to the DNA sequences of the rrs genes of its most closely related species Clostridium septicum and Clostridium carnis. A subsequent restriction digestion of the 960 bp amplification product was used in order to unambiguously identify C. chauvoei. The developed identification system was evaluated on clinical material during a recent outbreak of blackleg in cattle. Thereby, C. chauvoei was identified as the etiologic agent of the outbreak either directly from clinical samples of muscle, liver, spleen and kidney or from primary cultures made with this material. A comparison of the newly developed method with standard diagnostic tools for C. chauvoei showed that it has advantages over the immunofluorescence and is, therefore, a useful option to it. Moreover, the assay is a valuable tool for the phylogenetic identification of C. chauvoei which can assist to substitute the fastidious traditional identification methods and replace laboratory animal testing currently used.

A Method for Preparing Oligodeoxynucleotides Containing an Apurinic Site

10.1002/hlca.19900730309.abs In three steps, 2-deoxy-D-ribose has been converted into a phosphoramidite building block bearing a (t-Bu)Me2Si protecting group at the OH function of the anomeric centre of the furanose ring. This building block was subsequently incorporated into DNA oligomers of various base sequences using the standard phosphoramidite protocol for automated DNA synthesis. The resulting silyl-oligomers have been purified by HPLC and selectively desilylated to the corresponding free apurinic DNA sequences. The hexamer d (A-A-A-A-X-A) (X representing the apurinic site) which was prepared in this way was characterized by 1H- and 31P-NMR spectroscopy. The other sequences as well as their fragments, which formed upon treatment with alkali base, were analyzed by polyacrylamide gel electrophoresis.

Reclassification of Actinobacillus muris as Muribacter muris gen. nov. comb. nov.

To reinvestigate the taxonomy of [Actinobacillus] muris, 474 strains mainly from mice and rats were characterized by phenotype and 130 strains selected for genotypic characterization by 16S rRNA and partial rpoB gene sequencing. The type strain was further investigated by whole genome sequencing. Phylogenetic analysis of the DNA sequences showed one monophyletic group with intra group similarities of 96.7 % and 97.2 % for 16S rRNA and rpoB genes, respectively. The lowest 16S rRNA similarity to the closest related valid named taxon outside the group was 95.9 % to the type strain of [Pasteurella] pneumotropica. The closest related taxon based on rpoB sequence comparison was 'Haemophilus influenzae-murium' with 88.4 %. A new genus, Muribacter is proposed based on a distinct phylogenetic position based on 16S rRNA and rpoB gene sequence comparisons with major divergence to the existing genera of Pasteurellaceae. The new genus includes the characteristics of [Actinobacillus] muris with the emendation that acid formation from (-)-D-mannitol is variable as well the hydrolysis of esculin while the α-glucosidase test is positive. There is no requirement for exogenously supplied nicotinamide adenine dinucleotide (V factor) for the majority of strains investigated, however, one strain was found positive. The major fatty acids of the type strain of Muribacter muris were C 14:0, C 14:0 3OH/C 16:1 ISOI, C 16:1 ω7c and C 16:0 which is in line with most genera of Pasteurellaceae. The type strain of Muribacter muris is CCUG 16938T ( = NCTC 12432T = ATCC 49577T).

EXPRESSION OF THE HUMAN PLACENTAL LACTOGEN GENES

The placenta is the site of synthesis of various peptide and steroid hormones related to pregnancy. Human placental lactogen (hPL) is the predominant peptide hormone secreted by term placenta and its synthesis is tissue-specific and coupled to placenta development. The objective of this work was to study the structure and expression of the hPL.^ Poly(A('+))RNA from human term placenta was translated in a mouse-derived cell-free system. A major band corresponding to pre-hPL and a minor band comigrating with mature hPL, represent (TURN)15% of the total radioactively labeled proteins. Analysis of the poly(A('+))RNA showed a prominent band at approximately 860 nucleotides. A corresponding band was observed in Northern blots of total RNA, hybridized with {('32)P}-labeled recombinant plasmid containing a portion of hPL cDNA. Similar analyses of nuclear RNA showed at least four additional bands at 990, 1200, 1460 and 1760 nucleotides, respectively, which are likely precursors of hPL mRNA. Poly(A('+))RNA was used to construct a cDNA library, of which approximately 5% of the clones were found to hybridize to hPL DNA sequences. Heteroduplexes constructed between a clone containing a 815 bp hPL cDNA insert and a hPL genomic DNA clone revealed four small intervening sequences which can account for the lengths observed in hnRNA molecules.^ Recombinant plasmid HCS-pBR322 containing a 550 bp insert of a cDNA transcript of human placental lactogen (hPL) mRNA was ('3)H-labeled an hybridized in situ to human chromosome preparations. These experiments allowed assignment of the hPL and growth hormone (hGH) genes, which have over 90% nucleotide homology in their coding sequences, to band q22-24 of chromosome 17. A gene copy number experiment showed that both genes are present in (TURN)3 copies per haploid genome.^ Experiments were designed to determine if all members of the hPL gene cluster, consisting of four non-allelic genes, are transcribed in term placenta. Advantage was taken of differences in restriction endonuclease sites in the coding portions of the different hPL genes, to distinguish the putative cDNAs of the transcriptionally active genes. Two genes were found to be represented in the cDNA library and their cDNA transcripts were isolated and characterized. Three independent methods showed that their corresponding mRNAs are about equally represented in the hPL mRNA population. The two cDNAs code for prehPL proteins which differ at a single amino acid position. However the secreted hPLs have identical amino acid sequences. A tetramer insertion duplication was found in a palindrome area of the 3' untranslated region of one of the hPL mRNAs. ^

An analysis of the function of region 1.2 of the primary sigma factor, sigma 70, from Escherichia coli

The sigma (σ) subunit of eubacterial RNA polymerase is required for recognition of and transcription initiation from promoter DNA sequences. One family of sigma factors includes those related to the primary sigma factor from E. coli, σ70. Members of the σ70 family have four highly conserved domains, of which regions 2 through 4 are present in all members. Region 1 can be subdivided into regions 1.1 and 1.2. Region 1.1 affects DNA binding by σ 70 alone, as well as transcription initiation by holoenzyme. Region 1.2, present and highly conserved in most sigma factors, has not yet been assigned a putative function, although previous work demonstrated that it is not required for either association with the core subunits of RNA polymerase or promoter specific binding by holoenzyme. This study primarily investigates the functional role of region 1.2 during transcription initiation. In vivo and in vitro characterization of thirty-two single amino acid substitutions targeted to region 1.2 of E. coli σ70 as well as a deletion of region 1.2, revealed that mutations in region 1.2 can affect promoter binding, open complex formation, initiated complex formation, and the transition from abortive transcription to elongation. The relative degree of solvent exposure of several positions in region 1.2 has been determined, with positions 116 and 122 likely to be located near the surface of σ70. ^ During the course of this study, the existence of two “wild type” variants of E. coli σ70 was discovered. The identity of amino acid 149 has been reported variably as either arginine or aspartic acid in published articles and in online databases. In vivo and in vitro characterization of the two reported variations of E. coli σ70 (N149 and D149) has determined that the two variants are functionally equivalent. However, in vivo and in vitro characterization of single amino acid substitutions and a region 1.2 deletion in the context of each variant background revealed that the behavior of some mutations are greatly affected by the identity of amino acid 149. ^

Targeted Deletion Of Functionally Validated Enhancers Defines Their Role in Mouse Limb Development

Transcriptional enhancers are genomic DNA sequences that contain clustered transcription factor (TF) binding sites. When combinations of TFs bind to enhancer sequences they act together with basal transcriptional machinery to regulate the timing, location and quantity of gene transcription. Elucidating the genetic mechanisms responsible for differential gene expression, including the role of enhancers, during embryological and postnatal development is essential to an understanding of evolutionary processes and disease etiology. Numerous methods are in use to identify and characterize enhancers. Several high-throughput methods generate large datasets of enhancer sequences with putative roles in embryonic development. However, few enhancers have been deleted from the genome to determine their roles in the development of specific structures, such as the limb. Manipulation of enhancers at their endogenous loci, such as the deletion of such elements, leads to a better understanding of the regulatory interactions, rules and complexities that contribute to faithful and variant gene transcription – the molecular genetic substrate of evolution and disease. To understand the endogenous roles of two distinct enhancers known to be active in the mouse embryo limb bud we deleted them from the mouse genome. I hypothesized that deletion of these enhancers would lead to aberrant limb development. The enhancers were selected because of their association with p300, a protein associated with active transcription, and because the human enhancer sequences drive distinct lacZ expression patterns in limb buds of embryonic day (E) 11.5 transgenic mice. To confirm that the orthologous mouse enhancers, mouse 280 and 1442 (M280 and M1442, respectively), regulate expression in the developing limb we generated stable transgenic lines, and examined lacZ expression. In M280-lacZ mice, expression was detected in E11.5 fore- and hindlimbs in a region that corresponds to digits II-IV. M1442-lacZ mice exhibited lacZ expression in posterior and anterior margins of the fore- and hindlimbs that overlapped with digits I and V and several wrist bones. We generated mice lacking the M280 and M1442 enhancers by gene targeting. Intercrosses between M280 -/+ and M1442 -/+, respectively, generated M280 and M1442 null mice, which are born at expected Mendelian ratios and manifest no gross limb malformations. Quantitative real-time PCR of mutant E11.5 limb buds indicated that significant changes in transcriptional output of enhancer-proximal genes accompanied the deletion of both M280 and M1442. In neonatal null mice we observed that all limb bones are present in their expected positions, an observation also confirmed by histology of E18.5 distal limbs. Fine-scale measurement of E18.5 digit bone lengths found no differences between mutant and control embryos. Furthermore, when the developmental progression of cartilaginous elements was analyzed in M280 and M1442 embryos from E13.5-E15.5, transient development defects were not detected. These results demonstrate that M280 and M1442 are not required for mouse limb development. Though M280 is not required for embryonic limb development it is required for the development and/or maintenance of body size – adult M280 mice are significantly smaller than control littermates. These studies highlight the importance of experiments that manipulate enhancers in situ to understand their contribution to development.

{\it cis\/} -acting elements and {\it trans\/} -acting factors that control serum amyloid A gene expression during inflammation

To understand how the serum amyloid A (SAA) genes are regulated, the cis-acting elements and trans-acting factors involved in the regulation of mouse SAA3 and rat SAA1 genes expression during inflammation were analyzed.^ To identify DNA sequences involved in the liver-specific expression of the mouse SAA3 gene, the 5$\sp\prime$ flanking region of this gene was analyzed by transient transfection studies. Results suggest that C/EBP, a liver-enriched transcription factor, plays an important role for the enhanced expression of the mouse SAA3 gene in hepatocytes.^ Transfection studies of the regulation of the expression of rat SAA1 gene indicated that a 322 bp fragment ($-$304 to +18) of the gene contains sufficient information for cytokine-induced expression of the reporter gene in a liver cell-specific manner. Further functional analysis of the 5$\sp\prime$ flanking region of the rat SAA1 gene demonstrated that a 65 bp DNA fragment ($-$138/$-$73) can confer cytokine-inducibility onto a heterologous promoter both in liver and nonliver cells. DNase I footprint and gel retardation assays identified five putative cis-regulatory elements within the 5$\sp\prime$ flanking region of the gene: one inducible element, a NF$\kappa$B binding site and four constitutive elements. Two constitutive elements, footprint regions I and III, were identified as C/EBP binding sites with region III having over a 10-fold higher affinity for C/EBP binding than region I. Functional analysis of the cis-elements indicated that C/EBP(I) and C/EBP(III) confer liver cell-specific activation onto a heterologous promoter, while sequences corresponding to the NF$\kappa$B element and C/EBP(I) impart cytokine responsiveness onto the heterologous promoter. These results suggest that C/EBP(I) possesses two functions: liver-specific activation and cytokine responsiveness. The identification of two cytokine responsive elements (NF$\kappa$B and C/EBP(I)), and two liver-specific elements (C/EBP(I) and C/EBP(III)) implies that multiple cis-acting elements are involved in the regulation of the expression of the rat SAA1 gene. The tissue-specific and cytokine-induced expression of rat SAA1 gene is likely the result of the interactions of these cis-acting elements with their cognate trans-acting factors as well as the interplay between the different cis-acting elements and their binding factors. (Abstract shortened with permission of author.) ^

Molecular analysis of a neurovirulent murine leukemia virus, {\it ts\/}1

ts1 is a neurovirulent spontaneous temperature-sensitive mutant of Moloney murine leukemia virus TB (MoMuLV-TB). MoMuLV-TB causes T-cell lymphoma or lymphoid leukemia in mice after a long latency period whereas ts1 causes a progressive hindlimb paralytic disease after a much shorter latency period. In previous studies, it had been shown that the temperature-sensitive defect resided in the $env$ gene. At the restrictive temperature, the envelope precursor polyprotein, gPr80$\sp{env}$, is inefficiently processed intracellularly into a heterodimer consisting of two cleavage products, gp70 and Prp15E. This inefficient processing is correlated with neurovirulence. In this study, the nucleotide sequences of the env genes for both ts1 and MoMuLV-TB were determined, and the encoded amino acid sequences were deduced from the DNA sequences. There were four unique amino acid substitutions in the gPr80$\sp{env}$ of ts1. In order to determine which unique amino acid was responsible for the phenotypic characteristics of ts1, a set of hybrid genomes was constructed by exchanging restriction fragments between ts1 and MoMuLV-TB. NIH 3T3 cells were transfected with the hybrid genomes to obtain infectious hybrid viruses. Assays of the hybrid viruses showed that a Val-25$\to$Ile substitution in gPr80$\sp{env}$ was responsible for the temperature sensitivity, inefficient processing, and neurovirulence of ts1. In further studies, the Ile-25 in gPr80$\sp{env}$ was substituted with Thr, Ala, Leu, Gly, and Glu by site-directed mutagenesis to generate a new set of mutant viruses, i.e., ts1-T, -A, -L, -G, and -E, respectively. The rank order of the mutants for temperature sensitivity was: ts1-E $>$ ts1-G $>$ ts1-L $>$ ts1-A $>$ ts1 $>$ ts1-T. The degree of temperature sensitivity of each of the mutants also correlated with the degree of inefficient processing of gPr80$\sp{env}$. The mutant viruses were assayed for neurovirulence. ts1-T caused whole body tremor, ts1-A caused hindlimb paralysis, ts1-L caused paraparesis, but ts1-G and -E were not neurovirulent. These results show that inefficient processing of gPr80$\sp{env}$ is correlated with neurovirulence, but if processing of gPr80$\sp{env}$ is too inefficient there is no neurovirulence. Furthermore, the disease profile of each of the neurovirulent viruses depends on the degree of inefficient processing of gPr80$\sp{env}$. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

2-methylthio-N$\sp6$-dimethylallyl modification of adenosine 37 of tRNAs in {\it Escherichia coli\/} K-12

The hypermodified, hydrophobic 2-methylthio-N$\sp6$-(dimethylallyl)-adenosine (ms${2{\cdot}6}\atop1$A) residue occurs $3\sp\prime$ to the anticodon in tRNA species that read codons beginning with U. The first step (i$\sp6$A37 formation) of this modification is catalyzed by dimethylallyl diphosphate:tRNA dimethyallyltransferase (EC 2.5.1.8), which is the product of the miaA gene. Subsequent steps were proposed to be catalyzed by MiaB and MiaC enzymes to complete the ms${2{\cdot}6}\atop1$A37 modification. The study of functions of the ms${2{\cdot}6}\atop1$A37 is very important because this modified base is one of the best candidates for a role in global control in response to environmental stress. This dissertation describes the further delineation of functions of the ms${2{\cdot}6}\atop1$A37 modification in E. coli K-12 cells. This work provides significant information on functions of tRNA modifications in E. coli cells to adapt to stressful environmental conditions. Three hypotheses were tested in this work.^ The first hypothesis tested was that non-optimal translation processes cause increased spontaneous mutagenesis by the induction of SOS response in starving cells. To test this hypothesis, I measured spontaneous mutation rates of wild type cells and various mutant strains which are defective in tRNA modification, SOS response, or oxidative damage repair. I found that the miaA mutation acts as a mutator that increased Lac$\sp+$ reversion rates and Trp$\sp+$ reversion frequencies of the wild-type cells in starving conditions. However, the lexA3(Ind)(which abolishes the induction of SOS response) mutation abolished the mutator phenotype of the miaA mutant. The recA430 mutation, not other identified SOS genes, decreased the Lac$\sp+$ reversion to a less extent than that of the lexA3(Ind) mutation. These results suggest that RecA together with another unidentified SOS gene product are responsible for the process.^ The second hypothesis tested was that MiaA protein binds to full-length tRNA$\sp{\rm Phe}$ molecules in form of a protein dimer. To test this hypothesis, three versions of the MiaA protein and seven species of tRNA substrates were purified. Binding studies by gel mobility shift assays, filter binding assays and gel filtration shift assays support the hypothesis that MiaA protein binds to full-length tRNA$\sp{\rm Phe}$ as a protein dimer but as a monomer to the anticodon stem-and-loop. These results were further supported by using steady state enzyme kinetic studies.^ The third hypothesis tested in this work was that the miaB gene in E. coli exists and is clonable. The miaB::Tn10dCm insertion mutation of Salmonella typhimurium was transduced to E. coli K-12 cells by using P$\sb1$ and P$\sb{22}$ bacteriophages. The insertion was confirmed by HPLC analyses of nucleotide profiles of miaB mutants of E. coli. The insertion mutation was cloned and DNA sequences adjacent to the transposon were sequenced. These DNA sequences were 86% identical to the f474 gene at 14.97 min chromosome of E. coli. The f474 gene was then cloned by PCR from the wild-type chromosome of E. coli. The recombinant plasmid complemented the mutant phenotype of the miaB mutant of E. coli. These results support the hypothesis that the miaB gene of E. coli exists and is clonable. In summary, functions of the ms${2{\cdot}6}\atop1$A37 modification in E. coli cells are further delineated in this work in perspectives of adaptation to stressful environmental conditions and protein:tRNA interaction. (Abstract shortened by UMI.) ^

(Table S1) Molecular analyses and morphological comparisons of deep-sea clams

Large vesicomyid clams are common inhabitants of sulphidic deep-sea habitats such as hydrothermal vents, hydrocarbon seeps and whale-falls. Yet, the species- and genus-level taxonomy of these diverse clams has been unstable due to insufficiencies in sampling and absence of detailed taxonomic studies that would consistently compare molecular and morphological characters. To clarify uncertainties about species-level assignments, we examined DNA sequences from mitochondrial cytochrome-c-oxidase subunit I (COI) in conjunction with morphological characters. New and published COI sequences were used to create a molecular database for 44 unique evolutionary lineages corresponding to species. Overall, the congruence between molecular and morphological characters was good. Several discrepancies due to synonymous species designations were recognized, and acceptable species names were rectified with published COI sequences in cases where morphological specimens were available. We identified seven species with trans-Pacific distributions, and two species with Indo-Pacific distributions. Presently, 27 species have only been documented from one region, which might reflect limited ranges, or insufficient geographical sampling. Vesicomyids exhibit the greatest species diversity along the northwest Pacific ridge systems and in the eastern Pacific, along the western America margin, where depth zonation typically results in segregation of closely related species. The broad distributions of several vesicomyid species suggest that their required chemosynthetic habitats might be more common than previously recognized and occur along most continental margins.

Effect of solute and matric potential on growth rate of fungal species isolated from cheese

The effect of water potential ( J w ) on the growth of 15 fungal species isolated from cheeses was analysed. The species, identified mainly by analysis of DNA sequences, belonged to genera Penicillium , Geotrichum , Mucor , Aspergillus , Microascus and Talaromyces . Particularly, the effect of matric potential ( J m ), and ionic (NaCl) and non-ionic (glycerol) solute potentials ( J s ) on growth rate was studied. The response of strains was highly dependent on the type of J w . For J s , clear profiles for optimal, permissive and marginal conditions for growth were obtained, and differences in growth rate were achieved comparing NaCl and glycerol for most of the species. Conversely, a sustained growth was obtained for J m in all the strains, with the exception of Aspergillus pseudoglaucus , whose growth increased proportionally to the level of water stress. Our results might help to understand the impact of environmental factors on the ecophysiology and dynamics of fungal populations associated to cheeses.

Marco computacional para la definición de un modelo bio-inspirado en la señalización celular

Las Redes de Procesadores Evolutivos-NEP propuestas en [Mitrana et al., 2001], son un modelo computacional bio-inspirado a partir de la evolución de poblaciones de células, definiendo a nivel sintáctico algunas propiedades biológicas. En este modelo, las células están representadas por medio de palabras que describen secuencias de ADN. Informalmente, en algún instante de tiempo, el sistema evolutivo está representado por una colección de palabras cada una de las cuales representa una célula. El espacio genotipo de las especies, es un conjunto que recoge aquellas palabras que son aceptadas como sobrevivientes (es decir, como \correctas"). Desde el punto de vista de la evolución, las células pertenecen a especies y su comunidad evoluciona de acuerdo a procesos biológicos como la mutación y la división celular. éstos procesos representan el proceso natural de evolución y ponen de manifiesto una característica intrínseca de la naturaleza: el paralelismo. En este modelo, estos procesos son vistos como operaciones sobre palabras. Formalmente, el modelo de las NEP constituyen una arquitectura paralela y distribuida de procesamiento simbólico inspirada en la Máquina de conexión [Hillis, 1981], en el Paradigma de Flujo Lógico [Errico and Jesshope, 1994] y en las Redes de Procesadores Paralelos de Lenguajes (RPPL) [Csuhaj-Varju and Salomaa, 1997]. Al modelo NEP se han ido agregando nuevas y novedosas extensiones hasta el punto que actualmente podemos hablar de una familia de Redes de Procesadores Bio-inspirados (NBP) [Mitrana et al., 2012b]. Un considerable número de trabajos a lo largo de los últimos años han demostrado la potencia computacional de la familia NBP. En general, éstos modelos son computacionalmente completos, universales y eficientes [Manea et al., 2007], [Manea et al., 2010b], [Mitrana and Martín-Vide, 2005]. De acuerdo a lo anterior, se puede afirmar que el modelo NEP ha adquirido hasta el momento un nivel de madurez considerable. Sin embargo, aunque el modelo es de inspiración biológica, sus metas siguen estando motivadas en la Teoría de Lenguajes Formales y las Ciencias de la Computación. En este sentido, los aspectos biológicos han sido abordados desde una perspectiva cualitativa y el acercamiento a la realidad biológica es de forma meramente sintáctica. Para considerar estos aspectos y lograr dicho acercamiento es necesario que el modelo NEP tenga una perspectiva más amplia que incorpore la interacción de aspectos tanto cualitativos como cuantitativos. La contribución de esta Tesis puede considerarse como un paso hacia adelante en una nueva etapa de los NEPs, donde el carácter cuantitativo del modelo es de primordial interés y donde existen posibilidades de un cambio visible en el enfoque de interés del dominio de los problemas a considerar: de las ciencias de la computación hacia la simulación/modelado biológico y viceversa, entre otros. El marco computacional que proponemos en esta Tesis extiende el modelo de las Redes de Procesadores Evolutivos (NEP) y define arquitectura inspirada en la definición de bloques funcionales del proceso de señalización celular para la solución de problemas computacionales complejos y el modelado de fenómenos celulares desde una perspectiva discreta. En particular, se proponen dos extensiones: (1) los Transductores basados en Redes de Procesadores Evolutivos (NEPT), y (2) las Redes Parametrizadas de Procesadores Evolutivos Polarizados (PNPEP). La conservación de las propiedades y el poder computacional tanto de NEPT como de PNPEP se demuestra formalmente. Varias simulaciones de procesos relacionados con la señalización celular son abordadas sintáctica y computacionalmente, con el _n de mostrar la aplicabilidad e idoneidad de estas dos extensiones. ABSTRACT Network of Evolutionary Processors -NEP was proposed in [Mitrana et al., 2001], as a computational model inspired by the evolution of cell populations, which might model some properties of evolving cell communities at the syntactical level. In this model, cells are represented by words which encode their DNA sequences. Informally, at any moment of time, the evolutionary system is described by a collection of words, where each word represents one cell. Cells belong to species and their community evolves according to mutations and division which are defined by operations on words. Only those cells accepted as survivors (correct) are represented by a word in a given set of words, called the genotype space of the species. This feature is analogous with the natural process of evolution. Formally, NEP is based on an architecture for parallel and distributed processing inspired from the Connection Machine [Hillis, 1981], the Flow Logic Paradigm [Errico and Jesshope, 1994] and the Networks of Parallel Language Processors (RPPL) [Csuhaj-Varju and Salomaa, 1997]. Since the date when NEP was proposed, several extensions and variants have appeared engendering a new set of models named Networks of Bio-inspired Processors (NBP) [Mitrana et al., 2012b]. During this time, several works have proved the computational power of NBP. Specifically, their efficiency, universality, and computational completeness have been thoroughly investigated [Manea et al., 2007, Manea et al., 2010b, Mitrana and Martín-Vide, 2005]. Therefore, we can say that the NEP model has reached its maturity. Nevertheless, although the NEP model is biologically inspired, this model is mainly motivated by mathematical and computer science goals. In this context, the biological aspects are only considered from a qualitative and syntactical perspective. In view of this lack, it is important to try to keep the NEP theory as close as possible to the biological reality, extending their perspective incorporating the interplay of qualitative and quantitative aspects. The contribution of this Thesis, can be considered as a starting point in a new era of the NEP model. Then, the quantitative character of the NEP model is mandatory and it can address completely new different types of problems with respect to the classical computational domain (e.g. from the computer science to system biology). Therefore, the computational framework that we propose extends the NEP model and defines an architecture inspired by the functional blocks from cellular signaling in order to solve complex computational problems and cellular phenomena modeled from a discrete perspective. Particularly, we propose two extensions, namely: (1) Transducers based on Network of Evolutionary Processors (NEPT), and (2) Parametrized Network of Polarized Evolutionary Processors (PNPEP). Additionally, we have formally proved that the properties and computational power of NEP is kept in both extensions. Several simulations about processes related with cellular signaling both syntactical and computationally have been considered to show the model suitability.