881 resultados para Powder diffraction
Resumo:
Ochre samples excavated from the neolithic site at Qatalhoyuk, Turkey have been compared with "native" ochres from Clearwell Caves, UK using infrared spectroscopy backed up by Raman spectroscopy, scanning electron microscopy (with energy-dispersive X-rays (EDX) analysis), powder X-ray diffraction, diffuse reflection UV-Vis and atomic absorption spectroscopies. For the Clearwell Caves ochres, which range in colour from yellow-orange to red-brown, it is shown that the colour is related to the nature of the chromophore present and not to any differences in particle size. The darker red ochres contain predominantly haematite while the yellow ochre contains only goethite. The ochres from Qatalhoyuk contain only about one-twentieth of the levels of iron found in the Clearwell Caves ochres. The iron oxide pigment (haematite in all cases studied here) has been mixed with a soft lime plaster which also contains calcite and silicate (clay) minerals. (C) 2003 Elsevier B.V. All rights reserved.
Resumo:
The phase diagram of cyclopentane has been studied by powder neutron diffraction, providing diffraction patterns for phases I, II, and III, over a range of temperatures and pressures. The putative phase IV was not observed. The structure of the ordered phase III has been solved by single-crystal diffraction. Computational modeling reveals that there are many equienergetic ordered structures for cyclopentane within a small energy range. Molecular dynamics simulations reproduce the structures and diffraction patterns for phases I and III and also show an intermediate disordered phase, which is used to interpret phase II.
The effect of free Ca2+ on the heat stability and other characteristics of low-heat skim milk powder
Resumo:
Low-heat skim milk powder (SMP), reconstituted to 25% total solids, was found to have poor heat stability. This could be improved by reducing the free Ca2+ concentration to 1.14 mm, or lower, by the addition of either Amberlite IR-120 ion-exchange resin in its sodium form or tri-sodium citrate in skim milk prior to evaporation and spray drying. Reduction in Ca2+ concentration was accompanied by increases in pH, particle size, and kinematic viscosity, and by a reduction in zeta-potential and changes in colour. In-container sterilisation of the reconstituted powder increased particle size, zeta-potential, kinematic viscosity and a* and b* values. However. Ca2+ concentration, pH and whiteness decreased. This study elucidated the importance of Ca2+ concentration and pH on heat stability of low-heat SMP, suggesting that Ca2+ concentration and pH in bulk milk are useful indicators for ensuring that spray dried milk powder has good heat stability. (C) 2009 Elsevier Ltd. All rights reserved.
Resumo:
This study probes the molecular interactions between model drugs and poloxamers that facilitate dissolution rate improvements using solid dispersions. Ibuprofen and ketoprofen solid dispersions were prepared at different mole ratios using poloxamers 407 and 188. The carbonyl stretching vibration of the ibuprofen dimer shifted to higher wavenumber in the infrared spectra of 2:1 drug:carrier mole ratio solid dispersions, indicating disruption of the ibuprofen dimer concomitant with hydrogen bond formation between the drug and carrier. Solid dispersions with mole ratios >2:1 drug:carrier (up to 29:1) showed both ibuprofen hydrogen-bonded to the poloxamer, and excess drug present as dimers. X-ray diffraction studies confirmed these findings with no evidence of crystalline drug in 2:1 mole ratio systems whereas higher drug loadings retained crystalline ibuprofen. Similar results were found with ketoprofen-poloxamer solid dispersions. Thermal analysis of ibuprofen-poloxamer 407 solid dispersions and their resultant phase diagram suggested solid solutions and a eutectic system were formed, depending on drug loading. Dissolution studies showed fastest release from the solid solutions; dissolution rates from solid solutions were 12-fold greater than the dissolution of ibuprofen powder whereas the eutectic system gave a 6-fold improvement over the powder. When designing solid dispersions to improve the delivery of poorly-water soluble drugs, the nature of drug:carrier interactions, which are governed by the stochiometry of the composition, can affect the dissolution rate improvement.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
The structure of single wall peptide nanotubes is presented for the model surfactant-like peptide A6K. Capillary flow alignment of a sample in the nematic phase at high concentration in water leads to oriented X-ray diffraction patterns. Analysis of these, accompanied by molecular dynamics simulations, suggests the favourable self-assembly of antiparallel peptide dimers into beta-sheet ribbons that wrap helically to form the nanotube wall.
Resumo:
The thermal decomposition of the complex K-4[Ni(NO2)6]center dot H2O has been investigated over the temperature range 25-600 degrees C by a combination of infrared spectroscopy, powder X-ray diffraction, FAB-mass spectrometry and elemental analysis. The first stage of reaction is loss of water and isomerisation of one of the coordinated nitro groups to form the complex K-4 [Ni(NO2)(4) (ONO)]center dot NO2. At temperatures around 200 degrees C the remaining nitro groups within the complex isomerise to the chelating nitrite form and this process acts as a precursor to the loss of NO2 gas at temperatures above 270 degrees C. The product, which is stable up to 600 degrees C, is the complex K-4[Ni(ONO)(4)]center dot NO2, where the nickel atom is formally in the +1 oxidation state. (c) 2005 Elsevier B.V. All rights reserved.
Resumo:
The low-energy electron diffraction (LEED) pattern of the step-kinked Pt{531} surface at 200 K shows energy-dependent cancellation of diffraction spots over unusually large energy ranges, up to 100 eV. This cannot be reproduced theoretically when a flat surface geometry is assumed. A relatively simple model of roughening, however, involving 0.25 ML of vacancies and adatoms leads to very good agreement with the experiment. The cancellation of intensities within a very narrow range of adatom or vacancy coverages is caused by the interference of electrons emerging from different heights but similar local environments. This is a rare example where the energy dependence of integrated LEED spot intensities is dramatically affected by the long-range arrangement of atoms.
Resumo:
We describe a FORTRAN-90 program that computes scattering t-matrices for a molecule. These can be used in a Low-Energy Electron Diffraction program to solve the molecular structural problem very efficiently. The intramolecular multiple scattering is computed within a Dyson-like approach, using free space Green propagators in a basis of spherical waves. The advantage of this approach is related to exploiting the chemical identity of the molecule, and to the simplicity to translate and rotate these t-matrices without performing a new multiple-scattering calculation for each configuration. FORTRAN-90 routines for rotating the resulting t-matrices using Wigner matrices are also provided.
Resumo:
We describe a FORTRAN-90 program to compute low-energy electron diffraction I(V) curves. Plane-waves and layer doubling are used to compute the inter-layer multiple-scattering, while the intra-layer multiple-scattering is computed in the standard way expanding the wavefield on a basis of spherical waves. The program is kept as general as possible, in order to allow testing different parts of multiple-scattering calculations. In particular, it can handle non-diagonal t-matrices describing the scattering of non-spherical potentials, anisotropic vibrations, anharmonicity, etc. The program does not use old FORTRAN flavours, and has been written keeping in mind the advantage for parallelism brought forward by FORTRAN-90.
Resumo:
YqjH is a cytoplasmic FAD-containing protein from Escherichia coli; based on homology to ViuB of Vibrio cholerae, it potentially acts as a ferri-siderophore reductase. This work describes its overexpression, purification, crystallization and structure solution at 3.0 A resolution. YqjH shares high sequence similarity with a number of known siderophore-interacting proteins and its structure was solved by molecular replacement using the siderophore-interacting protein from Shewanella putrefaciens as the search model. The YqjH structure resembles those of other members of the NAD(P)H:flavin oxidoreductase superfamily.
Resumo:
Pre-term birth is the leading cause of perinatal and neonatal mortality, 40% of which are attributed to the pre-term premature rupture of amnion. Rupture of amnion is thought to be associated with a corresponding decrease in the extracellular collagen content and/or increase in collagenase activity. However, there is very little information concerning the detailed organisation of fibrillar collagen in amnion and how this might influence rupture. Here we identify a loss of lattice like arrangement in collagen organisation from areas near to the rupture site, and present a 9% increase in fibril spacing and a 50% decrease in fibrillar organisation using quantitative measurements gained by transmission electron microscopy and the novel application of synchrotron X-ray diffraction. These data provide an accurate insight into the biomechanical process of amnion rupture and highlight X-ray diffraction as a new and powerful tool in our understanding of this process.
Resumo:
Gas-phase electron-diffraction (GED) data together with results from ab initio molecular orbital calculations have been used to determine the structure of propylene sulphide. Values found for the main structural parameters for the molecule are consistent with those obtained from microwave studies and are compared here with those found for similar sulphur containing rings of general formula S(CH2)n (n = 2–5). A high ring strain enthalpy was calculated for propylene sulphide which is consistent with the small C–S–C angle (48.2(6)degrees) and the relatively long C–S bond lengths (ra = 1.831(2) Å). This is thought to account for the ease of ring opening in propylene sulphide observed in MOCVD reactions and the ready polymerisation of the molecule.
Resumo:
The complex [(C(NH2)3)3ZrOH(CO3)3·H2O]2 (A) has been shown by means of a single crystal X-ray diffraction study to contain [C(NH2)3]+ cations and dimeric anions of formulation [(ZrOH(CO3)3)2]6−. The anion is centrosymmetric with each metal being bonded to two bridging OH groups and three chelating CO2−3 ions. The Zr atoms are thus eight coordinate with a dodecahedral environments. The ZrO distances formed by the bridgng OH groups are shorter than those formed through zirconiu carbonate interactions. The non-bonded Zr…Zr distance is 3.47(2) Å. An infrared spectroscopic investigation of A provides data which support the findings of the crystallographic study. Likewise the complex Na6(ZrOH(CO2O4)3)2·7H2O (B) contains the anion [(ZrOH(C2O4)3)2]6−. This anion is structurally related to the anion in A as each Zr atom has an eight-coordinate dodecahedral environment being bonded to two bridging OH groups and three chelating oxalate ligands, but has no imposed crysallographic symmetry. The Zr…Zr non-bonded distance is 3.50(1) Å. The OZrO bridge angles are 69.7(4)° and A and 67.4(3)° in B.