767 resultados para Positive and negative affect
Resumo:
Obesity has a complex, multi-factorial etiology. Infectious agents have recently emerged as a possible contributor to the current obesity epidemic. Seven viruses have demonstrated an association with obesity in animals; however, Adenovirus-36 (Ad-36) is the only known virus associated with obesity in humans. The primary aim of this research was to determine the association between Ad-36 infection and the expression of obesity related hormones in children. Additionally, this study proposed to compare the mean three year change in the level of obesity related hormones between Ad-36 positive and negative children. This study utilized pilot data collected from 98 children at baseline and year three of the Project Heartbeat! cohort. Fasting serum samples were analyzed for the concentration of adiponectin, insulin and leptin. The crude analysis uncovered Ad-36 positive children had significantly lower mean concentrations of insulin (p=0.039) and leptin (p=0.038) at baseline compared to Ad-36 negative children. The results of the adjusted analysis indicated the leptin association with Ad-36 infection at baseline was statistically significant even after controlling for age, sex, ethnicity, and BMI percentile. The longitudinal evaluation revealed individuals with a history of Ad-36 infection experienced a larger mean decrease in adiponectin, a larger mean increase in leptin, and a smaller mean increase in insulin levels over a three year period compared to individuals without a history of infection. These results suggest Ad-36 infection may produce changes in hormone expression. The only statistically significant findings in the crude and adjusted longitudinal analysis occurred at baseline when the children were younger, suggesting physical changes that occur during sexual maturation may mask or enhance Ad-36 induced changes in hormone expression. Furthermore, the longitudinal analysis revealed the duration and course of Ad-36 infection may influence changes in the expression of obesity-related hormones. Taken together, the results of this pilot study are suggestive of an association between Ad-36 infection and the expression of obesity-related hormones.^
Resumo:
The prevalence of obesity has continued to rise over the last several decades in the United States lending to overall increases in risk for chronic diseases including many types of cancer. In contrast, reduction in energy consumption via calorie restriction (CR) has been shown to be a potent inhibitor of carcinogenesis across a broad range of species and tumor types. Previous data has demonstrated differential signaling through Akt and mTOR via the IGF-1R and other growth factor receptors across the diet-induced obesity (DIO)/CR spectrum. Furthermore, mTORC1 is known to be regulated directly via nutrient availability, supporting its role in the link between epithelial carcinogenesis and diet-induced obesity. In an effort to better understand the importance of mTORC1 in the context of both positive and negative energy balance during epithelial carcinogenesis, we have employed the use of specific pharmacological inhibitors, rapamycin (mTORC1 inhibitor) and metformin (AMPK activator) to target mTORC1 or various components of this pathway during skin tumor promotion. Two-stage skin carcinogenesis studies demonstrated that mTORC1 inhibition via rapamycin, metformin or combination treatments greatly inhibited skin tumor development in normal, overweight and obese mice. Furthermore, mechanisms by which these chemopreventive agents may be exerting their anti-tumor effects were explored. In addition, the effect of these compounds on the epidermal proliferative response was analyzed and drastic decreases in epidermal hyperproliferation and hyperplasia were found. Rapamycin also inhibited dermal inflammatory cell infiltration in a dose-dependent manner. Both compounds also blocked or attenuated TPA-induced signaling through epidermal mTORC1 as well as several downstream targets. In addition, inhibition of this pathway by metformin appeared to be, at least in part, dependent on AMPK activation in the skin. Overall, the data indicate that pharmacological strategies targeting this pathway offset the tumor-enhancing effects of DIO and may serve as possible CR mimetics. They suggest that mTORC1 contributes significantly to the process of skin tumor promotion, specifically during dietary energy balance effects. Exploiting the mechanistic information underlying dietary energy balance responsive pathways will help translate decades of research into effective strategies for prevention of epithelial carcinogenesis.
Resumo:
The neu oncogene encodes a growth factor receptor-like protein, p185, with an intrinsic tyrosine kinase activity. A single point mutation, an A to T transversion resulting in an amino acid substitution from valine to glutamic acid, in the transmembrane domain of the rat neu gene was found to be responsible for the transforming and tumorigenic phenotype of the cells that carry it. In contrast, the human proto-neu oncogene is frequently amplified in tumors and cell lines derived from tumors and the human neu gene overexpression/amplification in breast and ovarian cancers is known to correlate with poor patient prognosis. Examples of the human neu gene overexpression in the absence of gene amplification have been observed, which may suggest the significant role of the transcriptional and/or post-transcriptional control of the neu gene in the oncogenic process. However, little is known about the transcriptional mechanisms which regulate the neu gene expression. In this study, three examples are presented to demonstrate the positive and negative control of the neu gene expression.^ First, by using band shift assays and methylation interference analyses, I have identified a specific protein-binding sequence, AAGATAAAACC ($-$466 to $-$456), that binds a specific trans-acting factor termed RVF (for EcoRV factor on the neu promoter). The RVF-binding site is required for maximum transcriptional activity of the rat neu promoter. This same sequence is also found in the corresponding regions of both human and mouse neu promoters. Furthermore, this sequence can enhance the CAT activity driven by a minimum promoter of the thymidine kinase gene in an orientation-independent manner, and thus it behaves as an enhancer. In addition, Southwestern (DNA-protein) blot analysis using the RVF-binding site as a probe points to a 60-kDa polypeptide as a potential candidate for RVF.^ Second, it has been reported that the E3 region of adenovirus 5 induces down-regulation of epidermal growth factor (EGF) receptor through endocytosis. I found that the human neu gene product, p185, (an EGF receptor-related protein) is also down-regulated by adenovirus 5, but via a different mechanism. I demonstrate that the adenovirus E1a gene is responsible for the repression of the human neu gene at the transcriptional level.^ Third, a differential expression of the neu gene has been found in two cell model systems: between the mouse fibroblast Swiss-Webster 3T3 (SW3T3) and its variant NR-6 cells; and between the mouse liver tumor cell line, Hep1-a, and the mouse pancreas tumor cell line, 266-6. Both NR-6 and 266-6 cell lines are not able to express the neu gene product, p185. I demonstrate that, in both cases, the transcriptional repression of the neu gene may account for the lack of the p185 expression in these two cell lines. ^
Resumo:
Hispanics form the second-largest minority group in the United States totaling 22 million people. Health data on this population are sparse and inconsistent. This study seeks to determine use of preventative services and risk factor behaviors of Mexican American and non-Hispanic White females residing in South Texas.^ Baseline data from female respondents in household surveys in six South Texas counties (Ramirez and McAlister, 1988; McAlister et al., 1992) were analyzed to test the following hypotheses: (1) Mexican American and Non-Hispanic White females exhibit different patterns of health behaviors; (2) Mexican American females will exhibit different health behaviors regardless of age; and (3) the differences between Mexican American women and non-Hispanic White females are due to education and acculturation factors.^ Over the past decade, the traditional behaviors of Mexican American females have begun to change due to education, acculturation, and their participation in the labor force. The results from this study identify some of the changes that will require immediate attention from health care providers. Results revealed that regardless of ethnicity, age, education, and language preference, non-Hispanic White females were significantly more likely to participate in preventive screening practices than were Mexican American females. Risk factor analysis revealed a different pattern with Mexican American females significantly more likely to be non-smokers, non-alcoholic drinkers, and to have good fat avoidance practices compared to non-Hispanic White females. However, compared to those who are less-educated or Spanish-speaking, Mexican American females with higher levels of education and preference for speaking English only showed positive and negative health behaviors that were more similar to the non-Hispanic White females. The positive health behaviors that come with acculturation, e.g., more participation in preventive care and more physical activity, are welcome changes. But this study has implications for global health development and reinforces a need for "primordial" prevention strategies to deter the unwanted concomitants of economic development and acculturation. Smoking and drinking behaviors among Mexican American females need to be kept at low levels to prevent increased morbidity and premature deaths in this population. ^
Resumo:
Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^
Resumo:
Despite continued research and public health efforts to reduce smoking during pregnancy, prenatal cessation rates in the United States have decreased and the incidence of low birth weight has increased from 1985 to 1991. Lower socioeconomic status women who are at increased risk for poor pregnancy outcomes may be resistant to current intervention efforts during pregnancy. The purpose of this dissertation was to investigate the determinants of continued smoking and quitting among low-income pregnant women.^ Using data from cross-sectional surveys of 323 low-income pregnant smokers, the first study developed and tested measures of the pros and cons of smoking during pregnancy. The original decisional balance measure for smoking was compared with a new measure that added items thought to be more salient to the target population. Confirmatory factor analysis using structural equation modeling showed neither the original nor new measure fit the data adequately. Using behavioral science theory, content from interviews with the population, and statistical evidence, two 7-item scales representing the pros and cons were developed from a portion (n = 215) of the sample and successfully cross-validated on the remainder of the sample (n = 108). Logistic regression found only pros were significantly associated with continued smoking. In a discriminant function analysis, stage of change was significantly associated with pros and cons of smoking.^ The second study examined the structural relationships between psychosocial constructs representing some of the levels of and the pros and cons of smoking. The cross-sectional design mandates that statements made regarding prediction do not prove causation or directionality from the data or methods analysis. Structural equation modeling found the following: more stressors and family criticism were significantly more predictive of negative affect than social support; a bi-directional relationship was found between negative affect and current nicotine addiction; and negative affect, addiction, stressors, and family criticism were significant predictors of pros of smoking.^ The findings imply reversing the trend of decreasing smoking cessation during pregnancy may require supplementing current interventions for this population of pregnant smokers with programs addressing nicotine addiction, negative affect, and other psychosocial factors such as family functioning and stressors. ^
Resumo:
Based on the World Health Organization's (1965) definition of health, understanding of health requires understanding of positive psychological states. Subjective Well-being (SWB) is a major indicator of positive psychological states. Up to date, most studies of SWB have been focused on its distributions and determinants. However, study of its consequences, especially health consequences, is lacking. This dissertation research examined Subjective Well-being, as operationally defined by constructs drawn from the framework of Positive Psychology, and its sub-scores (Positive Feelings and Negative Feelings) as predictors of three major health outcomes—mortality, heart disease, and obesity. The research used prospective data from the Alameda County Study over 29 years (1965–1994), based on a stratified, randomized, representative sample of the general public in Alameda County, California (Baseline N = 6928). ^ Multivariate analyses (Survival analyses using sequential Cox Proportional Hazard models in the cases of mortality and heart disease, and sequential Logistic Regression analyses in the case of obesity) were performed as the main methods to evaluate the associations of the predictors and the health outcomes. The results revealed that SWB reduced risks of all-cause mortality, natural-cause mortality, and cardiovascular mortality. Positive feelings not only had an even stronger protective effect against all-cause, natural-cause and cardiovascular mortality, but also predicted decreased unnatural-cause mortality which includes deaths from suicide, homicide, accidents, mental disorders, drug dependency, as well as alcohol-related liver diseases. These effects were significant even after adjusted for age, gender, education, and various physical health measures, and, in the case of cardiovascular mortality, obesity and health practices (alcohol consumption, smoking, and physical activities). However, these two positive psychological indicators, SWB and positive feelings, did not predict obesity. And negative feelings had no significant effect on any of the health outcomes evaluated, i.e., all-cause mortality, natural- and unnatural-cause mortality, cardiovascular mortality, or obesity, after covariates were controlled. These findings were discussed (1) in comparison with relevant existing studies, (2) in terms of their implications in health research and promotion, (3) in terms of the independence of positive and negative feelings, and (4) from a Positive Psychology perspective and its significance in Public Health research and practice. ^
Resumo:
Twenty-four piston core sediment samples and 13 sediments and 3 basalts from DSDP Leg 78 Site 543 were analyzed for Sr, Nd and Pb isotopic compositions. The results show sediment with highly radiogenic Pb (206Pb/204Pb up to 19.8) and rather radiogenic Sr and unradiogenic Nd has been deposited in the region since the Cretaceous. The source of this sediment is probably the Archean Guiana Highland, which is drained by the Orinoco River. Pb and Sr isotopic compositions and sediment thickness decrease and 143Nd/144Nd increases northward due to a decrease in turbiditic component. This decrease is partly due to the damming action of basement ridges. Rare earth concentrations in the sediments are somewhat low, due to the abundance of detrital and biogenic components in the sediment and rapid sedimentation rates. Both positive and negative Ce anomalies occur in the surface sediments, but only positive Ce anomalies occur in the Site 543 sediments. It is unlikely that sediment subducted to the source region of Lesser Antilles arc magmas could be the cause of negative Ce anomalies in those magmas. Isotopic compositions of Site 543 basalts show some effect of contamination by seawater-basalt reaction products and sediments. Beyond this, however, they are typical of "normal" depleted MORB.
Resumo:
We present tools for rapid and quantitative detection of sediment lamination. The BMPix tool extracts color and gray-scale curves from images at pixel resolution. The PEAK tool uses the gray-scale curve and performs, for the first time, fully automated counting of laminae based on three methods. The maximum count algorithm counts every bright peak of a couplet of two laminae (annual resolution) in a smoothed curve. The zero-crossing algorithm counts every positive and negative halfway-passage of the curve through a wide moving average, separating the record into bright and dark intervals (seasonal resolution). The same is true for the frequency truncation method, which uses Fourier transformation to decompose the curve into its frequency components before counting positive and negative passages. We applied the new methods successfully to tree rings, to well-dated and already manually counted marine varves from Saanich Inlet, and to marine laminae from the Antarctic continental margin. In combination with AMS14C dating, we found convincing evidence that laminations in Weddell Sea sites represent varves, deposited continuously over several millennia during the last glacial maximum. The new tools offer several advantages over previous methods. The counting procedures are based on a moving average generated from gray-scale curves instead of manual counting. Hence, results are highly objective and rely on reproducible mathematical criteria. Also, the PEAK tool measures the thickness of each year or season. Since all information required is displayed graphically, interactive optimization of the counting algorithms can be achieved quickly and conveniently.
Resumo:
On the orbiter of the Rosetta spacecraft, the Cometary Secondary Ion Mass Analyser (COSIMA) will provide new in situ insights about the chemical composition of cometary grains all along 67P/Churyumov–Gerasimenko (67P/CG) journey until the end of December 2015 nominally. The aim of this paper is to present the pre-calibration which has already been performed as well as the different methods which have been developed in order to facilitate the interpretation of the COSIMA mass spectra and more especially of their organic content. The first step was to establish a mass spectra library in positive and negative ion mode of targeted molecules and to determine the specific features of each compound and chemical family analyzed. As the exact nature of the refractory cometary organic matter is nowadays unknown, this library is obviously not exhaustive. Therefore this library has also been the starting point for the research of indicators, which enable to highlight the presence of compounds containing specific atom or structure. These indicators correspond to the intensity ratio of specific peaks in the mass spectrum. They have allowed us to identify sample containing nitrogen atom, aliphatic chains or those containing polyaromatic hydrocarbons. From these indicators, a preliminary calibration line, from which the N/C ratio could be derived, has also been established. The research of specific mass difference could also be helpful to identify peaks related to quasi-molecular ions in an unknown mass spectrum. The Bayesian Positive Source Separation (BPSS) technique will also be very helpful for data analysis. This work is the starting point for the analysis of the cometary refractory organic matter. Nevertheless, calibration work will continue in order to reach the best possible interpretation of the COSIMA observations.
Resumo:
We describe interactive effects of total phosphorus (total P = 0.1-4.0 µmol/L; added as H2NaPO4), irradiance (40 and 150 µmol quanta/m**2/s), and the partial pressure of carbon dioxide (P-CO2; 19 and 81 Pa, i.e., 190 and 800 ppm) on growth and CO2- and dinitrogen (N-2)-fixation rates of the unicellular N-2-fixing cyanobacterium Crocosphaera watsonii (WH0003) isolated from the Pacific Ocean near Hawaii. In semicontinuous cultures of C. watsonii, elevated P-CO2 positively affected growth and CO2- and N-2-fixation rates under high light. Under low light, elevated P-CO2 positively affected growth rates at all concentrations of P, but CO2- and N-2-fixation rates were affected by elevated P-CO2 only when P was low. In both high-light and low-light cultures, the total P requirements for growth and CO2- and N-2-fixation declined as P-CO2 increased. The minimum concentration (C-min) of total P and half-saturation constant (K-1/2) for growth and CO2- and N-2-fixation rates with respect to total P were reduced by 0.05 µmol/L as a function of elevated P-CO2. We speculate that low P requirements under high P-CO2 resulted from a lower energy demand associated with carbon-concentrating mechanisms in comparison with low-P-CO2 cultures. There was also a 0.10 µmol/L increase in C-min and K-1/2 for growth and N-2 fixation with respect to total P as a function of increasing light regardless of P-CO2 concentration. We speculate that cellular P concentrations are responsible for this shift through biodilution of cellular P and possibly cellular P uptake systems as a function of increasing light. Changing concentrations of P, CO2, and light have both positive and negative interactive effects on growth and CO2-, and N-2-fixation rates of unicellular oxygenic diazotrophs like C. watsonii.
Resumo:
In this study, forward seismic modelling of four geological models with Hydrocarbon (HC) traps were performed by ray tracing method to produce synthetic seismogram of each model. The idea is to identify the Hydrocarbon Indicators (HCI‟s) such as bright spot, flat spot, dim spot and Bottom Simulating Reflector (BSR) in the synthethic seismogram. The modelling was performed in DISCO/FOCUS 5.0 seismic data processing programme. Strong positive and negative reflection amplitudes and some artifact reflection horizons were observed on produced seismograms due to rapid changes in subsurface velocity and geometry respectively Additionally, Amplitude-versus-angle (AVA) curves of each HCIs was calculated by the Crewes Zoeppritz Explorer programme. AVA curves show that how the reflection coefficients change with the density and the P and S wave velocities of each layer such as oil, gas, gas hydrate or water saturated sediments. Due to AVA curves, an increase in reflection amplitude with incident angle of seismic waves corresponds to an indicator of a hydrocarbon reservoir
Resumo:
The multimedia development that has taken place within the university classrooms in recent years has caused a revolution at psychological level within the collectivity of students and teachers inside and outside the classrooms. The slide show applications have become a key supporting element for university professors, who, in many cases, rely blindly in the use of them for teaching. Additionally, ill-conceived slides, poorly structured and with a vast amount of multimedia content, can be the basis of a faulty communication between teacher and student, which is overwhelmed by the appearance and presentation, neglecting their content. The same applies to web pages. This paper focuses on the study and analysis of the impact caused in the process of teaching and learning by the slide show presentations and web pages, and its positive and negative influence on the student’s learning process, paying particular attention to the consequences on the level of attention within the classroom, and on the study outside the classroom. The study is performed by means of a qualitative analysis of student surveys conducted during the last 8 school Civil Engineering School at the Polytechnic University of Madrid. It presents some of the weaknesses of multimedia material, including the difficulties for students to study them, because of the many distractions they face and the need for incentives web pages offer, or the insignificant content and shallowness of the studies due to wrongly formulated presentations.
Resumo:
In the photovoltaic field, the back contact solar cells technology has appeared as an alternative to the traditional silicon modules. This new type of cells places both positive and negative contacts on the back side of the cells maximizing the exposed surface to the light and making easier the interconnection of the cells in the module. The Emitter Wrap-Through solar cell structure presents thousands of tiny holes to wrap the emitter from the front surface to the rear surface. These holes are made in a first step over the silicon wafers by means of a laser drilling process. This step is quite harmful from a mechanical point of view since holes act as stress concentrators leading to a reduction in the strength of these wafers. This paper presents the results of the strength characterization of drilled wafers. The study is carried out testing the samples with the ring on ring device. Finite Element models are developed to simulate the tests. The stress concentration factor of the drilled wafers under this load conditions is determined from the FE analysis. Moreover, the material strength is characterized fitting the fracture stress of the samples to a three-parameter Weibull cumulative distribution function. The parameters obtained are compared with the ones obtained in the analysis of a set of samples without holes to validate the method employed for the study of the strength of silicon drilled wafers.
Resumo:
Las obras de infraestructura que construye el ser humano para optimizar los recursos naturales y satisfacer sus necesidades, producen impactos tanto positivos como negativos en el ambiente. México cuenta con una gran cantidad de recursos naturales y lugares que han sido favorecidos por la naturaleza, donde la sobrecarga de las actividades antropogénicas genera problemas de impacto ambiental, especialmente en las zonas costeras y en su entorno. El objetivo del presente trabajo fue aportar información acerca de las principales presiones que recibe el sistema y cómo esto afecta a las propuestas de soluciones integrales y a la capacidad para recuperar el estado de equilibrio en las zonas costeras. En la presente investigación, se desarrolló una metodología para la caracterización de zonas costeras, basada en un modelo sistémico, con el propósito de tener una herramienta de planificación para proyectos ambientalmente sustentables, integrando una base de datos con las mejores prácticas de planificación, lo que facilitará el diagnóstico y la evaluación de la capacidad adaptativa de recuperación del sistema. Asimismo, se utilizó un modelo sistémico como una metodología para organizar la gran complejidad que implica la interrelación e interconexión que existe entre los múltiples componentes, y con ello obtener el conocimiento para su caracterización. Con base en el modelo de Zachman, se realizó un análisis para la detección de las fortalezas y debilidades del sistema, lo que permitió visualizar el impacto de los riesgos a que está expuesta una zona costera. Las principales aportaciones de este trabajo fueron el desarrollo de la FICHA DE CARACTERIZACIÓN DE LA ZONA COSTERA y la inclusión, en dicha ficha, de la estimación del nivel de la resiliencia física, ambiental, social, económica y política. La metodología propuesta, es una aportación que permite integrar los componentes, las relaciones e interconexiones que existen en el sistema costero. La metodología tiene la ventaja de ser flexible y se pueden agregar o desechar componentes de acuerdo a las particularidades de cada caso de estudio; adicionalmente, se propone utilizar esta herramienta como ayuda en el monitoreo periódico del sistema. Lo anterior como parte de un observatorio integrado al Sistema Nacional de Gestión Costera que se propone como parte de futuras líneas de investigación. Como caso de estudio, se realizó la caracterización del complejo sistema Banco Chinchorro, lo que resultó en la inclusión (en la FICHA DE CARACTERIZACIÓN DE LA ZONA COSTERA), de las lecciones aprendidas con la detección de buenas y malas prácticas, esto redundó en la mejora de la metodología propuesta para la gestión de la zona costera. All infrastructures that build the human being to optimize natural resources and meet their needs, generate both, positive and negative impacts on the environment, since the acquisition and transformation of resources in coastal areas affect their balance. Mexico has a large number of natural resources and places that have been favored by nature, whereas the overhead of anthropogenic activities leads to problems of environmental impact, especially in coastal areas and in its surroundings. The aim of this study was to provide information about the main pressures that a system receives and how this affects the proposed solutions and the ability to restore the state of balance in coastal areas. In this research, a methodology for the characterization of coastal zones, based on a systemic model, in order to develop a planning tool for environmentally sustainable projects, was developed, integrating a database with the best practices for planning, conservation and balance of coastal areas. This will facilitate the diagnosis and evaluation of the adaptive resilience of the system. A systemic model was used as a methodology to organize the vast complexity of the relationship and interconnection between the multiple components, and so thus gain knowledge for its characterization. Based on the Zachman model, an analysis to detect the strengths and weaknesses of the system was performed, allowing visualizing the impact of the risks that the coastal zone is exposed to. The main contributions of this study was the development of the COASTAL CHARACTERIZATION RECORD, and the inclusion, on that record, of the estimation of the physical, environmental, social, economic and political resilience. The proposed methodology is a contribution that allows integrating the components, relationships and interconnections existing in the coastal system. The methodology has the advantage of being flexible and components can be added or discarded according to the particularities of each case study; Additionally, this is not only a diagnostic tool, it is proposed to use it as an aid in monitoring periodically the system, this as part of an integrated monitoring into the National System of Coastal Management that is proposed as part of future research. As a case study, the characterization of the coastal zone “Banco Chinchorro” was done, resulting in the inclusion, in the COASTAL CHARACTERIZATION RECORD, of the documented lessons learned from the good and bad practices detection, improvement of the methodology proposed for the management of the coastal zone.