Structure of AuCN determined from total neutron diffraction

The structure of gold cyanide, AuCN, has been determined at 10 and 300 K using total neutron diffraction. The structure consists of infinite -Au-(CN)-Au-(CN)-Au-(CN)- linear chains, hexagonally packed, with the gold atoms in sheets. The Au-C and Au-N bond lengths are found to be identical, with d(Au-C/N) = 1.9703(5) Angstrom at 300 K. This work supersedes a previous study, by others, which used Rietveld analysis of neutron Bragg diffraction in isolation, and found these bonds to have significantly different lengths (Deltad = 0.24 Angstrom) at 300 K. The total correlation function, T(r), at 10 and 300 K, has been modeled using information derived from total diffraction. The broadening of inter- and intrachain correlations differs markedly due to random displacements of the chains in the direction of the chain axes. This is a consequence of the relatively weak bonding between the chains. An explanation for the negative thermal expansion in the c-direction, which occurs between 10 and 300 K, is presented.

Modeling the structure of amorphous MoS3: a neutron diffraction and reverse Monte Carlo study

A model for the structure of amorphous molybdenum trisulfide, a-MoS3, has been created using reverse Monte Carlo methods. This model, which consists of chains Of MoS6 units sharing three sulfurs with each of its two neighbors and forming alternate long, nonbonded, and short, bonded, Mo-Mo separations, is a good fit to the neutron diffraction data and is chemically and physically realistic. The paper identifies the limitations of previous models based on Mo-3 triangular clusters in accounting for the available experimental data.

Water-soluble, unimolecular containers based on amphiphilic multiarm star block copolymers

A new class of water-soluble, amphiphilic star block copolymers with a large number of arms was prepared by sequential atom transfer radical polymerization (ATRP) of n-butyl methacrylate (BMA) and poly( ethylene glycol) methyl ether methacrylate (PEGMA). As the macroinitiator for the ATRP, a 2-bromoisobutyric acid functionalized fourth-generation hyperbranched polyester (Boltorn H40) was used, which allowed the preparation of star polymers that contained on average 20 diblock copolymer arms. The synthetic concept was validated by AFM experiments, which allowed direct visualization of single molecules of the multiarm star block copolymers. DSC and SAXS experiments on bulk samples suggested a microphase-separated structure, in agreement with the core-shell architecture of the polymers. SAXS experiments on aqueous solutions indicated that the star block copolymers can be regarded as unimolecular micelles composed of a PBMA core and a diffuse PPEGMA corona. The ability of the polymers to encapsulate and release hydrophobic guests was evaluated using H-1 NMR spectroscopy. In dilute aqueous solution, these polymers act as unimolecular containers that can be loaded with up to 27 wt % hydrophobic guest molecules.

Inelastic neutron scattering in spectroscopic studies of hydrogen on carbon-supported catalysts-experimental spectra and computed spectra of model systems

Inelastic neutron scattering spectroscopy has been used to observe and characterise hydrogen on the carbon component of a Pt/C catalyst. INS provides the complete vibration spectrum of coronene, regarded as a molecular model of a graphite layer. The vibrational modes are assigned with the aid of ab initio density functional theory calculations and the INS spectra by the a-CLIMAX program. A spectrum for which the H modes of coronene have been computationally suppressed, a carbon-only coronene spectrum, is a better representation of the spectrum of a graphite layer than is coronene itself. Dihydrogen dosing of a Pt/C catalyst caused amplification of the surface modes of carbon, an effect described as H riding on carbon. From the enhancement of the low energy carbon modes (100-600 cm(-1)) it is concluded that spillover hydrogen becomes attached to dangling bonds at the edges of graphitic regions of the carbon support. (C) 2003 Elsevier Science B.V. All rights reserved.

Hydrogen spillover on carbon-supported metal catalysts studied by inelastic neutron scattering. Surface vibrational states and hydrogen riding modes

Hydrogen spillover on carbon-supported precious metal catalysts has been investigated with inelastic neutron scattering (INS) spectroscopy. The aim, which was fully realized, was to identify spillover hydrogen on the carbon support. The inelastic neutron scattering spectra of Pt/C, Ru/C, and PtRu/C fuel cell catalysts dosed with hydrogen were determined in two sets of experiments: with the catalyst in the neutron beam and, using an annular cell, with carbon in the beam and catalyst pellets at the edge of the cell excluded from the beam. The vibrational modes observed in the INS spectra were assigned with reference to the INS of a polycyclic aromatic hydrocarbon, coronene, taken as a molecular model of a graphite layer, and with the aid of computational modeling. Two forms of spillover hydrogen were identified: H at edge sites of a graphite layer (formed after ambient dissociative chemisorption of H-2), and a weakly bound layer of mobile H atoms (formed by surface diffusion of H atoms after dissociative chernisorption of H-2 at 500 K). The INS spectra exhibited characteristic riding modes of H on carbon and on Pt or Ru. In these riding modes H atoms move in phase with vibrations of the carbon and metal lattices. The lattice modes are amplified by neutron scattering from the H atoms attached to lattice atoms. Uptake of hydrogen, and spillover, was greater for the Ru containing catalysts than for the Pt/C catalyst. The INS experiments have thus directly demonstrated H spillover to the carbon support of these metal catalysts.

Electrospinning atactic polystyrene: a neutron scattering study

Electrospinning is a method used to produce nanoscale to microscale sized polymer fibres. In this study we electrospin 1:1 blends of deuterated and hydrogenated atactic- Polystyrene from N,N-Dimethylformamide for small angle neutron scattering experiments in order to analyse the chain conformation in the electrospun fibres. Small angle neutron scattering was carried out on randomly orientated fibre mats obtained using applied voltages of 10kV-15kV and needle tip to collector distances of 20cm and 30cm. Fibre diameters varied from 3μm – 20μm. Neutron scattering data from fibre samples were compared with bulk samples of the same polymer blend. The scattering data indicates that there are pores and nanovoiding present in the fibres; this was confirmed by scanning electron microscopy. A model that combines the scattering from the pores and the labelled polymer chains was used to extract values for the radius of gyration. The radius of gyration in the fibres is found to vary little with the applied voltage, but varies with the initial solution concentration and fibre diameter. The values for the radius of gyration in the fibres are broadly equivalent to that of the bulk state.

Hydrogen adsorption in a copper ZSM5 zeolite: an inelastic neutron scattering study

Currently microporous oxidic materials including zeolites are attracting interest as potential hydrogen storage materials. Understanding how molecular hydrogen interacts with these materials is important in the rational development of hydrogen storage materials and is also challenging theoretically. In this paper, we present an incoherent inelastic neutron scattering (INS) study of the adsorption of molecular hydrogen and hydrogen deuteride (HD) in a copper substituted ZSM5 zeolite varying the hydrogen dosage and temperature. We have demonstrated how inelastic neutron scattering can help us understand the interaction of H-2 molecules with a binding site in a particular microporous material, Cu ZSM5, and by implication of other similar materials. The H-2 molecule is bound as a single species lying parallel with the surface. As H-2 dosing increases, lateral interactions between the adsorbed H-2 molecules become apparent. With rising temperature of measurement up to 70 K (the limit of our experiments), H-2 molecules remain bound to the surface equivalent to a liquid or solid H-2 phase. The implication is that hydrogen is bound rather strongly in Cu ZSM5. Using the simple model for the anisotropic interaction to calculate the energy levels splitting, we found that the measured rotational constant of the hydrogen molecule is reduced as a consequence of adsorption by the Cu ZSM5. From the decrease in total signal intensity with increasing temperature, we were able to observe the conversion of para-hydrogen into ortho-hydrogen at paramagnetic centres and so determine the fraction of paramagnetic sites occupied by hydrogen molecules, ca. 60%. (c) 2006 Elsevier B.V. All rights reserved.

Dihydrogen in cation-substituted zeolites X - an inelastic neutron scattering study

An inelastic neutron scattering (INS) study of the rotational - vibrational spectrum of dihydrogen sorbed by zeolite X having substituted sodium, calcium and zinc cations is reported. The rotational - vibrational spectrum of H-2 was observed at low energy transfer ( below ca. 25 meV, 202 cm(-1)); the vibration was that of the H-2 molecule against the binding site (H-2 - X, not H - H). The vibration frequency was proportional to the polarising power of the cation (Na+ < Ca2+ < Zn2+). Polarisation of the H-2 molecule dominated the interaction of H-2 with this binding site. The total scattering intensity was proportional to the dihydrogen dose. However the vibrational intensities became constant at ca. 0.3 wt% showing that the H-2 binding sites had saturated. Additional dihydrogen appeared as unbound or weakly bound dihydrogen exhibiting recoil.

Dihydrogen in zeolite CaX: an inelastic neutron scattering study

We report an inelastic neutron scattering (INS) study of the rotational–vibrational spectrum of dihydrogen sorbed by zeolite CaX. In the low energy (<200 cm−1) INS spectrum of adsorbed H2 we observe the rotational–vibrational spectrum of H2, where the vibration is that of the H2 molecule against the binding site (i.e. H2–X, not H–H). We have observed for the first time the vibrational overtones of the hydrogen molecule against the adsorption surface up to sixth order. These vibrations are usually forbidden in INS spectroscopy because of the selection rules imposed by the spin flip event required. In our case we are able to observe such a vibration because the rotational transition J(1 ← 0) convolutes the vibrational spectrum. This paper reports the effect for the first time.

A study by high energy transfer inelastic neutron scattering spectroscopy of the mineral fraction of ox femur bone

We have used high energy transfer (HET) inelastic neutron scattering spectroscopy to measure the vibrational modes in the spectra of hydroxyapatite, bone and brushite to confirm our earlier work that only a fraction of the hydroxyl groups in bone mineral are substituted. The HET spectra are better observed due to the higher scattering cross section of hydrogen compared with the other elements in the calcium phosphate compounds. (C) 2003 Elsevier Science B.V. All rights reserved.

Accurate molecular structures of chlorothiazide and hydrochlorothiazide by joint refinement against powder neutron and X-ray diffraction data

The compounds chlorothiazide and hydrochlorothiazide (crystalline form II) have been studied in their fully hydrogenous forms by powder neutron diffraction on the GEM diffractometer. The results of joint Rietveld refinement of the structures against multi-bank neutron and single-bank X-ray powder data are reported and show that accurate and precise structural information can be obtained from polycrystalline molecular organic materials by this route.

Largest connected component of a star graph with faulty vertices

In order to make a full evaluation of an interconnection network, it is essential to estimate the minimum size of a largest connected component of this network provided the faulty vertices in the network may break its connectedness. Star graphs are recognized as promising candidates for interconnection networks. This article addresses the size of a largest connected component of a faulty star graph. We prove that, in an n-star graph (n >= 3) with up to 2n-4 faulty vertices, all fault-free vertices but at most two form a connected component. Moreover, all fault-free vertices but exactly two form a connected component if and only if the set of all faulty vertices is equal to the neighbourhood of a pair of fault-free adjacent vertices. These results show that star graphs exhibit excellent fault-tolerant abilities in the sense that there exists a large functional network in a faulty star graph.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.