965 resultados para Human Dna


Relevância:

30.00% 30.00%

Publicador:

Resumo:

In this study, the mature domains of type I (CPB) and type II (CPA) cysteine proteinases (CPs) of Leishmania infantum were expressed and their immunogenic properties defined using sera from active and recovered cases of human visceral leishmaniasis and sera from infected dogs. Immunoblotting and ELISA analysis indicated that a freeze/thaw extract of parasite antigens showed similar and intensive recognition in both active cases of human and dog sera but lower recognition in recovered human individuals. The total IgG of actively infected human sera was higher than in recovered cases when rCPs were used as antigen. In contrast to dog sera, both active and recovered human cases have higher recognition toward rCPB than rCPA. Furthermore, the asymptomatic dogs in contrast to the symptomatic cases exhibited specific lymphocyte proliferation to both crude antigens and rCPs.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Diabetes is associated with significant changes in plasma concentrations of lipoproteins. We tested the hypothesis that lipoproteins modulate the function and survival of insulin-secreting cells. We first detected the presence of several receptors that participate in the binding and processing of plasma lipoproteins and confirmed the internalization of fluorescent low density lipoprotein (LDL) and high density lipoprotein (HDL) particles in insulin-secreting beta-cells. Purified human very low density lipoprotein (VLDL) and LDL particles reduced insulin mRNA levels and beta-cell proliferation and induced a dose-dependent increase in the rate of apoptosis. In mice lacking the LDL receptor, islets showed a dramatic decrease in LDL uptake and were partially resistant to apoptosis caused by LDL. VLDL-induced apoptosis of beta-cells involved caspase-3 cleavage and reduction in the levels of the c-Jun N-terminal kinase-interacting protein-1. In contrast, the proapoptotic signaling of lipoproteins was antagonized by HDL particles or by a small peptide inhibitor of c-Jun N-terminal kinase. The protective effects of HDL were mediated, in part, by inhibition of caspase-3 cleavage and activation of Akt/protein kinase B. In conclusion, human lipoproteins are critical regulators of beta-cell survival and may therefore contribute to the beta-cell dysfunction observed during the development of type 2 diabetes.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The estrogen-responsive element (ERE) present in the 5'-flanking region of the Xenopus laevis vitellogenin (vit) gene B1 has been characterized by transient expression analysis of chimeric vit-tk-CAT (chloramphenicol acetyltransferase) gene constructs transfected into the human estrogen-responsive MCF-7 cell line. The vit B1 ERE behaves like an inducible enhancer, since it is able to confer estrogen inducibility to the heterologous HSV thymidine kinase (tk) promoter in a relative position- and orientation-independent manner. In this assay, the minimal B1 ERE is 33 bp long and consists of two 13 bp imperfect palindromic elements both of which are required for the enhancer activity. A third imperfect palindromic element is present further upstream within the 5'-flanking region of the gene but is unable to confer hormone responsiveness by itself. Similarly, neither element forming the B1 ERE can alone confer estrogen inducibility to the tk promoter. However, in combinations of two, all three imperfect palindromes can act cooperatively to form a functional ERE. In contrast a single 13 bp perfect palindromic element, GGTCACTGTGACC, such as the one found upstream of the vit gene A2, is itself sufficient to act as a fully active ERE. Single point mutations within this element abolish estrogen inducibility, while a defined combination of two mutations converts this ERE into a glucocorticoid-responsive element.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A complementary DNA for a glucagon-like peptide-1 receptor was isolated from a human pancreatic islet cDNA library. The isolated clone encoded a protein with 90% identity to the rat receptor. In stably transfected fibroblasts, the receptor bound [125I]GLP-1 with high affinity (Kd = 0.5 nM) and was coupled to adenylate cyclase as detected by a GLP-1-dependent increase in cAMP production (EC50 = 93 pM). Two peptides from the venom of the lizard Heloderma suspectum, exendin-4 and exendin-(9-39), displayed similar ligand binding affinities to the human GLP-1 receptor. Whereas exendin-4 acted as an agonist of the receptor, inducing cAMP formation, exendin-(9-39) was an antagonist of the receptor, inhibiting GLP-1-induced cAMP production. Because GLP-1 has been proposed as a potential agent for treatment of NIDDM, our present data will contribute to the characterization of the receptor binding site and the development of new agonists of this receptor.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The CD44 adhesion receptor is silenced in highly malignant neuroblastomas (NBs) with MYCN amplification. Because its functional expression is associated with decreased tumorigenic properties, CD44 behaves as a tumor suppressor gene in NB and other cancers. Given that the precise mechanisms responsible for CD44 silencing are not elucidated, we investigated whether CD44 expression could be regulated by DNA hypermethylation. The methylation status of CD44 gene promoter and exon 1 regions was analyzed in 12 NB cell lines and 21 clinical samples after bisulfite genomic modification, followed by PCR and single-strand conformation polymorphism analysis and genomic sequencing. The results showed that almost all CD44-negative cell lines displayed hypermethylation in both regions, whereas all CD44-expressing cell lines were unmethylated. These observations correlated with the ability to restore CD44 mRNA and protein expression by treatment of CD44-negative cells with the 5-aza-2'-deoxycytidine demethylating agent. In contrast, no CD44 gene hypermethylation could be detected in 21 NB clinical samples of different stages, irrespective of CD44 expression. Although our results suggest that aberrant methylation of promoter and exon 1 regions is involved in CD44 silencing in NB cell lines, they also indicate that methylation of unidentified regulatory sequences or methylation-independent mechanisms also control the expression of CD44 in primary NB tumors and cell lines. We therefore conclude that CD44 silencing is controlled by complex and tumor cell-specific processes, including gene hypermethylation. Further investigation of other mechanisms and genes involved in CD44 regulation will be needed before demethylation-mediated reactivation of the CD44 gene can be considered as therapeutic strategy for neuroblastoma and perhaps other related cancers.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

PURPOSE: To assess the usefulness of combining hyperthermia with a DNA repair inhibitor (double-strand break bait [Dbait]) and its potential application to radiofrequency ablation (RFA) in a preclinical model of human colorectal cancer. MATERIALS AND METHODS: The local ethics committee of animal experimentation approved all investigations. First, the relevance was assessed by studying the survival of four human colorectal adenocarcinoma cell cultures after 1 hour of hyperthermia at 41°C or 43°C with or without Dbait. Human colon adenocarcinoma cells (HT-29) were grafted subcutaneously into nude mice (n = 111). When tumors reached approximately 500 mm(3), mice were treated with Dbait alone (n = 20), sublethal RFA (n = 21), three different Dbait schemes and sublethal RFA (n = 52), or a sham treatment (n = 18). RFA was performed to ablate the tumor center alone. To elucidate antitumor mechanisms, 39 mice were sacrificed for blinded pathologic analysis, including assessment of DNA damage, cell proliferation, and tumor necrosis. Others were monitored for tumor growth and survival. Analyses of variance and log-rank tests were used to evaluate differences. RESULTS: When associated with mild hyperthermia, Dbait induced cytotoxicity in all tested colon cancer cell lines. Sublethal RFA or Dbait treatment alone moderately improved survival (median, 40 days vs 28 days for control; P = .0005) but combination treatment significantly improved survival (median, 84 days vs 40 days for RFA alone, P = .0004), with approximately half of the animals showing complete tumor responses. Pathologic studies showed that the Dbait and RFA combination strongly enhances DNA damage and coagulation areas in tumors. CONCLUSION: Combining Dbait with RFA sensitizes the tumor periphery to mild hyperthermia and increases RFA antitumor efficacy.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Use of radiolabeled nucleotides for tumor imaging is hampered by rapid in vivo degradation and low DNA-incorporation rates. We evaluated whether blocking of thymidine (dThd) synthesis by 5-fluoro-2'-deoxyuridine (FdUrd) could improve scintigraphy with radio-dThd analogues, such as 5-iodo-2'-deoxyuridine (IdUrd). We first show in vitro that coincubation with FdUrd substantially increased incorporation of [125I]IdUrd and [3H]dThd in the three tested human glioblastoma lines. Flow cytometry analysis showed that a short coincubation with FdUrd (1 h) produces a signal increase per labeled cell. We then measured biodistribution 24 h after i.v. injection of [125I]IdUrd in nude mice s.c. xenografted with the three glioblastoma lines. Compared with animals given [125I]IdUrd alone, i.v. preadministration for 1 h of 10 mg/kg FdUrd increased the uptake of [125I]IdUrd in the three tumors 4.8-6.8-fold. Compatible with previous reports, there were no side effects in mice observed for 2 months after receiving such a treatment. The tumor uptake of [125I]IdUrd was increased < or =13.6-fold when FdUrd preadministration was stepwise reduced to 1.1 mg/kg. Uptake increases remained lower (between 1.7- and 5.8-fold) in normal proliferating tissues (i.e., bone marrow, spleen, and intestine) and negligible in quiescent tissues. DNA extraction showed that 72-80% of radioactivity in tumor and intestine was bound to DNA. Scintigraphy of xenografted mice was performed at different times after i.v. injection of 3.7 MBq [125I]IdUrd. Tumor detection was significantly improved after FdUrd preadministration while still equivocal after 24 h in mice given [125I]IdUrd alone. Furthermore, background activity could be greatly reduced by p.o. administration of KClO4 in addition to potassium iodide. We conclude that FdUrd preadministration may improve positron or single photon emission tomography with cell division tracers, such as radio-IdUrd and possibly other dThd analogues.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Homologous recombination provides a major pathway for the repair of DNA double-strand breaks in mammalian cells. Defects in homologous recombination can lead to high levels of chromosomal translocations or deletions, which may promote cell transformation and cancer development. A key component of this process is RAD51. In comparison to RecA, the bacterial homologue, human RAD51 protein exhibits low-level strand-exchange activity in vitro. This activity can, however, be stimulated by the presence of high salt. Here, we have investigated the mechanistic basis for this stimulation. We show that high ionic strength favours the co-aggregation of RAD51-single-stranded DNA (ssDNA) nucleoprotein filaments with naked duplex DNA, to form a complex in which the search for homologous sequences takes place. High ionic strength allows differential binding of RAD51 to ssDNA and double-stranded DNA (dsDNA), such that ssDNA-RAD51 interactions are unaffected, whereas those between RAD51 and dsDNA are destabilized. Most importantly, high salt induces a conformational change in RAD51, leading to the formation of extended nucleoprotein filaments on ssDNA. These extended filaments mimic the active form of the Escherichia coli RecA-ssDNA filament that exhibits efficient strand-exchange activity.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The differentiation of CD4(+) or CD8(+) T cells following priming of naive cells is central in the establishment of the immune response against pathogens or tumors. However, our understanding of this complex process and the significance of the multiple subsets of differentiation remains controversial. Gene expression profiling has opened new directions of investigation in immunobiology. Nonetheless, the need for substantial amount of biological material often limits its application range. In this study, we have developed procedures to perform microarray analysis on amplified cDNA from low numbers of cells, including primary T lymphocytes, and applied this technology to the study of CD4 and CD8 lineage differentiation. Gene expression profiling was performed on samples of 1000 cells from 10 different subpopulations, defining the major stages of post-thymic CD4(+) or CD8(+) T cell differentiation. Surprisingly, our data revealed that while CD4(+) and CD8(+) T cell gene expression programs diverge at early stages of differentiation, they become increasingly similar as cells reach a late differentiation stage. This suggests that functional heterogeneity between Ag experienced CD4(+) and CD8(+) T cells is more likely to be located early during post-thymic differentiation, and that late stages of differentiation may represent a common end in the development of T-lymphocytes.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

In vertebrates, the RAD51 protein is required for genetic recombination, DNA repair, and cellular proliferation. Five paralogs of RAD51, known as RAD51B, RAD51C, RAD51D, XRCC2, and XRCC3, have been identified and also shown to be required for recombination and genome stability. At the present time, however, very little is known about their biochemical properties or precise biological functions. As a first step toward understanding the roles of the RAD51 paralogs in recombination, the human RAD51C and XRCC3 proteins were overexpressed and purified from baculovirus-infected insect cells. The two proteins copurify as a complex, a property that reflects their endogenous association observed in HeLa cells. Purified RAD51C--XRCC3 complex binds single-stranded, but not duplex DNA, to form protein--DNA networks that have been visualized by electron microscopy.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Regulation of viral genome expression is the result of complex cooperation between viral proteins and host cell factors. We report here the characterization of a novel cellular factor sharing homology with the specific cysteine-rich C-terminal domain of the basic helix-loop-helix repressor protein I-mfa. The synthesis of this new factor, called HIC for Human I-mfa domain-Containing protein, is controlled at the translational level by two different codons, an ATG and an upstream non-ATG translational initiator, allowing the production of two protein isoforms, p32 and p40, respectively. We show that the HIC protein isoforms present different subcellular localizations, p32 being mainly distributed throughout the cytoplasm, whereas p40 is targeted to the nucleolus. Moreover, in trying to understand the function of HIC, we have found that both isoforms stimulate in T-cells the expression of a luciferase reporter gene driven by the human T-cell leukemia virus type I-long terminal repeat in the presence of the viral transactivator Tax. We demonstrate by mutagenesis that the I-mfa-like domain of HIC is involved in this regulation. Finally, we also show that HIC is able to down-regulate the luciferase expression from the human immunodeficiency virus type 1-long terminal repeat induced by the viral transactivator Tat. From these results, we propose that HIC and I-mfa represent two members of a new family of proteins regulating gene expression and characterized by a particular cysteine-rich C-terminal domain.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The transcription factors TFIIB, Brf1, and Brf2 share related N-terminal zinc ribbon and core domains. TFIIB bridges RNA polymerase II (Pol II) with the promoter-bound preinitiation complex, whereas Brf1 and Brf2 are involved, as part of activities also containing TBP and Bdp1 and referred to here as Brf1-TFIIIB and Brf2-TFIIIB, in the recruitment of Pol III. Brf1-TFIIIB recruits Pol III to type 1 and 2 promoters and Brf2-TFIIIB to type 3 promoters such as the human U6 promoter. Brf1 and Brf2 both have a C-terminal extension absent in TFIIB, but their C-terminal extensions are unrelated. In yeast Brf1, the C-terminal extension interacts with the TBP/TATA box complex and contributes to the recruitment of Bdp1. Here we have tested truncated Brf2, as well as Brf2/TFIIB chimeric proteins for U6 transcription and for assembly of U6 preinitiation complexes. Our results characterize functions of various human Brf2 domains and reveal that the C-terminal domain is required for efficient association of the protein with U6 promoter-bound TBP and SNAP(c), a type 3 promoter-specific transcription factor, and for efficient recruitment of Bdp1. This in turn suggests that the C-terminal extensions in Brf1 and Brf2 are crucial to specific recruitment of Pol III over Pol II.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Cilengitide is a cyclic peptide antagonist of integrins alphavbeta3 and alphavbeta5 that is currently being evaluated as a novel therapeutic agent for recurrent and newly diagnosed glioblastoma. Its mode of action is thought to be mainly antiangiogenic but may include direct effects on tumor cells, notably on attachment, migration, invasion, and viability. In this study we found that, at clinically relevant concentrations, cilengitide (1-100 microM) induces detachment in some but not all glioma cell lines, while the effect on cell viability is modest. Detachment induced by cilengitide could not be predicted by the level of expression of the cilengitide target molecules, alphavbeta3 and alphavbeta5, at the cell surface. Glioma cell death induced by cilengitide was associated with the generation of caspase activity, but caspase activity was not required for cell death since ectopic expression of cytokine response modifier (crm)-A or coexposure to the broad-spectrum caspase inhibitor zVAD-fmk was not protective. Moreover, forced expression of the antiapoptotic protein marker Bcl-X(L) or altering the p53 status did not modulate cilengitide-induced cell death. No consistent effects of cilengitide on glioma cell migration or invasiveness were observed in vitro. Preliminary clinical results indicate a preferential benefit from cilengitide added to temozolomide-based radiochemotherapy in patients with O(6)-methylguanine DNA methyltransferase (MGMT) gene promoter methylation. Accordingly, we also examined whether the MGMT status determines glioma cell responses to cilengitide alone or in combination with temozolomide. Neither ectopic expression of MGMT in MGMT-negative cells nor silencing the MGMT gene in MGMT-positive cells altered glioma cell responses to cilengitide alone or to cilengitide in combination with temozolomide. These data suggest that the beneficial clinical effects derived from cilengitide in vivo may arise from altered perfusion, which promotes temozolomide delivery to glioma cells.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Rationale: Human keratinocytes used for transplants are cultivated on a feeder layer which may be composed of autologous human fibroblasts or 3T3 murine fibroblasts. Using the latter method spares 15 additional days of preparation. In this study we investigate the potential presence of residual murine feeder cell contaminants in epidermal cultures prepared for transplantation. Methods: Monolayers of cultured 3T3-J2 murine fibroblasts were treated with 4 μg/mL of mitomycin C (MMC) for 2 h and used to track cell survival kinetics. Using similar 3T3 cells, human keratinocyte cultures were grown following a modified protocol based on the method described by Rheinwald and Green. Cell sheets were mechanically detached and rinsed 4 times following the same procedure used for transplant preparation. The elimination of 3T3 cells during culture was visually tracked using phase contrast microscopy. Epidermal cultures were then dissociated to produce cell suspensions and analyzed by flow cytometry using a murine-specific antibody, CD90, conjugated to a fluorescein isothiocyanate (FITC) marker. Dead cells were identified using 7-amino-actinomysin D (7-AAD) which binds to DNA in permeabilized cells. Results: 3T3 cells treated with MMC display clear morphological signs of apoptosis, disappearing completely in 9-10 days following kinetics similar to 30 Gy gamma irradiated 3T3 cells. Histological analysis of cultured epidermal sheets revealed homogenous keratinocytic tissue with no 3T3 cells. MMC treated and untreated 3T3 cells displayed strong CD90 expression. Cell suspensions obtained from epidermal cultures were, however, negative for that marker. Conclusion: Results obtained demonstrate the absence of contaminating murine 3T3 feeder cells in human keratinocyte cultures. These findings highlight our success in developing cultured human epidermal autografts.