Expression of the vault RNA protects cells from undergoing apoptosis

Non-protein-coding RNAs are a functionally versatile class of transcripts found in all domains of life exerting their biological role at the RNA level. Recently, we demonstrated that the vault-associated RNAs (vtRNAs) were significantly up-regulated in human B cells upon Epstein-Barr virus (EBV) infection [1,2]. vtRNAs are an integral part of the vault complex, a huge and evolutionarily conserved cytoplasmic ribonucleoprotein complex. The major vault protein (MVP) is the main structural component of the complex while vtRNA accounts for only 5% of its mass. Very little is known about the function(s) of the vtRNAs or the vault complex. In particular the role and significance of the previously observed vtRNA up-regulation upon EBV infection remained unclear. We individually expressed EBV-encoded genes in B cells and found the latent membrane protein 1 (LMP1) as trigger for vtRNA up-regulation. To unravel a putative functional interconnection between vtRNA expression and EBV infection, we ectopically expressed vtRNA1-1 in human B cells and observed an improved viral establishment. Furthermore, expression of vtRNA1-1 but not of the other vtRNA paralogs protected cells from undergoing apoptosis. Knock-down of MVP had no effect on these phenotypes thus revealing the vtRNA and not the vault complex to contribute to the enhanced EBV establishment and apoptosis resistance. Mutational analysis highlighted the central domain of the vtRNA to be involved in the anti-apoptotic effect. Ongoing research aims at characterizing the target of vtRNA1-1 in the apoptotic pathway. In summary, our data reveal a crucial cellular function for the so far elusive RNA biology of the vtRNAs.

Expression of the vault RNA protects cells from undergoing apoptosis

Non-protein-coding RNAs are a functionally versatile class of transcripts exerting their biological roles on the RNA level. Recently, we demonstrated that the vault complex-associated RNAs (vtRNAs) are significantly upregulated in Epstein-Barr virus (EBV)-infected human B cells. Very little is known about the function(s) of the vtRNAs or the vault complex. Here, we individually express latent EBV-encoded proteins in B cells and identify the latent membrane protein 1 (LMP1) as trigger for vtRNA upregulation. Ectopic expression of vtRNA1-1, but not of the other vtRNA paralogues, results in an improved viral establishment and reduced apoptosis, a function located in the central domain of vtRNA1-1. Knockdown of the major vault protein has no effect on these phenotypes revealing that vtRNA1-1 and not the vault complex contributes to general cell death resistance. This study describes a NF-κB-mediated role of the non-coding vtRNA1-1 in inhibiting both the extrinsic and intrinsic apoptotic pathways.

STUDIES ON THE BIOLOGICAL ACTIVITY OF MACROMOLECULES MICROINJECTED INTO MAMMALIAN SOMATIC CELLS

Red Blood cell mediated and glass needle mediated microinjection technology was used to introduce macromolecules into mammalian somatic cells. The biological activities of DNA synthesis inducing factor(s) (Chapter 1), mitotic factor(s) (Chapter 2), and DNA coding for ovalbumin and thymidine kinase (Chapter 3) were studied following injection into mammalian somatic cells.^ Chapter 1. A cell undergoing DNA replication (S phase) contains a factor(s) that induces DNA synthesis prematurely in a G(,1) nucleus when an S phase cell is fused to a G(,1) cell. An assay for the active factor(s) was developed in which a mixture of s phase extract loaded red blood cells (RBC) and synchronous G(,1) HeLa cells was centrifuged onto Concanavalin A (Con A) treated coverslips and fused by PEG. This technique is called "Centrifusion". The synchronous G(,1) HeLa cells injected with S phase extract initiated DNA synthesis earlier than the control G(,1) cells mock injected with RBC loaded with buffer.^ Chapter 2. It has been demonstrated that fusion between a mitotic and an interphase cell usually leads to breakdown of the interphase nucleus, followed by condensation of the interphase chromatin into discrete chromosomes, a process termed premature chromosome condensation. I wanted to develop an assay for the mitotic factor(s) that induces premature chromosome condensation. Experiments were performed utilizing glass needle mediated microinjection of HeLa cell mitotic extract into interphase somatic mammalian cells in an attempt to induce premature chromosome condensation. However, I was not able to induce premature chromosome condensation in the interphase cells, probably because of an inability to introduce sufficient mitotic factor(s) into the cells.^ Chapter 3. A recombinant plasmid containing the chicken ovalbumin gene and three copies of the Herpes thymidine Kinase gene (pOV12-TK) was introduced into mouse LMTK('-) cell nuclei using glass needle mediated gene transfer resulting in LMTK('+) clones that were selected for in HAT medium. Restriction enzyme analysis of the high molecular weight DNA from 6 HAT medium survivor cell clones revealed the presence of one or at best only a few copies of the 12kb ovalbumin gene per mouse genome. Further analysis showed the ovalbumin DNA was not rearranged and was associated with high molecular weight mouse cell DNA. Each of the analyzed cell clones produced ovalbumin demonstrating that the biological activity of the microinjected ovalbumin was retained. ^

IN VITRO INDUCTION OF XENOIMMUNE RESPONSES TO LIPOSOMES CONTAINING HUMAN COLON TUMOR ANTIGENS

Liposomes prepared with human LS174T colon tumor cell membranes induce specific primary and secondary xenogeneic immune responses in BALB/c splenocytes in vitro. The multilamellar vesicular liposomes were prepared by adding sonicated membrane fragments in 8 mM CaCl(,2) to a dried lipid film. Cytoxic splenocytes generated in vivo exhibited specificity for the LS174T cell; liposomes elicited higher levels of cytotoxicity than did membranes (P < 0.01). Secondary blastogenic responses elicited in in vivo-primed spleen cells by liposomes also produced a significantly greater (P < 0.005) response than membranes. Subsequently, in vitro induction of primary blastogenic and cytotoxic responses by liposomes were accomplished and revealed similar kinetics to that of whole LS174T cell immunogens. Specificity of the in vitro-primed spleen cells was clearly demonstrated (P < 0.01) on a variety of human tumor cells using both the primed lymphocyte and cell-mediated cytotoxicity assays. The results of competitive inhibition tests with autologous lymphoblasts demonstrated that 30% of the cytotoxic activity was directed against lymphocyte antigens.^ The adjuvant effect of liposomes was shown to be mediated primarily by tumor antigens exposed on the outer surface of liposomes. Trypsinization of the liposomes which eliminated 96% of the surface protein reduced the ability of liposomes to induce cytotoxic splenocytes. The generation of cytolytic activity with liposomes of increasing protein concentration showed that while 10 (mu)g protein was threshold, 100 (mu)g protein induced maximal responses. In addition, membrane fluidity studies revealed that rigid liposomes were significantly (P < 0.05) more efficacious than fluid liposomes in inducing cytotoxicity.^ The induction of the primary response required the presence of nonadherent splenocytes bearing the Thy-1, Lyt-1, and Lyt-2 surface markers. The role of a Lyt-123 subpopulation was suggested by the inability of both the Lyt-1 and Lyt-2 depleted populations to completely restore the cytolytic levels to normal. In addition, the interaction of I-A('+) spleen adherent cells with liposomes for at least 8 hours was required to generate maximal cytotoxic activity. The phenotype of the cytotoxic effector was Thy-1('+), Lyt-2('+), and I-A('d-).^ Incorporation of tumor antigens into liposomes has thus enabled primary immunization in vitro to human colon cancer antigens and may afford an adaptable means to evaluate and to select specific immune responses, as well as to identify colon tumor-specific determinants.^

The role of MAPK during the activation of NK cells

Although many clinical trials investigated the use of IL-2, IL-12, and LAK in adoptive immunotherapy to treat cancer, only limited clinical success has been achieved. Better understanding of the intracellular processes that IL-2 and IL-12 utilize to generate LAK and other functions in NK cells is necessary to improve this mode of therapy. IL-2 and IL-12 stimulate extracellular signal-regulated protein kinase (ERK) and p38 MAPK in mitogen-activated T lymphocytes. The functional roles that these kinases play are still unclear. In this study, we examined whether MAPK Kinase (MKK)/ERK and/or p38 MAPK pathways are necessary for IL-2 or IL-12 to activate NK cells. We established that IL-2 activates MKK1/2/ERK pathway in freshly isolated human NK cells without any prior stimulation. Furthermore, we determined that an intact MKK/ERK pathway is necessary for IL-2 to activate NK cells to express at least four known biological responses: LAK activity, IFN-γ secretion, and CD25 and CD69 expression. Treatment of NK cells with a specific inhibitor of MKK1/2 PD98059, during the IL-2 stimulation blocked in a dose-dependent manner each of four activation parameters. Although activation of ERK was not detected in NK cells immediately after IL-12 stimulation, IL-12-induced functional activation was inhibited by the MKK1/2 inhibitor, as well. In contrast to what was observed by others in T lymphocytes, activation of p38 MAPK by IL-2 was not detected in NK cells. Additionally, a specific inhibitor of p38 MAPK (SB203850) did not inhibit IL-2-activated NK functions. These data reveal selective signaling differences between NK cells and T lymphocytes. Collectively, the data support that the MKK/ERK pathway plays a critical positive regulatory role in NK cells during activation by IL-2 and IL-12. ^

The utility of N5 for gene therapy of human cancer

Cancer is a result of defects in the coordination of cell proliferation and programmed cell death. The extent of cell death is physiologically controlled by the activation of a programmed suicide pathway that results in a morphologically recognizable form of death termed apoptosis. Inducing apoptosis in tumor cells by gene therapy provides a potentially effective means to treat human cancers. The p84N5 is a novel nuclear death domain containing protein that has been shown to bind an amino terminal domain of retinoblastoma tumor suppressor gene product (pRb). Expression of N5 can induce apoptosis that is dependent upon its intact death domain and is inhibited by pRb. In many human cancer cells the functions of pRb are either lost through gene mutation or inactivated by different mechanisms. N5 based gene therapy may induce cell death preferentially in tumor cells relative to normal cells. We have demonstrated that N5 gene therapy is less toxic to normal cells than to tumor cells. To test the possibility that N5 could be used in gene therapy of cancer, we have generated a recombinant adenovirus engineered to express N5 and test the effects of viral infection on growth and tumorigenicity of human cancer cells. Adenovirus N5 infection significantly reduced the proliferation and tumorigenicity of breast, ovarian, and osteosarcoma tumor cell lines. Reduced proliferation and tumorigenicity were mediated by an induction of apoptosis as indicated by DNA fragmentation in infected cells. We also test the potential utility of N5 for gene therapy of pancreatic carcinoma that typically respond poorly to conventional treatment. Adenoviral mediated N5 gene transfer inhibits the growth of pancreatic cancer cell lines in vitro. N5 gene transfer also reduces the growth and metastasis of human pancreatic adenocarcinoma in subcutaneous and orthotopic mouse model. Interestingly, the pancreatic adenocarcinoma cells are more sensitive to N5 than they are to p53, suggesting that N5 gene therapy may be effective in tumors resistant to p53. We also test the possibilities of the use of N5 and p53 together on the inhibition of pancreatic cancer cell growth in vitro and vivo. Simultaneous use of N5 and RbΔCDK has been found to exert a greater extent on the inhibition of pancreatic cancer cell growth in vitro and in vivo. ^

Loss of activator protein-2alpha results in overexpression of the thrombin receptor and correlates with the malignant phenotype of human melanoma

Increasing evidence demonstrates that the thrombin receptor (protease activated receptor-1, PAR-1) plays a major role in tumor invasion and contributes to the metastatic phenotype of human melanoma. We demonstrate that the metastatic potential of human melanoma cells correlates with overexpression of PAR-1. The promoter of the PAR-1 gene contains multiple putative AP-2 and Sp1 consensus elements. We provide evidence that an inverse correlation exists between the expression of AP-2 and the expression of PAR-1 in human melanoma cells. Re-expression of AP-2 in WM266-4 melanoma cells (AP-2 negative) resulted in decreased mRNA and protein expression of PAR-1 and significantly reduced the tumor potential in nude mice. ChIP analysis of the PAR-1 promoter regions bp −365 to −329 (complex 1) and bp −206 to −180 (complex 2) demonstrates that in metastatic cells Sp1 is predominantly binding to the PAR-1 promoter, while in nonmetastatic cells AP-2 is bound. In vitro analysis of complex 1 demonstrates that AP-2 and Sp1 bind to this region in a mutually exclusive manner. Transfection experiments with full-length and progressive deletions of the PAR-1 promoter luciferase constructs demonstrated that metastatic cells had increased promoter activity compared to low and nonmetastatic melanoma cells. Our data shows that exogenous AP-2 expression decreased promoter activity, while transient expression of Sp1 further activated expression of the reporter gene. Mutational analysis of complex 1 within PAR-1 luciferase constructs further demonstrates that the regulation of PAR-1 is mediated through interactions with AP-2 and Sp1. Moreover, loss of AP-2 in metastatic cells alters the AP-2 to Sp1 ratio and DNA-binding activity resulting in overexpression of PAR-1. In addition, we evaluated the expression of AP-2 and PAR-1 utilizing a tissue microarray of 93 melanocytic lesions spanning from benign nevi to melanoma metastasis. We report loss of AP-2 expression in malignant tumors compared to benign tissue while PAR-1 was expressed more often in metastatic melanoma cells than in benign melanocytes. We propose that loss of AP-2 results in increased expression of PAR-1, which in turn results in upregulation of gene products that contribute to the metastatic phenotype of melanoma. ^

BIOCHEMICAL CHARACTERIZATION AND CLINICAL SIGNIFICANCE OF COAGULASE-NEGATIVE STAPHYLOCOCCI

Although coagulase-negative staphylococci (C-NS) have been implicated in certain human infections, they are generally regarded as contaminants and their clinical significance is questioned. To assess their role as pathogens, 205 isolates of C-NS from wounds, and body fluids (blood, urine, pleural and peritoneal fluids, etc.) were studied. Patient's charts were reviewed and using strict criteria a determination was made regarding the clinical significance of these isolates. The organisms were then identified using the scheme of Kloos and Schleifer to determine if certain species of C-NS were associated with specific infections. S. epidermidis sensu stricto accounted for 81% of the C-NS isolated; the frequency of other species was S. haemolyticus (6%), S. hominis (5%), S. capitis (4%), S. warneri (3%), and others (1%). Only two isolates were novobiocin resistant; neither was identified as S. saprophyticus. Using these criteria, 22% of C-NS were considered to be clinically significant and the majority of these (93%) were due to S. epidermidis. The most common source of the clinically relevant C-NS isolates was from wounds. These data suggest that identifying C-NS species other than S. epidermidis may be of limited value in predicting clinical significance.^ In addition, selected pathogenic and non-pathogenic strains of C-NS were compared for their ability to adhere to human cells in vitro. Although the results were not conclusive, it appeared that pathogenic C-NS adhered more avidly than non-pathogenic C-NS to buccal cells. Experiments with HeLa cells showed no difference between pathogenic and non-pathogenic C-NS in adherence abilities. ^

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Role and regulation of c-KIT gene expression in tumor growth and metastasis of human melanoma

The purpose of this study was to investigate the role of the c-KIT receptor in the progression of human melanoma and the mechanism(s) for the regulation of c-KIT gene expression in human melanoma.^ The molecular changes associated with the transition of melanoma cells from radial growth phase (RGP) to vertical growth phase (VGP) (metastatic phenotype) are not well-defined. Expression of the tyrosine-kinase receptor c-KIT progressively decreases during local tumor growth and invasion of human melanomas. To provide direct evidence that the metastasis of human melanoma is associated with the loss of c-KIT expression, highly metastatic A375SM cells, which express very low or undetectable levels of c-KIT, were tranduced with the human c-KIT gene. We demonstrated that enforced c-KIT expression in highly metastatic human melanoma cells significantly suppressed their tumorigenicity and metastatic propensity in nude mice. In addition, we showed that the ligand for c-KIT, SCF, induces apoptosis in human melanoma cells expressing c-KIT under both in vitro and in vivo conditions. These results suggest that loss of c-KIT receptor may allow malignant melanoma cells to escape SCF/c-KIT-mediated apoptosis, thus contributing to tumor growth and eventually metastasis.^ Furthermore, we investigated the possible mechanism(s) for the down-regulation of c-KIT gene expression in malignant melanoma. Sequence analysis of the c-KIT promoter indicated that this promoter contains several consensus binding-site sequences including three putative AP2 and two Myb sites. Although Myb was shown to be associated with c-KIT expression in human hemotopoietic cells, we found no correlation between c-KIT expression and Myb expression in human melanoma cell lines. In contrast, we showed that c-KIT expression directly correlates with expression of AP2 in human melanoma cells. We found that highly metastatic cells do not express the transcription factor AP2. Expression of AP2 in A375SM cells (c-KIT-negative and AP2-negative) was enough to restore luciferase activity driven by the c-KIT promoter in a dose-dependent manner. On the other hand, co-expression of the dominant-negative form of AP2 (AP2B) in Mel-501 cells (c-KIT-positive and AP2-positive) resulted in two-fold reduction in luciferase activity. Electrophoretic mobility shift assays revealed that the c-KIT promoter contains functional AP2 binding sites which could associate with AP2 protein. Endogenous c-KIT gene expression levels were elevated in AP2 stably-transfected human melanoma A375SM cells. Expression of exogenous AP2 in A375SM cells inhibited their tumorigenicity and metastatic potential in nude mice. The c-KIT ligand, SCF, also induced apoptosis in the AP2 stably-transfected A375SM cells. The identification of AP2 as an important regulator for c-KIT expression suggests that AP2 may have tumor growth and metastasis inhibitory properties, possibly mediated through c-KIT/SCF effects on apoptosis of human melanoma cells. Since AP2 binding sites were found in the promoters of other genes involved in the progression of human melanoma, such as MMP2 (72 kDa collagenase), MCAM/MUC18 and P21/WAF-1, our findings suggest that loss of AP2 expression might be a crucial event in the development of malignant melanoma. ^

Transcriptional repression of serum amyloid A1 by AP -2 contributes to its liver -specific expression

Studies on the transcriptional regulation of serum amyloid A1 (SAA1) gene, a liver specific acute-phase gene, identified a regulatory element in its promoter that functioned to repress (SAA1) gene transcription in nonliver cells. This silencer element interacts with a nuclear protein that is detectable in HeLa cells, fibroblasts and placental tissues but not in liver or liver-derived cells. As the expression pattern of this repressor is consistent with its potential regulatory role in repressing SAA1 expression, and that many other liver gene promoters also contain this repressor binding site, we sought to investigate whether this repressor may have a broader functional role in repressing liver genes. ^ We have utilized protein purification, cell culture, transient and stable gene transfection, and molecular biology approaches to identify this protein and investigate its possible function in the regulation of (SAA1) and other liver genes. Analyses of amino acid sequence of the purified nuclear protein, and western blot and gel shift studies identified the repressor as transcription factor AP-2 or AP-2-like protein. Using transient transfection of DNA into cultured cells, we demonstrate that AP-2 can indeed function as a repressor to inhibit transcription of SAA1 gene promoter. This conclusion is supported by the following experimental results: (1) overexpression of AP-2 in hepatoma cells inhibits conditioned medium (CM)-induced expression of SAA1 promoter; (2) binding of AP-2 to the SAA1 promoter is required for AP-2 repression function; (3) one mechanism by which AP-2 inhibits SAA1 may be by antagonizing the activation function of the strong transactivator NFκB; (4) mutation of AP-2 binding sites results in derepression of SAM promoter in HeLa cells; and (5) inhibition of endogenous AP-2 activity by a dominant-negative mutant abolishes AP-2's inhibitory effect on SAM promoter in HeLa cells. In addition to the SAM promoter, AP-2 also can bind to the promoter regions of six other liver genes tested, suggesting that it may have a broad functional role in restricting the expression of many liver genes in nonliver cells. Consistent with this notion, ectopic expression of AP-2 also represses CM-mediated activation of human third component of complement 3 promoter. Finally, in AP-2-expressing stable hepatoma cell lines, AP-2 inhibits not only the expression of endogenous SAA, but also the expression of several other endogenous liver genes including albumin, α-fetoprotein. ^ Our findings that AP-2 has the ability to repress the expression of liver genes in nonliver cells opens a new avenue of investigation of negative regulation of gene transcription, and should improve our understanding of tissue-specific expression of liver genes. In summary, our data provide evidence suggesting a novel role of AP-2 as a repressor, inhibiting the expression of liver genes in nonliver cells. Thus, the tissue-specific expression of AP-2 may constitute an important mechanism contributing to the liver-specific expression of liver genes. ^

Intrinsic oxidative stress in cancer cells: A biochemical basis for therapeutic selectivity using ROS -generating agents

A major goal of chemotherapy is to selectively kill cancer cells while minimizing toxicity to normal cells. Identifying biological differences between cancer and normal cells is essential in designing new strategies to improve therapeutic selectivity. Superoxide dismutases (SOD) are crucial antioxidant enzymes required for the elimination of superoxide (O2·− ), a free radical produced during normal cellular metabolism. Previous studies in our laboratory demonstrated that 2-methoxyestradiol (2-ME), an estradiol derivative, inhibits the function of SOD and selectively kills human leukemia cells without exhibiting significant cytotoxicity in normal lymphocytes. The present work was initiated to examine the biochemical basis for the selective anticancer activity of 2-ME. Investigations using two-parameter flow cytometric analyses and ROS scavengers established that O2·− is a primary and essential mediator of 2-ME-induced apoptosis in cancer cells. In addition, experiments using SOD overexpression vectors and SOD knockout cells found that SOD is a critical target of 2-ME. Importantly, the administration of 2-ME resulted in the selective accumulation of O 2·− and apoptosis in leukemia and ovarian cancer cells. The preferential activity of 2-ME was found to be due to increased intrinsic oxidative stress in these cancer cells versus their normal counterparts. This intrinsic oxidative stress was associated with the upregulation of the antioxidant enzymes SOD and catalase as a mechanism to cope with the increase in ROS. Furthermore, oxygen consumption experiments revealed that normal lymphocytes decrease their respiration rate in response to 2-ME-induced oxidative stress, while human leukemia cells seem to lack this regulatory mechanism. This leads to an uncontrolled production of O2·−, severe accumulation of ROS, and ultimately ROS-mediated apoptosis in leukemia cells treated with 2-ME. The biochemical differences between cancer and normal cells identified here provide a basis for the development of drug combination strategies using 2-ME with other ROS-generating agents to enhance anticancer activity. The effectiveness of such a combination strategy in killing cancer cells was demonstrated by the use of 2-ME with agents/modalities such as ionizing radiation and doxorubicin. Collectively, the data presented here strongly suggests that 2-ME may have important clinical implications for the selective killing of cancer cells. ^

Loss of transformed phenotype in cancer cells by overexpression of the uteroglobin gene

Uteroglobin (UG) is a multifunctional, secreted protein that has receptor-mediated functions. The human UG (hUG) gene is mapped to chromosome 11q12.2–13.1, a region frequently rearranged or deleted in many cancers. Although high levels of hUG expression are characteristic of the mucosal epithelia of many organs, hUG expression is either drastically reduced or totally absent in adenocarcinomas and in viral-transformed epithelial cells derived from the same organs. In agreement with these findings, in an ongoing study to evaluate the effects of aging on UG-knockout mice, 16/16 animals developed malignant tumors, whereas the wild-type littermates (n = 25) remained apparently healthy even after 1½ years. In the present investigation, we sought to determine the effects of induced-expression of hUG in human cancer cells by transfecting several cell lines derived from adenocarcinomas of various organs with an hUG-cDNA construct. We demonstrate that induced hUG expression reverses at least two of the most important characteristics of the transformed phenotype (i.e., anchorage-independent growth on soft agar and extracellular matrix invasion) of only those cancer cells that also express the hUG receptor. Similarly, treatment of the nontransfected, receptor-positive adenocarcinoma cells with purified recombinant hUG yielded identical results. Taken together, these data define receptor-mediated, autocrine and paracrine pathways through which hUG reverses the transformed phenotype of cancer cells and consequently, may have tumor suppressor-like effects.

Chimeric anti-angiogenin antibody cAb 26–2F inhibits the formation of human breast cancer xenografts in athymic mice

Angiogenin (Ang), an inducer of neovascularization, is secreted by several types of human tumor cells and appears critical for their growth. The murine anti-Ang monoclonal antibody (mAb) 26–2F neutralizes the activities of Ang and dramatically prevents the establishment and metastatic dissemination of human tumor cell xenografts in athymic mice. However, for use clinically, the well-documented problem of the human anti-globulin antibody response known to occur with murine antibodies requires resolution. As a result, chimeric as well as totally humanized antibodies are currently being evaluated as therapeutic agents for the treatment of several pathological conditions, including malignancy. Therefore, we have constructed a chimeric mouse/human antibody based on the structure of mAb 26–2F. Complementary DNAs from the light and heavy chain variable regions of mAb 26–2F were cloned, sequenced, and genetically engineered by PCR for subcloning into expression vectors that contain human constant region sequences. Transfection of these vectors into nonproducing mouse myeloma cells resulted in the secretion of fully assembled tetrameric molecules. The chimeric antibody (cAb 26–2F) binds to Ang and inhibits its ribonucleolytic and angiogenic activities as potently as mAb 26–2F. Furthermore, the capacities of cAb 26–2F and its murine counterpart to suppress the formation of human breast cancer tumors in athymic mice are indistinguishable. Thus cAb 26–2F, with its retained neutralization capability and likely decreased immunogenicity, may be of use clinically for the treatment of human cancer and related disorders where pathological angiogenesis is a component.

Inhibition of hypoxia-inducible factor 1 activity by nitric oxide donors in hypoxia

Nitric oxide (NO) is known to have various biologic and pathophysiologic effects on organisms. The molecular mechanisms by which NO exerts harmful effects are unknown, although various O2 radicals and ions that result from reactivity of NO are presumed to be involved. Here we report that adaptive cellular response controlled by the transcription factor hypoxia-inducible factor 1 (HIF-1) in hypoxia is suppressed by NO. Induction of erythropoietin and glycolytic aldolase A mRNAs in hypoxically cultured Hep3B cells, a human hepatoma cell line, was completely and partially inhibited, respectively, by the addition of sodium nitroprusside (SNP), which spontaneously releases NO. A reporter plasmid carrying four hypoxia-response element sequences connected to the luciferase structural gene was constructed and transfected into Hep3B cells. Inducibly expressed luciferase activity in hypoxia was inhibited by the addition of SNP and two other structurally different NO donors, S-nitroso-l-glutathione and 3-morpholinosydnonimine, giving IC50 values of 7.8, 211, and 490 μM, respectively. Inhibition by SNP was also observed in Neuro 2A and HeLa cells, indicating that the inhibition was not cell-type-specific. The vascular endothelial growth factor promoter activity that is controlled by HIF-1 was also inhibited by SNP (IC50 = 6.6 μM). Induction generated by the addition of cobalt ion (this treatment mimics hypoxia) was also inhibited by SNP (IC50 = 2.5 μM). Increased luciferase activity expressed by cotransfection of effector plasmids for HIF-1α or HIF-1α-like factor in hypoxia was also inhibited by the NO donor. We also showed that the inhibition was performed by blocking an activation step of HIF-1α to a DNA-binding form.