Induced oleoresin biosynthesis in grand fir as a defense against bark beetles.

Grand fir (Abies grandis) saplings and derived cell cultures are useful systems for studying the regulation of defensive oleoresinosis in conifers, a process involving both the constitutive accumulation of resin (pitch) in specialized secretory structures and the induced production of monoterpene olefins (turpentine) and diterpene resin acids (rosin) by nonspecialized cells at the site of injury. The pathways and enzymes involved in monoterpene and diterpene resin acid biosynthesis are described, as are the coinduction kinetics following stem injury as determined by resin analysis, enzyme activity measurements, and immunoblotting. The effects of seasonal development, light deprivation, and water stress on constitutive and wound-induced oleoresinosis are reported. Future efforts, including a PCR-based cloning strategy, to define signal transduction in the wound response and the resulting gene activation processes are delineated.

Use of Arabidopsis thaliana defense-related mutants to dissect the plant response to pathogens.

The plant defense response to microbial pathogens had been studied primarily by using biochemical and physiological techniques. Recently, several laboratories have developed a variety of pathosystems utilizing Arabidopsis thaliana as a model host so that genetic analysis could also be used to study plant defense responses. Utilizing a pathosystem that involves the infection of Arabidopsis with pathogenic pseudomonads, we have cloned the Arabidopsis disease-resistance gene RPS2, which corresponds to the avirulence gene avrRpt2 in a gene-for-gene relationship. RPS2 encodes a 105-kDa protein containing a leucine zipper, a nucleotide binding site, and 14 imperfect leucine-rich repeats. The RPS2 protein is remarkably similar to the product of the tobacco N gene, which confers resistance to tobacco mosaic virus. We have also isolated a series of Arabidopsis mutants that synthesize decreased levels of an Arabidopsis phytoalexin called camalexin. Analysis of these mutants indicated that camalexin does not play a significant role in limiting growth of avirulent Pseudomonas syringae strains during the hypersensitive defense response but that it may play a role in limiting the growth of virulent strains. More generally, we have shown that we can utilize Arabidopsis to systematically dissect the defense response by isolation and characterization of appropriate defense-related mutants.

Molecular mechanisms of defense by rhizobacteria against root disease.

Genetic resistance in plants to root diseases is rare, and agriculture depends instead on practices such as crop rotation and soil fumigation to control these diseases. "Induced suppression" is a natural phenomenon whereby a soil due to microbiological changes converts from conducive to suppressive to a soilborne pathogen during prolonged monoculture of the susceptible host. Our studies have focused on the wheat root disease "take-all," caused by the fungus Gaeumannomyces graminis var. tritici, and the role of bacteria in the wheat rhizosphere (rhizobacteria) in a well-documented induced suppression (take-all decline) that occurs in response to the disease and continued monoculture of wheat. The results summarized herein show that antibiotic production plays a significant role in both plant defense by and ecological competence of rhizobacteria. Production of phenazine and phloroglucinol antibiotics, as examples, account for most of the natural defense provided by fluorescent Pseudomonas strains isolated from among the diversity of rhizobacteria associated with take-all decline. There appear to be at least three levels of regulation of genes for antibiotic biosynthesis: environmental sensing, global regulation that ties antibiotic production to cellular metabolism, and regulatory loci linked to genes for pathway enzymes. Plant defense by rhizobacteria producing antibiotics on roots and as cohabitants with pathogens in infected tissues is analogous to defense by the plant's production of phytoalexins, even to the extent that an enzyme of the same chalcone/stilbene synthase family used to produce phytoalexins is used to produce 2,4-diacetylphloroglucinol. The defense strategy favored by selection pressure imposed on plants by soilborne pathogens may well be the ability of plants to support and respond to rhizosphere microorganisms antagonistic to these pathogens.

Pluripotent hematopoietic stem cells contain high levels of mRNA for c-kit, GATA-2, p45 NF-E2, and c-myb and low levels or no mRNA for c-fms and the receptors for granulocyte colony-stimulating factor and interleukins 5 and 7.

Pluripotent hematopoietic stem cells (PHSCs) were highly enriched from mouse bone marrow by counterflow centrifugal elutriation, lineage subtraction, and fluorescence-activated cell sorting based on high c-kit receptor expression (c-kitBR). We used reverse transcriptase polymerase chain reaction to assay the c-kitBR subset and the subsets expressing low (c-kitDULL) and no (c-kitNEG) c-kit receptor for expression of mRNA encoding hematopoietic growth factor receptors and transcription factors. The c-kitBR cells had approximately 3.5-fold more c-kit mRNA than unfractionated bone marrow cells. The c-kitDULL cells had 47-58% of the c-kit mRNA found in c-kitBR cells and the c-kitNEG cells had 4-9% of the c-kit mRNA present in c-kitBR cells. By comparing mRNA levels in c-kitBR cells (enriched for PHSCs) with those of unfractionated bone marrow, we demonstrated that c-kitBR cells contained low or undetectable levels of mRNA for c-fms, granulocyte colony-stimulating factor receptor, interleukin 5 receptor (IL-5R), and IL-7R. These same cells had moderate levels of mRNA for erythropoietin receptor, IL-3R subunits IL-3R alpha (SUT-1), AIC-2A, and AIC-2B, IL-6R and its partner gp-130, and the transcription factor GATA-1 and high levels of mRNA for transcription factors GATA-2, p45 NF-E2, and c-myb. We conclude from these findings that PHSCs are programmed to interact with stem cell factor, IL-3, and IL-6 but not with granulocyte or macrophage colony-stimulating factor. These findings also indicate that GATA-2, p45 NF-E2, and c-myb activities may be involved in PHSC maintenance or proliferation.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

The Identification of Best Management Practices in a Materials Recovery Facility to Increase Solid Waste Diversion in the Department of Defense (DoD) Installations along the Front Range of Colorado to Satisfy the DoD Solid Waste Diversion Goal of 40 Percent

The five installations operated by the Department of Defense (DoD) in the Front Range region of Colorado do not meet the DoD non-hazardous solid waste diversion goal of 40 percent, further impacting landfills and generating greenhouse gases. This applied capstone project identifies and evaluates best management practices of a Materials Recovery Facility (MRF), qualitatively and quantitatively, to increase solid waste diversion at a DoD MRF. An environmental benefits model quantified the externalities of increasing solid waste diversion at the installations. By implementing best management practices at a MRF, the DoD would divert an additional 1,400 tons of solid waste per year, resulting in the equivalent of 1,502,567 gallons of gasoline being saved, among many benefits presented in this capstone.

Endophytic colonization of barley (Hordeum vulgare) roots by the nematophagous fungus Pochonia chlamydosporia reveals plant growth promotion and a general defense and stress transcriptomic response

Plant crop yields are negatively conditioned by a large set of biotic and abiotic factors. An alternative to mitigate these adverse effects is the use of fungal biological control agents and endophytes. The egg-parasitic fungus Pochonia chlamydosporia has been traditionally studied because of its potential as a biological control agent of plant-parasitic nematodes. This fungus can also act as an endophyte in monocot and dicot plants, and has been shown to promote plant growth in different agronomic crops. An Affymetrix 22K Barley GeneChip was used in this work to analyze the barley root transcriptomic response to P. chlamydosporia root colonization. Functional gene ontology (GO) and gene set enrichment analyses showed that genes involved in stress response were enriched in the barley transcriptome under endophytism. An 87.5 % of the probesets identified within the abiotic stress response group encoded heat shock proteins. Additionally, we found in our transcriptomic analysis an up-regulation of genes implicated in the biosynthesis of plant hormones, such as auxin, ethylene and jasmonic acid. Along with these, we detected induction of brassinosteroid insensitive 1-associated receptor kinase 1 (BR1) and other genes related to effector-triggered immunity (ETI) and pattern-triggered immunity (PTI). Our study supports at the molecular level the growth-promoting effect observed in plants endophytically colonized by P. chlamydosporia, which opens the door to further studies addressing the capacity of this fungus to mitigate the negative effects of biotic and abiotic factors on plant crops.

Notebook containing Nathan Prince's defense against the first articles of accusation against him, Nov. 26, 1741

A penciled notation on this notebook's cover indicates that the handwriting is of Thomas Prince, Nathan's brother. Informally titled "An Heavenly Interposition of a Storm & Tempest," this notebook details Prince's point-by-point responses to the accusations against him. Prince also includes lists of each accusation and those making the accusation; he appears to have believed there was a conspiracy against him.

Notebook containing Nathan Prince's defense of himself before the Overseers, Dec. 24, 1741

"Prince's Defence of himself before the Overseers" is written on the cover in ink. "Papers relating to Mr. Prince's iniquities" is written in pencil, in a different hand. This volume, similar to the one in folder 9, records at great length Prince's responses to the accusations against him.

List of books donated by Francis Bernard, Governor of the Massachusetts Bay Colony, undated

Bracketed annotation made by John Langdon Sibley in Feb. 1842: "The books on this & the three succeeding pages, I find on examination, to have been given by Gov. Bernard." On the fourth page, presumably also in 1842, Sibley wrote: "This is a list of donations by Gov. Bernard, & not by Hollis."

Motion for change of venue in the case of the Inhabitants of Massachusetts Bay Colony v. Charles Paxton, October 1761

A motion that the case not be tried in Suffolk County, on the grounds that the judges and jurors were residents of the colony. Pratt was attorney to Paxton, an attorney and commissioner of customs, who had incurred a debt to the Colony.