Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Mineralogical characteristics and transformations during long-term operation of a zero-valent iron reactive barrier

Received for publication October 31, 2002. Design and operation of Fe0 permeable reactive barriers (PRBs) can be improved by understanding the long-term mineralogical transformations that occur within PRBs. Changes in mineral precipitates, cementation, and corrosion of Fe0 filings within an in situ pilot-scale PRB were examined after the first 30 months of operation and compared with results of a previous study of the PRB conducted 15 months earlier using X-ray diffraction and scanning electron microscopy employing energy dispersive X-ray and backscatter electron analyses. Iron (oxy)hydroxides, aragonite, and maghemite and/or magnetite occurred throughout the cores collected 30 mo after installation. Goethite, lepidocrocite, mackinawite, aragonite, calcite, and siderite were associated with oxidized and cemented areas, while green rusts were detected in more reduced zones. Basic differences from our last detailed investigation include (i) mackinawite crystallized from amorphous FeS, (ii) aragonite transformed into calcite, (iii) akaganeite transformed to goethite and lepidocrocite, (iv) iron (oxy)hydroxides and calcium and iron carbonate minerals increased, (v) cementation was greater in the more recent study, and (vi) oxidation, corrosion, and disintegration of Fe0 filings were greater, especially in cemented areas, in the more recent study. If the degree of corrosion and cementation that was observed from 15 to 30 mo after installation continues, certain portions of the PRB (i.e., up-gradient entrance of the ground water to the Fe0 section of the PRB) may last less than five more years, thus reducing the effectiveness of the PRB to mitigate contaminants. Abbreviations: EDX, energy dispersive X-ray • Fe0, zerovalent iron • PRB, permeable reactive barrier • SEM, scanning electron microscopy • XRD, X-ray diffraction

Impact of sample preparation on mineralogical analysis of iron reactive barrier materials

Permeable reactive barriers (PRBs) of zero-valent iron (Fe0) are increasingly being used to remediate contaminated ground water. Corrosion of Fe0 filings and the formation of precipitates can occur when the PRB material comes in contact with ground water and may reduce the lifespan and effectiveness of the barrier. At present, there are no routine procedures for preparing and analyzing the mineral precipitates from Fe0 PRB material. These procedures are needed because mineralogical composition of corrosion products used to interpret the barrier processes can change with iron oxidation and sample preparation. The objectives of this study were (i) to investigate a method of preparing Fe0 reactive barrier material for mineralogical analysis by X-ray diffraction (XRD), and (ii) to identify Fe mineral phases and rates of transformations induced by different mineralogical preparation techniques. Materials from an in situ Fe0 PRB were collected by undisturbed coring and processed for XRD analysis after different times since sampling for three size fractions and by various drying treatments. We found that whole-sample preparation for analysis was necessary because mineral precipitates occurred within the PRB material in different size fractions of the samples. Green rusts quickly disappeared from acetone-dried samples and were not present in air-dried and oven-dried samples. Maghemite/magnetite content increased over time and in oven-dried samples, especially after heating to 105°C. We conclude that care must be taken during sample preparation of Fe0 PRB material, especially for detection of green rusts, to ensure accurate identification of minerals present within the barrier system.

Electron collisions with iron peak elements: a computational grand challenge

This paper discusses the calculation of electron impact collision strengths and effective collision strengths for iron peak elements of importance in the analysis of many astronomical and laboratory spectra. It commences with a brief overview of R-matrix theory which is the basis of computer programs which have been widely used to calculate the relevant atomic data used in this analysis. A summary is then given of calculations carried out over the last 20 y for electron collisions with Fe II. The grand challenge, represented by the calculation of accurate collision strengths and effective collision strengths for this ion, is then discussed. A new parallel R-matrix program PRMAT, which is being developed to meet this challenge, is then described and results of recent calculations, using this program to determine optically forbidden transitions in e- – Ni IV on a Cray T3E-1200 parallel supercomputer, are presented. The implications of this e- – Ni IV calculation for the determination of accurate data from an isoelectronic e- – Fe II calculation are discussed and finally some future directions of research are reviewed.

Recyclable copper catalysts based on imidazolium-tagged bis(oxazolines): A marked enhancement in rate and enantioselectivity for Diels-Alder reactions in ionic liquid

Imidazolium-tagged bis(oxazolines) have been prepared and used as chiral ligands in the copper(II)-catalysed Diels-Alder reaction of N-acryloyl- and N-crotonoyloxazolidinones with cyclopentadiene and 1,3-cyclohexadiene in the ionic liquid 1-ethyl-3-methylimidazolium bis[(trifluoromethyl)sulfonyl]imide, [emim][NTf2]. A significant and substantial enhancement in the rate and enantioselectivity was achieved in [emim][NTf2] compared with dichloromethane. For example, complete conversion and enantioselectivities up to 95 % were obtained for the reaction between N-acryloyloxazolidinone and cyclopentadiene within 2 min in [emim][NTf2] whereas the corresponding reaction in dichloromethane required 60 min to reach completion and gave an ee of only 16 %. The enhanced rates obtained in the ionic liquid enabled a catalyst loading as low as 0.5 mol % to give complete conversion within 2 min while retaining the same level of enantioselectivity. The imidazolium-tagged catalysts can be recycled ten times without any loss in activity or enantioselectivity and showed much higher affinity for the ionic liquid phase during the recycle procedure than the analogous uncharged ligand.

The dichotomy in the DNA-binding behaviour of ruthenium(II) complexes bearing benzoxazole and benzothiazole groups

The substituted tris(bipyridine)ruthenium(II) complexes {[Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru(bpy)(2)(5,5'-bbob)](2+) [where bpy = 2,2'-bipyridine and bbob = bis(benzoxazol-2-yl)-2,2'-bipyridine] have been prepared and compared to the previously studied complex [Ru(bpy)(2)(4,4'-bbtb)](2+) [where bbtb = bis(benzothiazol-2-yl)-2,2'-bipyridine]. From the UV/VIS titration studies, Delta-[Ru(bpy)(2)(4,4'bbob)](2+) displays a stronger association than the Lambda-isomer with calf-thymus DNA (ct-DNA). For [Ru(bpy)(2)(5,5'-bbob)](2+), there appears to be minimal interaction with ct-DNA. The results of fluorescence titration studies suggest that [Ru(bpy)(2)(4,4'-bbob)](2+) gives an increase in emission intensity with increasing ct-DNA concentrations, with an enantiopreference for the A isomer, confirmed by membrane dialysis studies. The fluorescent intercalation displacement studies revealed that [Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru.(bpy)(2)(5,5'bbob)](2+) display a preference for more open DNA structures such as bulge and hairpin sequences. While Delta-[Ru(bpy)(2)(4,4'-bbtb)](2+) has shown the most significant affinity for all the oligonucleotides sequences screened in previous studies, it is the A isomer of the comparable benzoxazole ruthenium(II) complex (Delta-[Ru(bpy)(2)(4,4'-bbob)](2+)) that preferentially binds to DNA.

Benzothiazole bipyridine complexes of ruthenium(II) with cytotoxic activity

A series of benzothiazole-substituted trisbipyridine ruthenium(II) analogues {[Ru(bpy)(2)(4,5'-bbtb)](2+), [Ru(bpy)(2)(5,5'-bbtb)](2+) and [Ru(bpy)(2)(5-mbtb)](2+) [bpy is 2,2'-bipyridine, bbtb is bis(benzothiazol-2-yl)-2,2'-bipyridine, 5-mbtb is 5-(benzothiazol-2-yl),5'-methyl-2,2'-bipyridine]} have been prepared and compared with the complex [Ru(bpy)(2)(4,4'-bbtb)](2+) reported previously. From the UV-vis spectral studies, substitution at the 5-position of the bpy causes the ligand-centred transitions to occur at considerably lower energy than for those with the functionality at the 4-position, while at the same time causing the emission to be effectively quenched. However, substitution at the 4-position causes the metal-to-ligand charge transfer to occur at lower energies. Fluorescent intercalator displacement studies indicate that the doubly substituted complexes displace ethidium bromide from a range of oligonucleotides, with the greater preference shown for bulge and hairpin sequences by the Lambda enantiomer. Since the complexes only show small variation in the UV-vis spectra on the introduction of calf thymus DNA and a small increase in fluorescence they do not appear to be intercalators, but appear to associate within one of the grooves. All of the reported bisbenzothiazole complexes show reasonable cytotoxicity against a range of human cancer cell lines.

The stereoselective coordination chemistry of the helicating ligand N,N '-bis(-2,2 '-dipyridyl-5-yl)carbonyl-(S/R,S/R)-1,2-diphenylethylenediamine

Enantiomerically pure N,N'-bis(-2,2'-dipyridyl-5-yl)carbonyl-(S/R,S/R)-1,2-diphenylethylenediamine has been synthesised by linking two 2,2'-bipyridine units by (R,R)- and (S,S)-1,2-diphenylethylenediamine. The ligands possess a hindered rotation between the bipyridine chromophores, which are held together by intramolecular hydrogen bonds. ES mass spectroscopy confirmed that reaction with Fe(II), Co(III) and Cd(II) afforded dinuclear complexes. CD spectroscopy implied that enantiopure ligands conferred helicity to the metals centre giving a dominant triple helicate diastereoisomer (with the RR isomer giving a P helicate). H-1 NMR spectroscopy of the cadmium complex confirmed the presence of a single diastereoisomer. (C) 2003 Elsevier B.V. All rights reserved.

Task-specific ionic liquid for solubilizing metal oxides

Protonated betaine bis(trifluoromethylsulfonyl) imide is an ionic liquid with the ability to dissolve large quantities of metal oxides. This metal-solubilizing power is selective. Soluble are oxides of the trivalent rare earths, uranium(VI) oxide, zinc(II) oxide, cadmium( II) oxide, mercury( II) oxide, nickel( II) oxide, copper(II) oxide, palladium(II) oxide, lead(II) oxide, manganese( II) oxide, and silver( I) oxide. Insoluble or very poorly soluble are iron(III), manganese(IV), and cobalt oxides, as well as aluminum oxide and silicon dioxide. The metals can be stripped from the ionic liquid by treatment of the ionic liquid with an acidic aqueous solution. After transfer of the metal ions to the aqueous phase, the ionic liquid can be recycled for reuse. Betainium bis( trifluoromethylsulfonyl) imide forms one phase with water at high temperatures, whereas phase separation occurs below 55.5 degrees C ( temperature switch behavior). The mixtures of the ionic liquid with water also show a pH-dependent phase behavior: two phases occur at low pH, whereas one phase is present under neutral or alkaline conditions. The structures, the energetics, and the charge distribution of the betaine cation and the bis( trifluoromethylsulfonyl) imide anion, as well as the cation-anion pairs, were studied by density functional theory calculations.