935 resultados para skin permeability
Resumo:
Basic fibroblast growth factor (bFGF) regulates skin wound healing; however, the underlying mechanism remains to be defined. In the present study, we determined the effects of bFGF on the regulation of cell growth as well as collagen and fibronectin expression in fibroblasts from normal human skin and from hypertrophic scars. We then explored the involvement of mitochondria in mediating bFGF-inducedeffects on the fibroblasts. We isolated and cultivated normal and hypertrophic scar fibroblasts from tissue biopsies of patients who underwent plastic surgery for repairing hypertrophic scars. The fibroblasts were then treated with different concentrations of bFGF (ranging from 0.1 to 1000 ng/mL). The growth of hypertrophic scar fibroblasts became slower with selective inhibition of type I collagen production after exposure to bFGF. However, type III collagen expression was affected in both normal and hypertrophic scar fibroblasts. Moreover, fibronectin expression in the normal fibroblasts was up-regulated after bFGF treatment. bFGF (1000 ng/mL) also induced mitochondrial depolarization in hypertrophic scar fibroblasts (P < 0.01). The cellular ATP level decreased in hypertrophic scar fibroblasts (P < 0.05), while it increased in the normal fibroblasts following treatment with bFGF (P < 0.01). These data suggest that bFGF has differential effects and mechanisms on fibroblasts of the normal skin and hypertrophic scars, indicating that bFGF may play a role in the early phase of skin wound healing and post-burn scar formation.
Resumo:
The Caco-2 cell line has been used as a model to predict the in vitro permeability of the human intestinal barrier. The predictive potential of the assay relies on an appropriate in-house validation of the method. The objective of the present study was to develop a single HPLC-UV method for the identification and quantitation of marker drugs and to determine the suitability of the Caco-2 cell permeability assay. A simple chromatographic method was developed for the simultaneous determination of both passively (propranolol, carbamazepine, acyclovir, and hydrochlorothiazide) and actively transported drugs (vinblastine and verapamil). Separation was achieved on a C18 column with step-gradient elution (acetonitrile and aqueous solution of ammonium acetate, pH 3.0) at a flow rate of 1.0 mL/min and UV detection at 275 nm during the total run time of 35 min. The method was validated and found to be specific, linear, precise, and accurate. This chromatographic system can be readily used on a routine basis and its utilization can be extended to other permeability models. The results obtained in the Caco-2 bi-directional transport experiments confirmed the validity of the assay, given that high and low permeability profiles were identified, and P-glycoprotein functionality was established.
Resumo:
The participation of regulatory T (Treg) cells in B cell-induced T cell tolerance has been claimed in different models. In skin grafts, naive B cells were shown to induce graft tolerance. However, neither the contribution of Treg cells to B cell-induced skin tolerance nor their contribution to the histopathological diagnosis of graft acceptance has been addressed. Here, using male C57BL/6 naive B cells to tolerize female animals, we show that skin graft tolerance is dependent on CD25+ Treg cell activity and independent of B cell-derived IL-10. In fact, B cells from IL-10-deficient mice were able to induce skin graft tolerance while Treg depletion of the host inhibited 100% graft survival. We questioned how Treg cell-mediated tolerance would impact on histopathology. B cell-tolerized skin grafts showed pathological scores as high as a rejected skin from naive, non-tolerized mice due to loss of skin appendages, reduced keratinization and mononuclear cell infiltrate. However, in tolerized mice, 40% of graft infiltrating CD4+ cells were FoxP3+ Treg cells with a high Treg:Teff (effector T cell) ratio (6:1) as compared to non-tolerized mice where Tregs comprise less than 8% of total infiltrating CD4 cells with a Treg:Teff ratio below 1:1. These results render Treg cells an obligatory target for histopathological studies on tissue rejection that may help to diagnose and predict the outcome of a transplanted organ.
Resumo:
Melanocyte loss in vitiligo vulgaris is believed to be an autoimmune process. Macrophage migration inhibitory factor (MIF) is involved in many autoimmune skin diseases. We determined the possible role of MIF in the pathogenesis of vitiligo vulgaris, and describe the relationship between MIF expressions and disease severity and activity. Serum MIF concentrations and mRNA levels in PBMCs were measured in 44 vitiligo vulgaris patients and 32 normal controls, using ELISA and real-time RT-PCR. Skin biopsies from 15 patients and 6 controls were analyzed by real-time RT-PCR. Values are reported as median (25th-75th percentile). Serum MIF concentrations were significantly increased in patients [35.81 (10.98-43.66) ng/mL] compared to controls [7.69 (6.01-9.03) ng/mL]. MIF mRNA levels were significantly higher in PBMCs from patients [7.17 (3.59-8.87)] than controls [1.67 (1.23-2.42)]. There was also a significant difference in MIF mRNA levels in PBMCs between progressive and stable patients [7.86 (5.85-9.13)vs 4.33 (2.23-8.39)] and in serum MIF concentrations [40.47 (27.71-46.79) vs 26.80 (10.55-36.07) ng/mL]. In addition, the vitiligo area severity index scores of patients correlated positively with changes of both serum MIF concentrations (r = 0.488) and MIF mRNA levels in PBMCs (r = 0.426). MIF mRNA levels were significantly higher in lesional than in normal skin [2.43 (2.13-7.59)vs 1.18 (0.94-1.83)] and in patients in the progressive stage than in the stable stage [7.52 (2.43-8.84)vs 2.13 (1.98-2.64)]. These correlations suggest that MIF participates in the pathogenesis of vitiligo vulgaris and may be useful as an index of disease severity and activity.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
Staphylococcus aureus is highly prevalent among patients with atopic dermatitis (AD), and this pathogen may trigger and aggravate AD lesions. The aim of this study was to determine the prevalence of S. aureus in the nares of pediatric subjects and verify the phenotypic and molecular characteristics of the isolates in pediatric patients with AD. Isolates were tested for antimicrobial susceptibility, SCCmectyping, and Panton-Valentine Leukocidin (PVL) genes. Lineages were determined by pulsed-field gel electrophoresis and multilocus sequence typing (MLST). AD severity was assessed with the Scoring Atopic Dermatitis (SCORAD) index. Among 106 patients, 90 (85%) presented S. aureus isolates in their nares, and 8 also presented the pathogen in their skin infections. Two patients had two positive lesions, making a total of 10 S. aureusisolates from skin infections. Methicillin-resistant S. aureus(MRSA) was detected in 24 (26.6%) patients, and PVL genes were identified in 21 (23.3%), including 6 (75%) of the 8 patients with skin lesions but mainly in patients with severe and moderate SCORAD values (P=0.0095). All 24 MRSA isolates were susceptible to trimethoprim/sulfamethoxazole, while 8 isolates had a minimum inhibitory concentration (MIC) to mupirocin >1024 μg/mL. High lineage diversity was found among the isolates including USA1100/ST30, USA400/ST1, USA800/ST5, ST83, ST188, ST718, ST1635, and ST2791. There was a high prevalence of MRSA and PVL genes among the isolates recovered in this study. PVL genes were found mostly among patients with severe and moderate SCORAD values. These findings can help clinicians improve the therapies and strategies for the management of pediatric patients with AD.
Resumo:
Mimic biological structures such as the cell wall of plant tissues may be an alternative to obtain biodegradable films with improved mechanical and water vapor barrier properties. This study aims to evaluate the mechanical properties and water vapor permeability (WVP) of films produced by using the solvent-casting technique from blended methylcellulose, glucomannan, pectin and gelatin. First, films from polysaccharides at pH 4 were produced. The film with the best mechanical performance (tensile strength = 72.63 MPa; elongation = 9.85%) was obtained from methylcellulose-glucomannan-pectin at ratio 1:4:1, respectively. Then, gelatin was added to this polysaccharide blend and the pH was adjusted to 4, 5 and 6. Results showed significant improvement in WVP when films were made at pH 5 and at polysaccharides/gelatin ratio of 90/10 and 10/90, reaching 0.094 and 0.118 g.mm/h.m².kPa as values, respectively. Films with the best mechanical properties were obtained from the blend of polysaccharides, whereas WVP was improved from the blend of polysaccharides and gelatin at pH 5.
Resumo:
Gelatin was extracted from the skin of tilapia (Oreochromis urolepis hornorum) and characterized according to its physical and chemical properties. It had pH 4.66, which is slightly higher than the values reported for gelatins processed by acid solubilization. In general, the ionic content was low, and the average yield of the process was 5.10 g/100 g. The proximal composition of the gelatin was similar to that of the commercial gelatins, with slightly higher moisture content. The tilapia skin gelatin had whitish-yellow color and average turbidity of 67 NTU.
Resumo:
The equilibrium moisture content for adsorption and desorption isotherms of mango skin was determined using the static gravimetric method at temperatures of 20, 26, 33, 38 and 44 oC in the 0.056 to 0.873 water activity range. Both sorption curves show a decrease in equilibrium moisture content as the temperature increasing. The hysteresis effect was observed at constant water activity. The Guggenheim, Anderson, and de Boer (GAB) model presented the best fitting accuracy among a group of models and was used to determine the thermodynamic properties of water sorption. Integral enthalpy and integral entropy areas showed inverted values for the adsorption and desorption isotherms over the wide range of water activity studied. These values confirm, in energetic terms, the difference between adsorption and desorption isotherms observed in the hysteresis phenomenon. Finally, the Gibbs free energy revealed that the sorption process was spontaneous for both sorption isotherms.
Resumo:
Abstract Composite films of chitosan, fish gelatin and microbial transglutaminase (MTgase) were developed. Films were produced by the casting method and dried at room temperature for 30 h, conditioned for 7 days at 30 °C at a relative humidity (RH) from 11 to 90%, and characterized. Chitosan:fish gelatin films in different proportions (100:0, 75:25, 50:50) with MTgase, were subjected to tensile properties and water vapor transmission (WVT) testing. The results showed that tensile strength decreased with an increase in RH and with an increase in gelatin content. Percent of elongation also increased with increasing RH and gelatin concentration. Water vapor transmission showed an increase proportional to an increase in RH with the presence of gelatin being unfavorable for reducing WVT. Results in this work allowed studying the effect of relative humidity on tensile and water vapor properties of chitosan and fish gelatin films.
Resumo:
-
Resumo:
examined in Choanephora cucurbita rum during the early stages of infection by Piptocephalis virginiana » There was a small but consistent increase in the leakage of electrolytes, amino acids and sugars as a result of infection. These low levels of differential leakage in infected tissues are explained on the basis of the nature of this obligate, biotrophic, mycoparasitic system. Quantitative analysis of the twenty six amino acids and amino compounds detected in the leacheates — showed similar profiles in infected and control host and no new species of amino acids or amino compounds were detected in either infected or control host leacheates. Comparatively high amounts of aspartic acid, glutamic acid and alanine were found in the leacheates of host and infected host . Analyses of the sugars comprising the leacheates of infected and control host showed the presence of eight sugars, among which glucose was found in significant amounts (50-53%) ' The nutritional implication of this preferential leakage is discussed. No significant difference was observed in the leacheates of infected host sugar profiles compared with that of the control host. Profiles of the internal pool sugars of infected and control host did not reflect that obtained from the leacheate data, perhaps owing to leakage of sugars in a selective manner . Membrane lipid analyses yielded higher levels of lipid in infected host compared with the control, both at the 24 h and 36 h analyses. In addition, preliminary investigations of phosphorous-32 incorporation and turnover in phospholipids showed higher levels of 32p incorporation and turnover in infected host compared with the control. No apparent difference was noted in the profiles of the neutral lipid classes and the polar lipid classes of the membrane lipids as determined by one and two dimensional thin-layer chromatography respectively. However, a small but consistently higher degree of unsaturation was detected in the fatty acids of infected tissue compared with the control. Also, '^''-^^''^^'-'-^'^^c acid, a polyunsaturated fatty acid previously reported to show a direct correlation during the early stages of infection and the degree of parasitism of P. virginiana on C. cucurbitarum , was found in higher amounts in infected host membrane lipids compared with that of the control host. The implications of these membrane lipid alterations are discussed with particular reference to the small but consistently higher leakage of electrolytes, amino acids and sugars observed during infection in this study.
Resumo:
Through the reflective lens of an adult educator with invisible and episodic disabilities, this paper has been written as an organizational autoethnography. Through a process of autoethnographical sensemaking, it is intended to illuminate important gaps in organizational theory. Feminist/relational care ethics, critical reflection, and transformative learning serve as the educational theories that comprise its framework. In telling my story, embodied writing and performance narrative are used to convey the felt existence of a body exposed through words—where my “abled” and “disabled” professional teaching and learning identities may be studied against the backdrop of organizational policies and procedures. Words used to describe unfamiliar experiences and situations shape meaning for which new meaning may emerge. At the conclusion of this paper, an alternative frame of reference—a view from the margins—may be offered to articulate authenticity in the expectancy of workplace equity for adult educators with disabilities. Taken collectively on a larger level, it is hoped that this research may provide a source of inspiration for systemic organizational change in adult learning environments.
Resumo:
The interaction between local and reflexive control of skin blood flow (SkBF) is unclear. This thesis isolated the roles of rectal (Tre) and local (Tloc) temperature on forearm SkBF regulation at normal and elevated body temperatures, and to investigate the interaction between local and reflexive SkBF control. While either normothermic (Tre ~37.0°C) or hyperthermic (∆Tre +1.1°C), SkBF was assessed on the dorsal aspect of each forearm in 10 participants while Tloc was manipulated in an A-B-A-B fashion between neutral (33.0°C) and hot (38.5°C). Finally, local heating to 44°C was performed to elicit maximal SkBF. Data are presented as a percentage of maximal cutaneous vascular conductance (CVC), calculated as laser-Doppler flux divided by mean arterial pressure. Tloc manipulations performed during normothermia had significantly greater effects on CVC than during hyperthermia. The decreased modification to SkBF from the Tloc changes during hyperthermia suggests that strong reflexive vasodilation attenuates local SkBF control mechanisms.
Resumo:
Abstract It is recommended that all new mothers experience skin-to-skin contact (SSC) with their newborns immediately after birth. However, SSC is not commonly practiced after cesarean deliveries. To understand facilitators and barriers regarding SSC in the operating room (OR), a descriptive online and paper survey was conducted with 68 Registered Nurses from four hospitals in Ontario. The theory of planned behavior framed the study. Nurses had positive attitudes, and believed most health care team members supported SSC in the OR, but were uncertain about their control over the behavior. Nurses who had practiced the behavior in the past had more positive attitudinal and normative beliefs, and perceived some barriers as less difficult. Attitude and past behavior were the only significant multivariate predictors of intention to practice SSC in the future. Results suggest that shifting attitude and supporting more experience with the practice may increase nurses’ implementation of SSC in the OR.