1000 resultados para poro


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Relevância:

10.00% 10.00%

Publicador:

Resumo:

O LMV ocorre em todo o mundo e é considerado um dos patógenos mais importantes para a cultura da alface. de acordo com a habilidade em contornar os genes de resistência mo1¹ e mo1² encontrados em alface, os isolados de LMV podem ser dividos em dois sub-grupos: LMV-Most, capazes de contornar a resistência propiciada por estes genes e de serem transmitidos pela semente nestas cutivares, e LMV-Common, que não são capazes de causar sintomas nestes cultivares, além de serem transmitidos pela semente somente em cultivares suscetíveis. Para avaliar a ocorrência destes dois tipos de isolados de LMV foram coletadas, durante 2002-2005, amostras de alface com sintomas de mosaico em áreas de produção de alface comercial das regiões de Campinas, Mogi das Cruzes e Bauru no estado de São Paulo. O RNA total foi utilizado para detecção por RT-PCR utilizando-se oligonucleotídeos universais para LMV que amplificam a porção N-terminal variável da capa protéica, localizada no terminal 3´do genoma. As amostras positivas foram analisadas por um segundo primer que amplifica um fragmento da região central (CI-VPg) do genoma viral. Um total de 1362 amostras foram avaliadas, tendo sido detectado o LMV em 504 amostras (37,29%). O LMV-Common prevaleceu em variedades suscetíveis (77,3%). O LMV-Most foi encontrado frequentemente associado a variedades portadoras do gene de tolerância mo1¹. Apesar da existência dos LMV-Most capazes de contornar a resistência em alface, estes não predominam em nossa condições.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

O milheto é uma gramínea anual de sementes pequenas, com grande diversidade de tamanho, e com dificuldade, às vezes, do estabelecimento da população adequada de plantas. Este experimento objetivou verificar a influência do tamanho da semente de milheto sobre sua germinação e vigor. Foram utilizados quatro lotes de sementes (I, II, III e IV), classificados em quatro tamanhos, através de peneiras de malha quadrada, sendo: peneira 1 ≥ 2,00mm, peneira 2: 1,68 a 2,00mm, peneira 3: 1,41 a 1,68mm, peneira 4: 0,71 a 1,41mm e mais uma porção do lote original (testemunha), que constituíram os tamanhos. Foram realizados os testes de: peso de 1000 sementes, germinação inicial e após seis meses de armazenamento (TGI e TGII, respectivamente) e vigor (primeira contagem do teste de germinação e condutividade elétrica das sementes). Utilizou-se o delineamento experimental inteiramente casualizado, com quatro repetições por tratamento. As sementes de peneira 4 apresentaram menores pesos de 1000 sementes para todos os lotes, menores valores de germinação para o TGI, em todos os lotes, e para o TGII nos lotes II e IV. Para o vigor (primeira contagem do teste de germinação) observou-se menor valor para peneira 4, nos lotes I, II e IV; enquanto para a condutividade, a peneira 4 apresentou maior valor para todos os lotes, indicando pior qualidade fisiológica dessas sementes. Concluiu-se que a germinação e o vigor das sementes de milheto são influenciados pelo seu tamanho; sementes maiores são de melhor qualidade do que as menores.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Na produção de mudas de figueira a utilização de estacas apicais de menor comprimento pode facilitar o manejo no viveiro, entretanto ainda não foram definidos os protocolos para enraizamento desse tipo de estaca. O objetivo do presente trabalho foi avaliar a ação da estratificação à frio úmido e do tratamento com AIB na rizogênese de estacas apicais de figueira Roxo de Valinhos. As estacas foram coletadas da porção apical dos ramos no final do período hibernal (julho) e padronizadas com 20 cm de comprimento e diâmetro aproximado de 0,7 cm. As estacas foram estratificadas (estacas embrulhadas em jornal umedecido e protegidas com saco plástico à temperatura de 4 ºC, em câmara tipo BOD) por diferentes períodos (0, 15, 30, 45 e 60 dias) e, posteriormente, tratadas e não tratadas com 2.000 mg L-1 de AIB por 10 segundos. em seguida, as estacas foram enterradas em leito de areia umedecido sob telado constituído de tela de polipropileno preta (sombreamento de 50%). Passados 60 dias de cada período de estratificação, foram mensuradas a percentagem de estacas enraizadas, a percentagem de estacas brotadas e o número médio de brotações e de raízes por estaca. Conclue-se que as estacas apicais de figueira Roxo de Valinhos estratificadas a frio úmido por 30 dias e posteriormente tratadas com 2.000 mg L-1 de AIB apresentaram maior potencial de rizogênese.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The present work had as objective to apply an experimental planning aiming at to improve the efficiency of separation of a new type of mixer-settler applied to treat waste water contaminated with oil. An unity in scale of laboratory, was installed in the Post-graduation Program of Chemical Engineering of UFRN. It was constructed in partnership with Petrobras S.A. This called device Misturador-Decantador a Inversão de Fases (MDIF) , possess features of conventional mixer-settler and spray column type. The equipment is composed of three main parts: mixing chamber; chamber of decantation and chamber of separation. The efficiency of separation is evaluated analyzing the oil concentrations in water in the feed and the output of the device. For the analysis one used the gravimetric method of oil and greases analysis (TOG). The system in study is a water of formation emulsified with oil. The used extractant is a mixture of Turpentine spirit hydro-carbons, supplied for Petrobras. It was applied, for otimization of the efficiency of separation of the equipment, an experimental planning of the composite central type, having as factorial portion fractionary factorial planning 2 5-2, with the magnifying of the type star and five replications in the central point. In this work, the following independents variables were studied: contents of oil in the feed of the device; volumetric ratio (O/A); total flowrate ; agitation in the mixing chamber and height of the organic bed. Minimum and maximum limits for the studied variables had been fixed according previous works. The analysis of variance for the equation of the empirical model, revealed statistically significant and useful results for predictions ends. The variance analysis also presented the distribution of the error as a normal distribution and was observed that as the dispersions do not depend on the levels of the factors, the independence assumption can be verified. The variation around the average is explained by 98.98%, or either, equal to the maximum value, being the smoothing of the model in relation to the experimental points of 0,98981. The results present a strong interaction between the variable oil contents in the feed and agitation in the mixing chamber, having great and positive influence in the separation efficiency. Another variable that presented a great positive influence was the height of the organic bed. The best results of separation efficiency had been obtained for high flowrates when associates the high oil concentrations and high agitation. The results of the present work had shown excellent agreement with the results carried out through previous works with the mixer-settler of phase inversion

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Supported catalysts of CuCl2 on sílica were used in the methane oxychlorination reaction. The materials were synthesized by the ion exchange technique in a basic solution, using a copper-ammonia complex with 3 and 6 % of nominal copper loading. The materials where characterized by thermogravimetry (TG), X-ray Fluorescence Spectroscopy (XRF), Temperature Programmed Reduction (TPR), Scanning Electron Microscopy with X-ray microanalysis (SEM/EDS), BET specific area and pore distribution. The characterization confirms the presence of copper on the support surface, concluding that the ion exchange technique was adequate in the catalyst synthesis. For the reaction test, an oxychlorination bench scale unit was employed. The tests were carried at 673 and 773 K. The results showed the influence of temperature and catalyst copper content on the oxychlorination of methane reaction

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Innovative technologies using surfactant materials have applicability in several industrial fields, including petroleum and gas areas. This study seeks to investigate the use of a surfactant derived from coconut oil (SCO saponified coconut oil) in the recovery process of organic compounds that are present in oily effluents from petroleum industry. For this end, experiments were accomplished in a column of small dimension objectifying to verify the influence of the surfactant SCO in the efficiency of oil removal. This way, they were prepared emulsions with amount it fastens of oil (50, 100, 200 and 400 ppm), being determined the great concentrations of surfactant for each one of them. Some rehearsals were still accomplished with produced water of the industry of the petroleum to compare the result with the one of the emulsions. According to the experiments, it was verified that an increase of the surfactant concentration does not implicate in a greater oil removal. The separation process use gaseous bubbles formed when a gas stream pass a liquid column, when low surfactant concentrations are used, it occurs the coalescence of the dispersed oil droplets and their transport to the top of the column, forming a new continuous phase. Such surfactants lead to a gas-liquid interface saturation, depending on the used surfactant concentration, affecting the flotation process and influencing in the removal capacity of the oily dispersed phase. A porous plate filter, with pore size varying from 40 to 250 mm, was placed at the base of the column to allow a hydrodynamic stable operation. During the experimental procedures, the operating volume of phase liquid was held constant and the rate of air flow varied in each experiment. The resulting experimental of the study hydrodynamic demonstrated what the capturing of the oil was influenced by diameter of the bubbles and air flow. With the increase flow of 300 about to 900 cm3.min-1, occurred an increase in the removal of oil phase of 44% about to 66% and the removal kinetic of oil was defined as a reaction of 1° order

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This work targetet the caprine ice cream production added with probiotic bacteria Bifidobacterium animalis subsp. lactis. It is divided into two parts. In the first one, four caprine ice cream formulations were evaluated, in which it was used hydrogenated fat (F1 and F3) or fat substitute (F2 and F4) in two different flavors (F1 and F2, passion fruit, F3 and F4, guava). Statistical differences (p<0.05) were detected for their physical-chemical properties, mainly for total solids and fat, but no differences were observed for melting test results. When it went to sensory acceptance, all four ice cream formulations reached high acceptance indexes, mostly formulation F4, which was selected for further studies. In the second part, F4 formulation was prepared with the addition of probiotic bacteria Bifidobacterium animalis subsp. lactis. The growth kinetics was studied and it was observed that the cellular concentration peak was reached after four fermentation hours (10.14 log UFC/g). This time was selected for pre-fermentation procedure and posterior addition at ice cream syrup. In this part of the study, two experimental groups were evaluated: group G1, in which the probiotic addition occurred before the maturation step and group G2, which included a pre-fermentation step and probiotic addition after ice cream maturation. The physical-chemical properties of these two ice cream groups were similar, except for pH, which was higher for group G2 (p<0.05). G1 samples had superior melting rate (3.566 mL/min) and both groups presented microbiological and sanitary results in accordance to current Brazilian legislation. Also, G1 and G2 were considered sensory accepted due to their acceptance indexes higher than 70%. G1 and G2 sensory profiles were similar (p>0.05), and both ice cream samples exhibited high creaminess (6.76 to 6.91) and mouth melting sensation (6.53 to 6.67) scores, while low sandiness scores (0.85 to 0.86) were observed, positive characteristics for this kind of food product. During the first 24 hours after ice cream production, the population of B. animalis subsp. lactis decreased, reaching 7.15 e 6.92 log CFU/g for G1 and G2, respectively. Probiotic bacteria counts fluctuated in ice cream samples during the first 108 days at frozen storage, especially for G2 group. Decreased probiotic viability was observed for G1 samples during the first 35 days of frozen storage, mild variation between 35 and 63 days and stabilized counts were observed after this time. After 21 days at frozen storage, ice cream samples of G1 and G2 groups reached 1.2 x 109 and 1.3 x 109 CFU/portion, respectively. After 108 days under these storage conditions, the survival rate of B. animalis subsp. lactis was 94.26% and 81.10% for G1 and G2 samples, respectively. After simulation of gastroenteric conditions, G2 group reached 9.72 x 105 CFU/portion. Considering the current requirements of Brazilian legislation, which stipulates that functional foods must have minimum probiotic count between 108 and 109 CFU/portion and detectable probiotic bacteria after being submitted to gastroenteric conditions, it is concluded that the ice cream with the addition of Bifidobacterium animalis subsp. lactis made as shown in this work, can be considered as a dairy functional food

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Anthropic disturbances in watersheds, such as inappropriate building development, disorderly land occupation and unplanned land use, may strengthen the sediment yield and the inflow into the estuary, leading to siltation, changes in the reach channel conformation, and ecosystem/water quality problems. Faced with such context, this study aims to assess the applicability of SWAT model to estimate, even in a preliminary way, the sediment yield distribution along the Potengi River watershed, as well as its contribution to the estuary. Furthermore, an assessment of its erosion susceptibility was used for comparison. The susceptibility map was developed by overlaying rainfall erosivity, soil erodibility, the slope of the terrain and land cover. In order to overlap these maps, a multi-criteria analysis through AHP method was applied. The SWAT was run using a five year period (1997-2001), considering three different scenarios based on different sorts of human interference: a) agriculture; b) pasture; and c) no interference (background). Results were analyzed in terms of surface runoff, sediment yield and their propagation along each river section, so that it was possible to find that the regions in the extreme west of the watershed and in the downstream portions returned higher values of sediment yield, reaching respectively 2.8 e 5.1 ton/ha.year, whereas central areas, which were less susceptible, returned the lowest values, never more than 0.7 ton/ha.ano. It was also noticed that in the west sub-watersheds, where one can observe the headwaters, sediment yield was naturally forced by high declivity and weak soils. In another hand, results suggest that the eastern part would not contribute to the sediment inflow into the estuary in a significant way, and the larger part of the sediment yield in that place is due to anthropic activities. For the central region, the analysis of sediment propagation indicates deposition predominance in opposition to transport. Thus, it s not expected that isolated rain storms occurring in the upstream river portions would significantly provide the estuary with sediment. Because the model calibration process hasn t been done yet, it becomes essential to emphasize that values presented here as results should not be applied for pratical aims. Even so, this work warns about the risks of a growth in the alteration of natural land cover, mainly in areas closer to the headwaters and in the downstream Potengi River

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fauna of Brazilian reef fishes comprises approximately 320 species distributed along the coast of the mainland and islands ocean. Little is known about the levels of connectivity between their populations, but has been given the interest in the relations between the offshore and the islands of the Brazil, in a biogeographical perspective. The oceanic islands Brazilian hosting a considerable number of endemic species, which are locally abundant, and divide a substantial portion of its reef fish fauna with the Western Atlantic. Among the richest families of reef fish in species are Pomacentridae. This study analyzed through analysis of sequences of the mitochondrial DNA control region (D-loop), the standards-breeding population of C. Multilineata in different areas of the NE coast of Brazil, involving both oceanic islands (Fernando de Noronha Archipelago and of St. Peter and St. Paul) and continental shelf (RN and BA). To this aim, partial sequences were used in the region HVR1 of mtDNA (312pb). The population structure and parameters for the estimates of genetic variability, molecular variance (AMOVA), estimation of the index for fixing (FST) and number of migrants were determined. The phylogenetic relationships between the populations were estimated using neighbor-joining (NJ) method. A group of Bayesian analysis was used to verify population structure, according to haplotype frequency of each individual. The genetic variability of populations was extremely high. The populations sampled show moderate genetic structure, with a higher degree of genetic divergence being observed for the sample of the Archipelago of St. Peter and St. Paul. At smaller geographical scale, the sample of Rio Grande do Norte and the Archipelago of Fernando de Noronha do not have genetic differentiation. Three moderately differentiated population groups were identified: a population group (I), formed by the Rio Grande do Norte (I') and the archipelago of Fernando de Noronha (I''), and two other different groups formed by the island population of the archipelago of Saint Peter and St. Paul (II) and Bahia (III). The genetic patterns found suggest that the species has suffered a relatively recent radiation favoring the absence of shared haplotypes. C. multilineata seems to constitute a relatively homogenous population along the West Atlantic coast, with evidence of a moderate population genetic structure in relation to the Archipelago of St. Peter and St. Paul. These data supports the importance of the dispersal larvae by marine current and the interpopulation similarity this species.