971 resultados para conical whirl instability
Resumo:
Numerical methods are used to simulate the double-diffusion driven convective pore-fluid flow and rock alteration in three-dimensional fluid-saturated geological fault zones. The double diffusion is caused by a combination of both the positive upward temperature gradient and the positive downward salinity concentration gradient within a three-dimensional fluid-saturated geological fault zone, which is assumed to be more permeable than its surrounding rocks. In order to ensure the physical meaningfulness of the obtained numerical solutions, the numerical method used in this study is validated by a benchmark problem, for which the analytical solution to the critical Rayleigh number of the system is available. The theoretical value of the critical Rayleigh number of a three-dimensional fluid-saturated geological fault zone system can be used to judge whether or not the double-diffusion driven convective pore-fluid flow can take place within the system. After the possibility of triggering the double-diffusion driven convective pore-fluid flow is theoretically validated for the numerical model of a three-dimensional fluid-saturated geological fault zone system, the corresponding numerical solutions for the convective flow and temperature are directly coupled with a geochemical system. Through the numerical simulation of the coupled system between the convective fluid flow, heat transfer, mass transport and chemical reactions, we have investigated the effect of the double-diffusion driven convective pore-fluid flow on the rock alteration, which is the direct consequence of mineral redistribution due to its dissolution, transportation and precipitation, within the three-dimensional fluid-saturated geological fault zone system. (c) 2005 Elsevier B.V. All rights reserved.
Resumo:
PHWAT is a new model that couples a geochemical reaction model (PHREEQC-2) with a density-dependent groundwater flow and solute transport model (SEAWAT) using the split-operator approach. PHWAT was developed to simulate multi-component reactive transport in variable density groundwater flow. Fluid density in PHWAT depends not on only the concentration of a single species as in SEAWAT, but also the concentrations of other dissolved chemicals that can be subject to reactive processes. Simulation results of PHWAT and PHREEQC-2 were compared in their predictions of effluent concentration from a column experiment. Both models produced identical results, showing that PHWAT has correctly coupled the sub-packages. PHWAT was then applied to the simulation of a tank experiment in which seawater intrusion was accompanied by cation exchange. The density dependence of the intrusion and the snow-plough effect in the breakthrough curves were reflected in the model simulations, which were in good agreement with the measured breakthrough data. Comparison simulations that, in turn, excluded density effects and reactions allowed us to quantify the marked effect of ignoring these processes. Next, we explored numerical issues involved in the practical application of PHWAT using the example of a dense plume flowing into a tank containing fresh water. It was shown that PHWAT could model physically unstable flow and that numerical instabilities were suppressed. Physical instability developed in the model in accordance with the increase of the modified Rayleigh number for density-dependent flow, in agreement with previous research. (c) 2004 Elsevier Ltd. All rights reserved.
Resumo:
The scale insect genus Calycicoccus Brain has a single described species, C. merwei Brain, which is endemic to southeastern South Africa. Females of C. merwei induce small, mostly conical galls on the foliage of their host tree, Apodytes dimidiata E. Meyer ex Arn. (Icacinaceae), which has a wider, mostly coastal distribution, than that currently known for the scale insect. Calycicoccus has been placed in the family Eriococcidae and may be related to the South American genus Aculeococcus Lepage. No other native eriococcid species have been described so far in South Africa, although the family is diverse in other Gondwanan regions. This paper summarizes the biology of C. merwei, redescribes the adult female, describes the adult male, the second-instar female and the first-instar nymphs for the first time, and reconsiders the phylogenetic relationships of the genus. The adult female is shown to have unusual abdominal segmentation, in that segment I is present both dorsally and ventrally, but a segment is absent ventrally on the middle abdomen. First-instar nymphs are sexually dimorphic; males have a larger and relatively narrower body, larger mouthparts, longer antennae and legs, and more thoracic dorsal setae compared with females. Molecular data from nuclear small-subunit ribosomal DNA (18S) and elongation factor 1 alpha (EF-1a) show C. merwei to have no close relatives among the Eriococcidae sampled to date. Instead, the Calycicoccus lineage is part of a polytomy near the base of the Eriococcidae. Molecular dating of the node suggests that the Calycicoccus lineage diverged from other eriococcids more than 100 Mya. These data support the placement of Calycicoccus as the only genus in the subfamily Calycicoccinae Brain.
Resumo:
Study Design. A clinical study was conducted on 39 patients with acute, first-episode, unilateral low back pain and unilateral, segmental inhibition of the multifidus muscle. Patients were allocated randomly to a control or treatment group. Objectives. To document the natural course of lumbar multifidus recovery and to evaluate the effectiveness of specific, localized, exercise therapy on muscle recovery. Summary of Background Data. Acute low back pain usually resolves spontaneously, but the recurrence rate is high. Inhibition of multifidus occurs with acute, first-episode, low back pain, and pathologic changes in this muscle have been linked with poor outcome and recurrence of symptoms. Methods. Patients in group 1 received medical treatment only. Patients in group 2 received medical treatment and specific, localized, exercise therapy. Outcome measures for both groups included 4 weekly assessments of pain, disability, range of motion, and size of the multifidus cross-sectional area. Independent examiners were blinded to group allocation. Patients were reassessed at a 10-week follow-up examination. Results. Multifidus muscle recovery was not spontaneous on remission of painful symptoms in patients in group 1. Muscle recovery was more rapid and more complete in patients in group 2 who received exercise therapy (P = 0.0001). Other outcome measurements were similar for the two groups at the 4-week examination. Although they resumed normal levels of activity, patients in group 1 still had decreased multifidus muscle size at the 10-week follow-up examination. Conclusions. Multifidus muscle recovery is not spontaneous on remission of painful symptoms. Lack of localized, muscle support may be one reason for the high recurrence rate of low back pain following the initial episode.
Resumo:
Background and objectives: Cardiac positioning and stabilization during myocardial revascularization without extracorporeal circulation (ECC) may cause hemodynamic changes dependent to the surgical site. The objective of this study was to evaluate these changes during distal coronary anastomosis. Methods: Twenty adult patients undergoing myocardial revascularization without ECC were monitored by pulmonary artery catheter and transesophageal Echo Doppler. Hemodynamic data were collected at the following times before removing the stabilizer wall: (1) after volume adjustments, (2) at the beginning of distal anastomosis, and (3) after 5 minutes. Treated coronary arteries were grouped according to their location in the lateral, anterior, or posterior wall. Two-way ANOVA with repetition and Newman-Keuls post-test were used in the analysis. A p value < 0.05 was considered statically significant. Results: During myocardial revascularization without ECC, pulmonary artery wedge pressure showed elevation from 17.7 +/- 6.1 to 19.2 +/- 6.5 (p < 0.001) and 19.4 +/- 5.9 mmHg (p < 0.001), while the central venous pressure went from 13.9 +/- 5.4 to 14.9 +/- 5.9 mmHg (p = 0.007) and 15.1 +/- 6.0 mmHg (p = 0.006). Intermittent cardiac output was reduced from 4.70 +/- 1.43 to 4.23 +/- 1.22 (p < 0.001) and 4.26 +/- 1.25 L.min(-1) (p < 0.001). According to transesophageal Doppler, a significant group-time interaction was observed in cardiac output, which was reduced in the lateral group from 4.08 +/- 1.99 to 2.84 +/- 1.82 (p = 0.02) and 2.86 +/- 1.73 L.min(-1) (p = 0.02), and aortic blood flow, which went from 2.85 +/- 1.39 to 1.99 +/- 1.26 (p = 0.02) and 2.00 +/- 1.21 L.min(-1) (p = 0.02). Other hemodynamic changes were not observed during anastomoses. Conclusions: A significant hemodynamic deterioration was observed during myocardial revascularization without ECC. Transesophageal Doppler detected a decrease in cardiac output only in the lateral group.
Resumo:
Introduction: The relevance of prostate size in the pathophysiology of lower urinary tract symptoms (LUTS) is controversial. We evaluated the urodynamic findings in patients with LUTS and small prostate volumes. Materials and Methods: 84 patients aged >= 50 years with LUTS and prostates < 40 ml were evaluated. All had an International Prostate Symptom Score (IPSS) >= 8. Average age was 62.0 +/- 8.1 years. We evaluated the impact of bladder outlet obstruction (BOO) and detrusor overactivity (DO) on the voiding symptoms and urodynamic findings. Results: Mean prostate volume was 29.2 +/- 7.2 ml and mean IPSS was 13.5 +/- 4.6. BOO was the main finding, affecting 42 (50.0%) patients, followed by detrusor underactivity (DU) in 41 (48.8%) and DO in 28 (33.3%) patients. Patients without BOO were significantly older than the obstructed (64.0 +/- 8.8 and 60.1 +/- 6.9 years, respectively; p = 0.026) and had an increased prevalence of DU (76.2 and 21.4%, respectively; p < 0.001). Comparison of patients with and without DO showed reduced bladder capacity and compliance in the DO group (p < 0.001). No other comparisons were significant. Conclusion: Half of the patients with LUTS and small prostates are not obstructed and may have DO or decreased detrusor contractility as the basis for their voiding symptoms. Our results emphasize the value of urodynamics in this population, especially when invasive treatments are being considered. Copyright (c) 2008 S. Karger AG, Basel.
Resumo:
Aims: To report the conclusion of the Think Thank 8 on Compliance Discussions during the second ICI-RS meeting in 2010. Methods: During a 3-day meeting a group of specialists discussed bladder compliance, what it represents, how it can be measured and if it is clinically relevant. Results: Bladder compliance is the result of a mathematical calculation of the volume required for a unit rise of pressure measured during a cystometric filling. It gives an indication on how the different mechanisms in the bladder wall react on stretching. There is a need of standardization of measurement and suggestions for this are given in the text. Pitfalls are described and how to avoid them. There is a wide range of compliance values in healthy volunteers and groups of patients. Poor compliance needs to be defined better as it can have significant clinical consequences. Prevention and treatment are discussed. Conclusion: If compliance is correctly measured and interpreted, it has importance in urodynamic testing and gives information relevant for clinical management. Neurourol. Urodynam. 30:714-722, 2011. (C) 2011 Wiley-Liss, Inc.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
Magneto-transport measurements of the 2D hole system (2DHS) in p-type Si-Si1-xGex heterostructures identify the integer quantum Hall effect (IQHE) at dominantly odd-integer filling factors v and two low-temperature insulating phases (IPs) at v = 1.5 and v less than or similar to 0.5, with re-entrance to the quantum Hall effect at v = 1. The temperature dependence, current-voltage characteristics, and tilted field and illumination responses of the IP at v = 1.5 indicate that the important physics is associated with an energy degeneracy of adjacent Landau levels of opposite spin, which provides a basis for consideration of an intrinsic, many-body origin.
Resumo:
A traveling wave of BaSO4 in the chlorite-thiourea reaction has shown concentric precipitation patterns upon being triggered by the autocatalyst HOCl. The precipitation patterns show circular rings of alternate null and full precipitation regions. This self-organization appears to be the result of the formation of a convective torus. The formation of the convective torus can be described as a Benard-Marangoni instability with lateral heating.
Resumo:
DsbA, a 21-kDa protein from Escherichia coli, is a potent oxidizing disulfide catalyst required for disulfide bond formation in secreted proteins. The active site of DsbA is similar to that of mammalian protein disulfide isomerases, and includes a reversible disulfide bond formed from cysteines separated by two residues (Cys3O-Pro31-His32-Cys33). Unlike most protein disulfides, the active-site disulfide of DsbA is highly reactive and the oxidized form of DsbA is much less stable than the reduced form at physiological pH. His32, one of the two residues between the active-site cysteines, is critical to the oxidizing power of DsbA and to the relative instability of the protein in the oxidized form. Mutation of this single residue to tyrosine, serine, or leucine results in a significant increase in stability (of similar to 5-7 kcal/mol) of the oxidized His32 variants relative to the oxidized wild-type protein. Despite the dramatic changes in stability, the structures of all three oxidized DsbA His32 Variants are very similar to the wild-type oxidized structure, including conservation of solvent atoms near the active-site residue, Cys3O. These results show that the His32 residue does not exert a conformational effect on the structure of DsbA. The destabilizing effect of His32 on oxidized DsbA is therefore most likely electrostatic in nature.
Resumo:
The popular Newmark algorithm, used for implicit direct integration of structural dynamics, is extended by means of a nodal partition to permit use of different timesteps in different regions of a structural model. The algorithm developed has as a special case an explicit-explicit subcycling algorithm previously reported by Belytschko, Yen and Mullen. That algorithm has been shown, in the absence of damping or other energy dissipation, to exhibit instability over narrow timestep ranges that become narrower as the number of degrees of freedom increases, making them unlikely to be encountered in practice. The present algorithm avoids such instabilities in the case of a one to two timestep ratio (two subcycles), achieving unconditional stability in an exponential sense for a linear problem. However, with three or more subcycles, the trapezoidal rule exhibits stability that becomes conditional, falling towards that of the central difference method as the number of subcycles increases. Instabilities over narrow timestep ranges, that become narrower as the model size increases, also appear with three or more subcycles. However by moving the partition between timesteps one row of elements into the region suitable for integration with the larger timestep these the unstable timestep ranges become extremely narrow, even in simple systems with a few degrees of freedom. As well, accuracy is improved. Use of a version of the Newmark algorithm that dissipates high frequencies minimises or eliminates these narrow bands of instability. Viscous damping is also shown to remove these instabilities, at the expense of having more effect on the low frequency response.
Resumo:
Background Basal cell carcinomas (BCCs) are the most frequent human cancer that results from malignant transformation of basal cells in the epidermis. Gorlin syndrome is a rare inherited autosomal dominant disease that predisposes with multiple BCCs and other birth defects. Both sporadic and inherited BCCs are associated with mutations in the tumor suppressor gene PTCH1, but there is still uncertainty on the role of its homolog PTCH2. Objectives To search for mutations and genomic instability in sporadic and inherited BCCs. Methods DNA obtained from leukocytes and tumor cells was amplified by polymerase chain reaction regarding five exons of PTCH1 and PTCH2 and neighboring microsatellites. Exons were sequenced and compared with the GenBank database. Results Only D9S180, of six microsatellites, showed loss of heterozygosity in three BCCs (two sporadic and one inherited). One sporadic BCC presented the mutation g. 2885G>C in exon 17 of PTCH1, which predicts the substitution p.R962T in an external domain of the protein. In addition, the leukocytes and tumor cells of one patient with Gorlin syndrome showed the mutation g. 2839T>G in the same exon and gene, which predicts a p.E947stop and truncated protein. All control and tumor samples presented IVS9 + 217T in intron 9 of PTCH1. Conclusion Mutations found in the PTCH1 gene and neighboring repetitive sequences may have contributed to the development of the studied BCCs.
Resumo:
Morbid obesity is highly prevalent in the Western World, and its consequences present a real public health challenge. Voice alterations can represent one of these consequences and represent an opportunity for interference with therapeutic methods. This particularly features of the individual`s voice was the goal of the present study. A group of 45 adult volunteers of both sexes with a BMI greater than 35 Kg/m(2) was selected among patients of the Obesity Ambulatory of the Digestive Surgery Division. The control group consisted of volunteers matched by sex, age (+/- 1 year), and smoking habits, but with a BMI bellow 30 Kg/m(2). All subjects were submitted to laryngoscopic examination, audio perceptive analysis, and voice acoustics determination. Examinations were always performed by the same doctor, and diagnoses were provided by two different physician specialists in laryngology and voice. Obese individuals exhibit the following modifications in voice feature: hoarseness, murmuring, vocal instability, altered jitter and shimmer, and reduced maximum phonation times as well the presence of voice strangulation at the end of emission. The voices of individuals with morbid obesity are different of the voice of nonobese people and demonstrate significant changes in vocal characteristics.
Resumo:
Purpose: To evaluate the effects of oral azithromycin in patients with posterior blepharitis. Methods: Twenty-six eyes of 13 patients with posterior blepharitis diagnosed by a qualified ophthalmologist were enrolled in this study. Patients were instructed to use oral azithromycin 500 mg per day for 3 days in 3 cycles with 7-day intervals. Subjective clinical outcomes were graded and scored 1 day before and 30 days after the end of the treatment (53 days after initiating the treatment) based on severity scores of: (1) eyelid debris; (2) eyelid telangiectasia; (3) swelling of the eyelid margin; (4) redness of the eyelid margin; and (5) ocular mucus secretion. For the assessment of global efficacy, patients were asked by the investigator to rate the subjective symptoms (eyelid itching, ocular itching, eyelid hyperemia, ocular hyperemia, ocular mucus secretion, photophobia, foreign body sensation, and dry eye sensation) on a scale of 0 (no symptoms) to 5 (severe symptoms). Break-up time, Schirmer I test, corneal fluorescein staining score, and rose bengal staining score were also performed in all patients. Results: All clinical outcomes scoring showed statistically significant improvement after oral azithromycin, except for eyelid swelling. Average subjective symptom grading improved statistically after treatment with oral azithromycin, except for eyelid hyperemia, photophobia, and foreign body sensation. Average tear film break-up time values showed statistically significant improvement after the treatment with oral azithromycin. No statistically significant improvement was observed on average values of Schirmer I test, corneal fluorescein staining score, and rose bengal staining score. Conclusions: The combination of multiple clinical parameters shown in this study supports the clinical efficacy of pulsed oral azithromycin therapy for the management of posterior blepharitis.