1000 resultados para Test ADSH


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Selostus: Suomen maaperän fosforin tutkiminen 1900-luvulla ja viljavuustutkimuksen kehittäminen

Relevância:

20.00% 20.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A new paint testing device was built to determine the resistance of paints to darkening due to road grime being tracked onto them. The device consists of a tire rotating on a sample drum. Soil was applied to the tire and then tracked onto paint samples which were attached to the drum. A colorimeter was used to measure the lightness of the paints after being tracked. Lightness is measured from 0 (absolute black) to 100 (absolute white). Four experiments were run to determine the optimum time length to track a sample, the reproducibility, the effects of different soils, and the maximum acceptable level for darkening of a paint. The following conclusions were reached: 1) the optimum tracking time was 10 minutes; 2) the reproducibility had a standard deviation of 1.5 lightness units; 3) different soils did not have a large effect on the amount of darkening on the paints; 4) a maximum acceptable darkness could not be established based on the limited amount of data; and 5) a correlation exists between the paints which were darkening in the field and the paints which were turning the darkest on the tracking wheel.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Research Project HR-124, "Development of a Laboratory Durability Test for Asphalts," was initiated in 1966 as a long-range comprehensive program. Its ultimate objective was to develop a simple, rapid laboratory test that could be used by highway engineers to select paving asphalt according to quality, to identify inferior asphalts, and to reasonably predict the useful life of asphalts once they were incorporated in the pavements.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Aim To evaluate the effects of using distinct alternative sets of climatic predictor variables on the performance, spatial predictions and future projections of species distribution models (SDMs) for rare plants in an arid environment. . Location Atacama and Peruvian Deserts, South America (18º30'S - 31º30'S, 0 - 3 000 m) Methods We modelled the present and future potential distributions of 13 species of Heliotropium sect. Cochranea, a plant group with a centre of diversity in the Atacama Desert. We developed and applied a sequential procedure, starting from climate monthly variables, to derive six alternative sets of climatic predictor variables. We used them to fit models with eight modelling techniques within an ensemble forecasting framework, and derived climate change projections for each of them. We evaluated the effects of using these alternative sets of predictor variables on performance, spatial predictions and projections of SDMs using Generalised Linear Mixed Models (GLMM). Results The use of distinct sets of climatic predictor variables did not have a significant effect on overall metrics of model performance, but had significant effects on present and future spatial predictions. Main conclusion Using different sets of climatic predictors can yield the same model fits but different spatial predictions of current and future species distributions. This represents a new form of uncertainty in model-based estimates of extinction risk that may need to be better acknowledged and quantified in future SDM studies.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Introduction: One of the main goals for exereise testing in children is evaluation of exercise capacity. There are many testing protocols, but the Bruce treadmill protocol is widely used among pediatrie cardiology centers. Thirty years ago, Cuming et al. were the first to establish normal values for children from North America (Canada) aged 4 to 18 years old. No data was ever published for children from Western Europe. Our study aimed to assess the validity of the normal values from Cuming et al. for children from Western Europe in the 21 st century. Methods: It is a retrospective cohort study in a tertiary care children's hospital. 144 children referred to our institution but finally diagnosed as having a normal heart underwent exercise stress testing using the Bruce protocol between 1999 and 2006. Data from 59 girls and 85 boys aged 6 to 18 were reviewed. Mean endurance time (ET) for each age category and gender was compared with the mean normal values fram Cumming et al by an unpaired t-test. Results: Mean ET increases with age until 15 years old in girls and then decreases. Mean endurance time increases continuouslY'from 6 to 18 years old in boys. The increase is more pronounced in boys than girls. In our study, a significant higher mean ET was found for boys in age categories 10 to 12, 13 to 15 and 16 to 18. No significant difference was found in any other groups. Conclusions: Some normal values from Cuming et al. established in 1978 for ET with the Bruce protocol are probably not appropriate any more today for children from Western Europe. Our study showed that mean ET is higher for boys from 10 to 18 years old. Despite common beliefs, cardiovascular conditioning doesn't seem yet reduced in children from Western Europe. New data for Bruce treadmill exercise. testing for healthy children, 4 to 18 years old, living in Western Europe are required. .

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Les Arenavirus sont une famille de virus à ARN très diversifiée avec plus de 23 espèces recensées dans le monde, divisées en deux Clades majeures (Emonet et al., 2009). Ils sont classifiés en Arenavirus du Nouveau Monde versus de l'Ancien Monde (Buchmeier, de la Torre, and Peters, 2007) (Fig. 1). Parmi les Arenavirus, sept sont connus pour être les agents causales de fièvres hémorragiques foudroyantes : Les virus Lassa, Junin, Machupo, Guanarito, Sabia, Chapare et Lujo. Les Arenavirus infectent, de façon spécifique, des espèces de rongeurs qui sont le réservoir naturel déterminant ainsi leur distribution géographique (Clegg, 2002). On retrouve le virus de la chorioméningite lymphocytaire (LCMV) à la fois en Europe et aux Amériques. Le rongeur infecté est le vecteur de transmission à l'Homme. Les maladies associées aux infections par les Arenavirus hémorragiques ont un haut taux de mortalité allant de 15 à 30% et sont à haut risque épidémiologique en raison de l'absence de vaccin et de traitement efficace. Pour ces raisons, ces Arenavirus sont classifiés comme pathogènes à haut risque par le centre pour le contrôle des maladies (CDC) (Borio et al., 2002).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Arterial Spin Labeling (ASL) is a method to measure perfusion using magnetically labeled blood water as an endogenous tracer. Being fully non-invasive, this technique is attractive for longitudinal studies of cerebral blood flow in healthy and diseased individuals, or as a surrogate marker of metabolism. So far, ASL has been restricted mostly to specialist centers due to a generally low SNR of the method and potential issues with user-dependent analysis needed to obtain quantitative measurement of cerebral blood flow (CBF). Here, we evaluated a particular implementation of ASL (called Quantitative STAR labeling of Arterial Regions or QUASAR), a method providing user independent quantification of CBF in a large test-retest study across sites from around the world, dubbed "The QUASAR reproducibility study". Altogether, 28 sites located in Asia, Europe and North America participated and a total of 284 healthy volunteers were scanned. Minimal operator dependence was assured by using an automatic planning tool and its accuracy and potential usefulness in multi-center trials was evaluated as well. Accurate repositioning between sessions was achieved with the automatic planning tool showing mean displacements of 1.87+/-0.95 mm and rotations of 1.56+/-0.66 degrees . Mean gray matter CBF was 47.4+/-7.5 [ml/100 g/min] with a between-subject standard variation SD(b)=5.5 [ml/100 g/min] and a within-subject standard deviation SD(w)=4.7 [ml/100 g/min]. The corresponding repeatability was 13.0 [ml/100 g/min] and was found to be within the range of previous studies.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Due to the low workability of slipform concrete mixtures, the science of rheology is not strictly applicable for such concrete. However, the concept of rheological behavior may still be considered useful. A novel workability test method (Vibrating Kelly Ball or VKelly test) that would quantitatively assess the responsiveness of a dry concrete mixture to vibration, as is desired of a mixture suitable for slipform paving, was developed and evaluated. The objectives of this test method are for it to be cost-effective, portable, and repeatable while reporting the suitability of a mixture for use in slipform paving. The work to evaluate and refine the test was conducted in three phases: 1. Assess whether the VKelly test can signal variations in laboratory mixtures with a range of materials and proportions 2. Run the VKelly test in the field at a number of construction sites 3. Validate the VKelly test results using the Box Test developed at Oklahoma State University for slipform paving concrete The data collected to date indicate that the VKelly test appears to be suitable for assessing a mixture’s response to vibration (workability) with a low multiple operator variability. A unique parameter, VKelly Index, is introduced and defined that seems to indicate that a mixture is suitable for slipform paving when it falls in the range of 0.8 to 1.2 in./√s.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

BACKGROUND: Patient behavior accounts for half or more of the variance in health, disease, mortality and treatment outcome and costs. Counseling using motivational interviewing (MI) effectively improves the substance use and medical compliance behavior of patients. Medical training should include substantial focus on this key issue of health promotion. The objective of the study is to test the efficacy of teaching MI to medical students. METHODS: Thirteen fourth-year medical students volunteered to participate. Seven days before and after an 8-hour interactive MI training workshop, each student performed a video-recorded interview with two standardized patients: a 60 year-old alcohol dependent female consulting a primary care physician for the first time about fatigue and depression symptoms; and a 50 year-old male cigarette smoker hospitalized for myocardial infarction. All 52 videos (13 students×2 interviews before and after training) were independently coded by two blinded clinicians using the Motivational Interviewing Training Integrity (MITI, 3.0). MITI scores consist of global spirit (Evocation, Collaboration, Autonomy/Support), global Empathy and Direction, and behavior count summary scores (% Open questions, Reflection to question ratio, % Complex reflections, % MI-adherent behaviors). A "beginning proficiency" threshold (BPT) is defined for each of these 9 scores. The proportion of students reaching BPT before and after training was compared using McNemar exact tests. Inter-rater reliability was evaluated by comparing double coding, and test-retest analyses were conducted on a sub-sample of 10 consecutive interviews by each coder. Weighted Kappas were used for global rating scales and intra-class correlations (ICC) were computed for behavior count summary scores. RESULTS: The percent of counselors reaching BPT before and after MI training increased significantly for Evocation (15% to 65%, p<.001), Collaboration (27% to 77%, p=.001), Autonomy/Support (15% to 54%, p=.006), and % Open questions (4% to 38%, p=.004). Proportions increased, but were not statistically significant for Empathy (38% to 58%, p=.18), Reflection to question ratio (0% to 15%, p=.12), % Complex reflection (35% to 54%, p=.23), and % MI-adherent behaviors (8% to 15%, p=.69). There was virtually no change for the Direction scale (92% to 88%, p=1.00). The reliability analyses produced mixed results. Weighted kappas for inter-rater reliability ranged from .14 for Direction to .51 for Collaboration, and from .27 for Direction to .80 for Empathy for test-retest. ICCs ranged from .20 for Complex reflections to .89 for Open questions (inter-rater), and from .67 for Complex reflections to .99 for Reflection to question ratio (test-retest). CONCLUSION: This pilot study indicates that a single 8-hour training in motivational interviewing for voluntary fourth-year medical students results in significant improvement of some MI skills. A larger sample of randomly selected medical students observed over longer periods should be studied to test if MI training generalizes to medical students. Inter-rater reliability and test-retest findings indicate a need for caution when interpreting the present results, as well as for more intensive training to help appropriately capture more dimensions of the process in future studies.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The stability of air bubbles in fresh concrete can have a profound influence of the potential durability of the system, because excessive losses during placement and consolidation can compromise the ability of the mixture to resist freezing and thawing. The stability of air void systems developed by some air entraining admixtures (AEAs) could be affected by the presence of some polycarboxylate-based water reducing admixtures (WRAs). The foam drainage test provides a means of measuring the potential stability of air bubbles in a paste. A barrier to acceptance of the test was that there was little investigation of the correlation with field performance. The work reported here was a limited exercise seeking to observe the stability of a range of currently available AEA/WRA combinations in the foam drainage test; then, to take the best and the worst and observe their stabilities on concrete mixtures in the lab. Based on the data collected, the foam drainage test appears to identify stable combinations of AEA and WRA.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Concrete durability may be considered as the ability to maintain serviceability over the design life without significant deterioration, and is generally a direct function of the mixture permeability. Therefore, reducing permeability will improve the potential durability of a given mixture and, in turn, improve the serviceability and longevity of the structure. Given the importance of this property, engineers often look for methods that can decrease permeability. One approach is to add chemical compounds known as integral waterproofing admixtures or permeability-reducing admixtures, which help fill and block capillary pores in the paste. Currently, there are no standard approaches to evaluate the effectiveness of permeability-reducing admixtures or to compare different products in the US. A review of manufacturers’ data sheets shows that a wide range of test methods have been used, and rarely are the same tests used on more than one product. This study investigated the fresh and hardened properties of mixtures containing commercially available hydrophilic and hydrophobic types of permeability-reducing admixtures. The aim was to develop a standard test protocol that would help owners, engineers, and specifiers compare different products and to evaluate their effects on concrete mixtures that may be exposed to hydrostatic or non-hydrostatic pressure. In this experimental program, 11 concrete mixtures were prepared with a fixed water-to-cement ratio and cement content. One plain mixture was prepared as a reference, 5 mixtures were prepared using the recommended dosage of the different permeability-reducing admixtures, and 5 mixtures were prepared using double the recommended dosage. Slump, air content, setting time, compressive and flexural strength, shrinkage, and durability indicating tests including electrical resistivity, rapid chloride penetration, air permeability, permeable voids, and sorptivity tests were conducted at various ages. The data are presented and recommendations for a testing protocol are provided.