Relation of Aortic Valve Calcium Detected by Cardiac Computed Tomography to All-Cause Mortality

Aortic valve calcium (AVC) can be quantified on the same computed tomographic scan as coronary artery calcium (CAC). Although CAC is an established predictor of cardiovascular events, limited evidence is available for an independent predictive value for AVC. We studied a cohort of 8,401 asymptomatic subjects (mean age 53 10 years, 69% men), who were free of known coronary heart disease and were undergoing electron beam computed tomography for assessment of subclinical atherosclerosis. The patients were followed for a median of 5 years (range 1 to 7) for the occurrence of mortality from any cause. Multivariate Cox regression models were developed to predict all-cause mortality according to the presence of AVC. A total of 517 patients (6%) had AVC on electron beam computed tomography. During follow-up, 124 patients died (1.5%), for an overall survival rate of 96.1% and 98.7% for those with and without AVC, respectively (hazard ratio 3.39, 95% confidence interval 2.09 to 5.49). After adjustment for age, gender, hypertension, dyslipidemia, diabetes mellitus, smoking, and a family history of premature coronary heart disease, AVC remained a significant predictor of mortality (hazard ratio 1.82, 95% confidence interval 1.11 to 2.98). Likelihood ratio chi-square statistics demonstrated that the addition of AVC contributed significantly to the prediction of mortality in a model adjusted for traditional risk factors (chi-square = 5.03, p = 0.03) as well as traditional risk factors plus the presence of CAC (chi-square = 3.58, p = 0.05). In conclusion, AVC was associated with increased all-cause mortality, independent of the traditional risk factors and the presence of CAC. (C) 2010 Published by Elsevier Inc. (Am J Cardiol 2010;106:1787-1791)

Use of a Minimally Invasive Uncalibrated Cardiac Output Monitor in Patients Undergoing Cesarean Section under Spinal Anesthesia: Report of Four Cases

Bliacheriene F, Carmona MJC, Barretti CFM, Haddad CMF, Mouchalwat ES, Bortlotto MRFL, Francisco RPV, Zugaib M - Use of a Minimally Invasive Uncalibrated Cardiac Output Monitor in Patients Undergoing Cesarean Section under Spinal Anesthesia: Report of Four Cases. Background and Objectives: Hemodynamic changes are observed during cesarean section under spinal anesthesia. Non-invasive blood pressure (BP) and heart rate (HR) measurements are performed to diagnose these changes, but they are delayed and inaccurate. Other monitors such as filling pressure and cardiac output (CO) catheters with external calibration are very invasive or inaccurate. The objective of the present study was to report the cardiac output measurements obtained with a minimally invasive uncalibrated monitor (LiDCO rapid) in patients undergoing cesarean section under spinal anesthesia. Case report: After approval by the Ethics Commission, four patients agreed to participate in this study. They underwent cesarean section under spinal anesthesia while at the same time being connected to the LiDCO rapid by a radial artery line. Cardiac output, HR, and BP were recorded at baseline, after spinal anesthesia, after fetal and placental extraction, and after the infusion of oxytocin and metaraminol. We observed a fall in BP with an increase of HR and CO after spinal anesthesia and oxytocin infusion; and an increase in BP with a fall in HR and CO after bolus of the vasopressor. Conclusions: Although this monitor had not been calibrated, it showed a tendency for consistent hemodynamic data in obstetric patients and it may be used as a therapeutic guide or experimental tool.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Pollymorphisms in the CBS Gene and Homocysteine, Folate and Vitamin B(12) Levels: Association With Polymorphisms in the MTHFR and MTRR Genes in Brazilian Children

Polymorphisms in the methylenetetrahydrofolate reductase (MTHFR), methionine synthase reductase (MTRR) and cystathionine P-synthase (CBS) genes, involved in the intracellular metabolism of homocysteine (Hcy), can result in hyperhomocysteinemia. The objective of this study was to evaluate prevalence estimates of CBS T833C, G919A and the insertion of 68-bp (844ins68) polymorphisms and their correlation with Hcy, folate and 131, in 220 children previously genotyped for MTHFR C677T, A1298C, and MTRR A66G. The prevalence of heterozygote children for 844ins68 was 19.5%. The T833C CBS mutation was identified in association with 844ins68 in all the carriers of the insertion. Genotyping for CBS G919A mutation showed that all the children presented the GG genotype. Analysis of Hcy, B(12) and folate, according to the combination of the different genotypes of the C677T and A1298C MTHFR, A66G MTRR, and 844ins68 CBS showed that the 677TT/1298AA/68WW genotype is associated with an increase in Hcy, when compared to the 677CC/1298AC/68WW (P = 0.033) and the 677CT/1298AA/68WW genotypes (P = 0.034). Since B(12) and folate were not different between these groups, a genetic interaction between diverse polymorphisms probably influences Hcy. Our results emphasize the role of genetic interactions in Hcy levels. (C) 2008 Wiley-Liss, Inc.

Spectrum and Prevalence of FP/TMEM127 Gene Mutations in Pheochromocytomas and Paragangliomas

Context Pheochromocytomas and paragangliomas are genetically heterogeneous neural crest-derived neoplasms. We recently identified germline mutations of the novel transmembrane-encoding gene FP/TMEM127 in familial and sporadic pheochromocytomas consistent with a tumor suppressor effect. Objectives To examine the prevalence and spectrum of FP/TMEM127 mutations in pheochromocytomas and paragangliomas and to test the effect of mutations in vitro. Design, Setting, and Participants We sequenced the FP/TMEM127 gene in 990 individuals with pheochromocytomas and/or paragangliomas, including 898 previously unreported cases without mutations in other susceptibility genes from 8 independent worldwide referral centers between January 2009 and June 2010. A multiplex polymerase chain reaction-based method was developed to screen for large gene deletions in 545 of these samples. Confocal microscopy of 5 transfected mutant proteins was used to determine their subcellular localization. Main Outcome Measures The frequency and type of FP/TMEM127 mutation or deletion was assessed and correlated with clinical variables; the subcellular localization of 5 overexpressed mutants was compared with wild-type FP/TMEM127 protein. Results We identified 19 potentially pathogenic FP/TMEM127 germline mutations in 20 independent families, but no large deletions were detected. All mutation carriers had adrenal tumors, including 7 bilateral (P=2.7 x 10(-4)) and/or with familial disease (5 of 20 samples; P=.005). The median age at disease onset in the FP/TMEM127 mutation group was similar to that of patients without a mutation (41.5 vs 45 years, respectively; P=.54). The most common presentation was that of a single benign adrenal tumor in patients older than 40 years. Malignancy was seen in 1 mutation carrier (5%). Expression of 5 novel FP/TMEM127 mutations in cell lines revealed diffuse localization of the mutant proteins in contrast with the discrete multiorganelle distribution of wild-type TMEM127. Conclusions Germline mutations of FP/TMEM127 were associated with pheochromocytoma but not paraganglioma and occured in an age group frequently excluded from genetic screening algorithms. Disease-associated mutations disrupt intracellular distribution of the FP/TMEM127 protein. JAMA. 2010;304(23):2611-2619 www.jama.com

High sucrose intake in rats is associated with increased ACE2 and angiotensin-(1-7) levels in the adipose tissue

Sucrose-fed rats, a model of metabolic syndrome, are characterized by insulin resistance, obesity, hypertension, and high plasma levels of triacylglycerols and angiotensin II (Ang II). However, whether tissue renin-angiotensin system (RAS) is altered in metabolic syndrome is unclear. To study this issue, food ad libitum and water (C) or 20% sucrose solution (SC) were given to adult male Wistar rats, for 30 days. Body weight (BW), blood pressure (BP), epididymal adipose tissue (EPI) mass, rate of in vivo fatty acid (FA) synthesis in EPI, circulating glucose, insulin, leptin, angiotensins I and II, triacylglycerols, and plasma renin (PRA) and angiotensin-converting enzyme (ACE) activities were evaluated. In kidneys and EPI, gene and protein expression of type 1 (AT(1)) and 2 (AT(2)) Ang II receptors, ACE, angiotensinogen (ACT) as well as protein expression of angiotensin-converting enzyme 2 (ACE2) were determined. In both tissues, Ang I, Ang II and Ang-(1-7) contents were also measured by HPLC. In SC rats higher BP, EPI mass, circulating triacylglycerols, insulin, leptin, PRA and, Ang II were found. In EPI, the rate of in vivo FA synthesis was associated with increased Ang-(1-7), protein expression of AT(1) and AT(2) receptors, ACE2, ACT, and gene expression of ACT although a reduction in ACE activity and in adipose Ang I and Ang II contents was observed. In kidneys, AT(1) and AT(2), ACE and ACT gene and protein expression as well as protein expression of ACE2 were unaltered while Ang II, Ang-(1-7) and ACE activity increased. These RAS component changes seem to be tissue specific and possibly are related to enhancement of FA synthesis, EPI mass and hypertension. (C) 2010 Elsevier B.V. All rights reserved.

A novel method for development of species and strain-specific DNA probes and PCR primers for identifying Burkholderia solanacearum (formerly Pseudomonas solanacearum)

Six Burkholderia solanacearum (formerly Pseudomonas solanacearum) genomic DNA fragments were isolated, using RAPD techniques and cloning, from the three genetically diverse strains: ACH092 (Biovar 4), ACH0158 (Biovar 2) and ACH0171 (Biovar 3) (1). One of these cloned fragments was selected because it was present constantly in all bacterial strains analysed. The remaining five clones were selected because Southern hybridisation revealed that each showed partial or complete specificity towards the strain of origin. A seventh genomic fragment showing a strain-specific distribution in Southern hybridisations was obtained by differential restriction, hybridisation and cloning of genomic DNA. Each of these clones was sequenced and primers to amplify the insert were designed. When DNA from the strain of origin was used as template, PCR amplification for each of these fragments yielded a single band on gel analysis. One pair of primers amplified the species-constant fragment of 281 bp from DNA of all B. solanacearum strains investigated, from DNA of the closely related bacterium which causes ''blood disease'' of banana (BDB) and in P. syzigii. The sensitivity of detection of B. solanacearum using these ubiquitous primers was between 1.3 and 20 bacterial cells. The feasibility and reliability of a PCR approach to detection and identification of B. solanacearum was tested in diverse strains of the bacterium in several countries and laboratories.

Interleukin-1 receptor antagonist gene (IL1RN) polymorphism possibly associated to severity of rheumatic carditis in a Brazilian cohort

Aims: To evaluate the IL1RN polymorphism as a possible marker for Rheumatic Fever (RF) susceptibility or disease severity. Methods: The genotypes of 84 RF patients (Jones criteria) and 84 normal race-matched controls were determined through the analysis of the number of 86-bp tandem repeats in the second intron of IL1RN. The DNA was extracted from peripheral-blood leukocytes and amplified with specific primers. Clinical manifestations of RF were obtained through a standardized questionnaire and an extensive chart review. Carditis was defined as new onset cardiac murmur that was perceived by a trained physician with corresponding valvae regurgitation or stenosis on echocardiogram. Carditis was classified as severe in the presence of congestive heart failure or upon the indication for cardiac surgery. The statistical association among the genotypes, RF and its clinical variations was determined. Results: The presence of allele I and the genotype A1/A1 were found less frequently among patients with severe carditis when compared to patients without this manifestation (OR = 0.11, p = 0.031; OR = 0.092, p = 0.017). Neither allele I nor allele 2 were associated with the presence of RF (p = 0.188 and p = 0.106), overall carditis (p = 0.578 and p = 0.767), polyarthritis (p = 0.343 and p = 0.313) and chorea (p = 0.654 and p = 0.633). Conclusion: In the Brazilian population, the polymorphism of the IL-1ra gene is a relevant factor for rheumatic heart disease severity. (C) 2009 Elsevier Ltd. All rights reserved.

Effects of high-intensity aerobic interval training vs. moderate exercise on hemodynamic, metabolic and neuro-humoral abnormalities of young normotensive women at high familial risk for hypertension

Exercise training has an important role in the prevention and treatment of hypertension, but its effects on the early metabolic and hemodynamic abnormalities observed in normotensive offspring of hypertensive parents (FH+) have not been studied. We compared high-intensity interval (aerobic interval training, AIT) and moderate-intensity continuous exercise training (CMT) with regard to hemodynamic, metabolic and hormonal variables in FH+ subjects. Forty-four healthy FH+ women (25.0+/-4.4 years) randomized to control (ConFH+) or to a three times per week equal-volume AIT (80-90% of VO(2MAX)) or CMT (50-60% of VO(2MAX)) regimen, and 15 healthy women with normotensive parents (ConFH-; 25.3+/-3.1 years) had their hemodynamic, metabolic and hormonal variables analyzed at baseline and after 16 weeks of follow-up. Ambulatorial blood pressure (ABP), glucose and cholesterol levels were similar among all groups, but the FH+ groups showed higher insulin, insulin sensitivity, carotid-femoral pulse wave velocity (PWV), norepinephrine and endothelin-1 (ET-1) levels and lower nitrite/ nitrate (NOx) levels than ConFH- subjects. AIT and CMT were equally effective in improving ABP (P<0.05), insulin and insulin sensitivity (P<0.001); however, AIT was superior in improving cardiorespiratory fitness (15 vs. 8%; P<0.05), PWV (P<0.01), and BP, norepinephrine, ET-1 and NOx response to exercise (P<0.05). Exercise intensity was an important factor in improving cardiorespiratory fitness and reversing hemodynamic, metabolic and hormonal alterations involved in the pathophysiology of hypertension. These findings may have important implications for the exercise training programs used for the prevention of inherited hypertensive disorder. Hypertension Research (2010) 33, 836-843; doi:10.1038/hr.2010.72; published online 7 May 2010

Age-dependent increase in blood pressure in two different Native American communities in Brazil

Objective Cardiovascular risk factors were surveyed in two Indian populations (Guarani, n=60; Tupinikin, n=496) and in a non-Indian group (n=114) living in the same reserve in southeast Brazilian coast. The relationship between an age-dependent blood pressure (BP) increase with salt consumption was also investigated. Methods Overnight (12 h) urine was collected to evaluate Na excretion. Fasting glucose and lipids, anthropometry, BP, ECG and carotid-femoral pulse wave velocity (PWV) were measured in a clinic visit. Participation (318 men/352 women, age 20-94 years; mean=37.6 +/- 14.9 years) comprised 80% of the eligible population. Results The prevalence of hypertension, diabetes and high cholesterol was similar in Tupinikins and in non-Indians and higher than in Guaranis. The prevalence of smoking and obesity was higher in the latter group. Hypertension and diabetes were detected in only one individual of the Guarani group. Mean BP adjusted to age and BMI was significantly lower (P<0.01) in Guaranis (82.8 +/- 1.6 mmHg) than in Tupinikins (92.3 +/- 0.5 mmHg) and non-Indians (91.6 +/- 1.1 mmHg). Urinary Na excretion (mEq/12h), however, was similar in the three groups (Guarani=94 +/- 40; Tupinikin=105 +/- 56; non-Indian=109 +/- 55; P>0.05). PWV (m/s) was lower (P<0.01) in Guarani (7.5 +/- 1.4) than in Tupinikins (8.8 +/- 2.2) and non-Indians (8.4 +/- 2.0). Multiple regression analysis showed that age and waist-to-hip ratio (WHR) were independent predictors of SBP and DBP (r(2)=0.44) in Tupinikins, whereas the WHR was the unique independent predictor of BP variability in Guaranis (r(2)=0.22). Conclusion Lower BP levels in Guaranis cannot be explained by low salt intake observed in other primitive populations. J Hypertens 27:1753-1760 (C) 2009 Wolters Kluwer Health vertical bar Lippincott Williams & Wilkins.

Insertion/deletion polymorphism of the bradykinin type 2 receptor gene influence diastolic blood pressure

The contribution of kinins to the beneficial effects in cardiovascular risk reductions remains unclear. In this context, the present study examined whether the +9bp/-9 bp polymorphism in bradykinin type 2 receptor gene, predicts hypertension risk in a large urban Brazilian population. Our finding indicated that the -9 bp allele may contribute to hypertension because of increased diastolic pressure.

Determinants of left ventricular mass and presence of metabolic risk factors in normotensive individuals

Background: Insulin resistance and obesity are recognized as left ventricular (LV) mass determinants independent of blood pressure (BP). Prevalence of LV hypertrophy (LVH) and the relationship between LV mass to body composition and metabolic variables were evaluated in normotensive individuals as participants of a population-based study. Methods: LV mass was measured using the second harmonic image by M-mode 2D guided echocardiography in 326 normotensive subjects (mean 47 +/- 9.4 years). Fasting serum lipids and glucose, BP, body composition and waist circumference (WC) were recorded during a clinic visit. Results: Applying a normalization criterion not related to body weight (g/height raised to the power 2.7) and the cut-off points of 47.7 (men) and 46.6 g/m(2.7) (women), LVH was found in 7.9% of the sample. Univariate analysis showed LV mass (g/m(2.7)) related to age, body mass index (BMI), WC, fat and lean body mass, systolic and diastolic BP, and metabolic variables (cholesterol, HDL-c, triglycerides and glucose). In multivariate analysis only BMI and age-adjusted systolic BP remained as independent predictors of LV mass, explaining 31% and 5% of its variability. Removing BMI from the model, WC, age-adjusted systolic BP and lean mass remained independent predictors, explaining 25.0%, 4.0% and 1.5% of LV mass variability, respectively. After sex stratification, LV mass predictors were WC (8%) and systolic BP (5%) in men and WC (36%) and systolic BP (3%) in women. Conclusion: BMI in general and particularly increased abdominal adiposity (WC as surrogate) seems to account for most of LV mass increase in normotensive individuals, mainly in women. (C) 2008 Elsevier Ireland Ltd. All rights reserved.

Acute effects of continuous and interval aerobic exercise on 24-h ambulatory blood pressure in long-term treated hypertensive patients

Background: Despite antihypertensive therapy, it is difficult to maintain optimal systemic blood pressure (BP) values in hypertensive patients (HPT). Exercise may reduce BP in untreated HPT. However, evidence regarding its effect in long-term antihypertensive therapy is lacking. Our purpose was to evaluate the acute effects of 40-minute continuous (CE) or interval exercise (IE) using cycle ergometers on BP in long-term treated HPT. Methods: Fifty-two treated HPT were randomized to CE (n=26) or IE (n=26) protocols. CE was performed at 60% of reserve heart rate (HR). IE alternated consecutively 2 min at 50% reserve HR with 1 min at 80%. Two 24-h ambulatory BP monitoring were made after exercise (postexercise) or a nonexercise control period (control) in random order. Results: CE reduced mean 24-h systolic (S) BP (2.6 +/- 6.6 mm Hg, p-0.05) and diastolic (D) BP (2.3 +/- 4.6, p-0.01), and nighttime SBP (4.8 +/- 6.4, p < 0.001) and DBP (4.6 +/- 5.2 mm Hg, p-0.001). IE reduced 24-h SBP (2.8 +/- 6.5, p-0.03) and nighttime SBP (3.4 +/- 7.2, p-0.02), and tended to reduce nighttime DBP (p=0.06). Greater reductions occurred in higher BP levels. Percentage of normal ambulatory BP values increased after CE (24-h: 42% to 54%; daytime: 42% to 61%; nighttime: 61% to 69%) and IE (24-h: 31% to 46%; daytime: 54% to 61%; nighttime: 46% to 69%). Conclusion: CE and IE reduced ambulatory BP in treated HPT, increasing the number of patients reaching normal ambulatory BP values. These effects suggest that continuous and interval aerobic exercise may have a role in BP management in treated HPT. (c) 2008 Elsevier Ireland Ltd. All rights reserved.

Congenic strains provide evidence that four mapped loci in chromosomes 2, 4, and 16 influence hypertension in the SHR

Aneas I, Rodrigues MV, Pauletti BA, Silva GJ, Carmona R, Cardoso L, Kwitek AE, Jacob HJ, Soler JM, Krieger JE. Congenic strains provide evidence that four mapped loci in chromosomes 2, 4, and 16 influence hypertension in the SHR. Physiol Genomics 37: 52-57, 2009. First published January 6, 2009; doi: 10.1152/physiolgenomics.90299.2008. - To dissect the genetic architecture controlling blood pressure (BP) regulation in the spontaneously hypertensive rat (SHR) we derived congenic rat strains for four previously mapped BP quantitative trait loci (QTLs) in chromosomes 2, 4, and 16. Target chromosomal regions from the Brown Norway rat (BN) averaging 13 - 29 cM were introgressed by marker-assisted breeding onto the SHR genome in 12 or 13 generations. Under normal salt intake, QTLs on chromosomes 2a, 2c, and 4 were associated with significant changes in systolic BP (13, 20, and 15 mmHg, respectively), whereas the QTL on chromosome 16 had no measurable effect. On high salt intake (1% NaCl in drinking water for 2 wk), the chromosome 16 QTL had a marked impact on SBP, as did the QTLs on chromosome 2a and 2c (18, 17, and 19 mmHg, respectively), but not the QTL on chromosome 4. Thus these four QTLs affected BP phenotypes differently: 1) in the presence of high salt intake (chromosome 16), 2) only associated with normal salt intake (chromosome 4), and 3) regardless of salt intake (chromosome 2c and 2a). Moreover, salt sensitivity was abrogated in congenics SHR. BN2a and SHR. BN16. Finally, we provide evidence for the influence of genetic background on the expression of the mapped QTLs individually or as a group. Collectively, these data reveal previously unsuspected nuances of the physiological roles of each of the four mapped BP QTLs in the SHR under basal and/or salt loading conditions unforeseen by the analysis of the F2 cross.

Evaluation of the cytogenetic effects of I-131 preceded by recombinant human thyrotropin (rhTSH) in peripheral lymphocytes of Wistar rats

The present study was carried out to investigate the cytogenetic effects of therapeutic exposure to radioiodine preceded by rhTSH in an animal model. Three groups of Wistar rats (n = 6) were used: one group was treated only with I-131 (11.1 MBq/animal); the other two groups received rhTSH (1.2 mu g/rat of either Thyrogen or rhTSH-IPEN, respectively) 24 h before administration of radioiodine. The percentage of lymphocytes with chromosome aberrations and the average number of aberrations and of dicentrics per cell were determined on blood samples collected 24 h, 7 and 30 days after administration of I-131. The data show that the treatment with radioiodine alone or associated with rhTSH resulted in a greater quantity of chromosome alterations in relation to basal values after 24 h, with a gradual decline after 7 and 30 days of treatment. An increase in chromosome alterations was also seen after rhTSH treatment alone. Neither of the treatments, i.e., with I-131 alone or associated with hormone, resulted in an aneugenic effect or influenced the kinetics of cellular proliferation in rat blood lymphocytes. There was no significant difference between the cytogenetic effects of Thyrogen and rhTSH-IPEN treatment. These data suggest that the treatment with radioiodine, associated or not with rhTSH, affects to a limited extent a relatively small number of cells although the occurrence of late stochastic effects could not be discarded.